Supplementary Material. Levels of S100B protein drive the reparative process in acute muscle injury and muscular dystrophy
|
|
- Ursula Richardson
- 6 years ago
- Views:
Transcription
1 Supplementary Material Levels of protein drive the reparative process in acute muscle injury and muscular dystrophy Francesca Riuzzi 1,4 *, Sara Beccafico 1,4 *, Roberta Sagheddu 1,4, Sara Chiappalupi 1,4, Ileana Giambanco 1, Oxana Bereshchenko, Carlo Riccardi, Guglielmo Sorci 1,4 and Rosario Donato 1,3,4 1 Department of Experimental Medicine, Department of Medicine, 3 Centro Universitario per la Ricerca sulla Genomica Funzionale, 4 Istituto Interuniversitario di Miologia, Perugia Medical School, University of Perugia, Piazza Lucio Severi 1, 613 Perugia, Italy 1
2 Supplementary Materials and Methods Supplementary Table 1 Primary antibodies used in immunohistochemistry and immunofluorescence Antibodies Host animal Dilution Source Mouse 1:5 R&D Systems MyoD clone Santa Cruz Mouse 1:5 5.8A Myogenin Mouse 1:5 Santa Cruz RAGE Goat 1:5 Santa Cruz Ki67 Mouse 1: Cell Signaling Technology Collagen IV Rabbit 1:4 Novus Biologicals Rat 1:5 BD Biosciences CD163 Rabbit 1: Bioss NOS Rabbit 1:1 Santa Cruz Mouse 1:1 BD Biosciences FGFR1 Mouse 1:1 Chemicon Secondary antibodies used in immunofluorescence Host Against Fluorophore Dilution Source Donkey Mouse Alexa Fluor 488 1: Invitrogen Donkey Rabbit Alexa Fluor 488 1: Invitrogen Donkey Rabbit Alexa Fluor 594 1: Invitrogen Donkey Rat Alexa Fluor 594 1: Invitrogen
3 Supplementary Table Primary antibodies used in Western blotting Antibodies Host animal Dilution Source Mouse 1:5 R&D Systems MyoD clone 5.8A Mouse 1:1 Santa Cruz Myogenin Mouse 1:1 Santa Cruz RAGE Goat 1:1 Santa Cruz emyhc Mouse 1:5 Monosan Ciclin D1 Rabbit 1:1 Santa Cruz Collagen IV Rabbit 1: Novus Biologicals Rat 1:1 BD Biosciences CD163 Rabbit 1:1 Bioss NOS Rabbit 1:1 Santa Cruz Mouse 1:5 BD Biosciences FGFR1 Mouse 1:1 Chemicon phosphorylated- Mouse 1:1 Santa Cruz Tyr clone PY phosphorylated- (Thr18/Tyr18) p38 MAPK) phosphorylated (Thr/Tyr4) ERK1/ polyclonal ERK1/ phosphorylated ( Se473) Akt phosphorylated (Ser536) NFκB(p65) Rabbit 1:1 Cell Signaling Technology Rabbit 1:1 Cell Signaling Technology Rabbit 1: Sigma Aldrich Rabbit 1:1 Cell Signaling Technology Rabbit 1:1 Cell Signaling Technology NF-κB(p65) Rabbit 1:1 Santa Cruz Mouse 1:5 Santa Cruz α-tubulin Mouse 1:1 Sigma-Aldrich 3
4 Supplementary Table 3 Oligonucleotide primers for real-time PCR Target Gene Accession number Primer Sequence (5-3 ) Il1b NC_68.7 Fwd: TGACGTTCCCATTAGACAACTG Rev: CCGTCTTTCATTACACAGGACA Il4 NC_77.6 Fwd: ATTTTGAACGAGGTCACAGGAGAAG Rev: ACCTTGGAAGCCCTACAGACGAG Il6 M_31168 Fwd: GAACAACGATGATGCACTTGC Rev: CTTCATGTACTCCAGGTAGCTATGGT Il1 NM_1548. Fwd: CAAGGAGCATTTGAATTCCC Rev: GGCCTTGTAGACACCTTGGTC Il1Ra NC_75.6 Fwd: TCATTGCATACGGGACAGAA Rev: TGGATGTCATTCCAGGTTGA Il1a NC_69.6 Fwd: CGCAGCACTTCAGAATCACA Rev: TCTCCCACAGGAGGTTTCTG Tnfa NM_13693 Fwd:TCTTCTGTCTACTGAACTTCGGGGTGA Rev: GTGGTTTGCTACGACGTGGGCTA Nos NM_197 Fwd: AGCCAAGCCCTCACCTACTT Rev: TCTCTGCCTATCCGTCTCGT Arg1 NM_748 Fwd: CAATGAAGAGCTGGCTGGTGT Rev: GTGTGAGCATCCACCCAAATG Mrc1 NC_68.7 Fwd: TCTTTGCCTTTCCCAGTCTCC Rev: TGACACCCAGCGGAATTTC Cd68 NC_77.6 Fwd: CAAAGCTTCTGCTGTGGAAAT Rev: GACTGGTCACGGTTGCAAG Gapdh NM_884. Fwd: GCCTTCCGTGTTCCTACCC Rev: CAGTGGGCCCTCAGATGC Ifng NM_ Fwd: GACAATCAGGCCATCAGCAAC Rev: CGGATGAGCTCATTGAATGCTT Cd86 NM_ Fwd: TTGTGTGTGTTCTGGAAACGGAG Rev: AACTTAGAGGCTGTGTTGCTGGG Cd163a NM_5394. Fwd: GCAAAAACTGGCAGTGGG Rev: GTCAAAATCACAGACGGAGC Tgfb NM_ Fwd: GAGACGGAATACAGGGCTTTC Rev: TCTCGTGGAGCTGAAGCAAT Ccl NC_519.4 Fwd: GCTCAGCCAGATGCAGTTAAC Rev: CTCTCTCTTGAGCTTGGTGAC Ccr NC_75.6 Fwd: CCTGTAAATGCCATGCAAGTTC Rev: GTATGCCGTGGATGAACTGAG Dursp1 NC_715.6 Fwd: CAGATTAGGAGCAGCGAGC Rev: AAAGCGAAGAAGGAGCGAC S1b NC_76.6 Fwd: TGGCTGCGGAAGTTGAGATT Rev: GAAGGGGGTTGGGGTTTCAT 4
5 Supplementary Results Figure S1. Blocking early after acute muscle injury delays regeneration. (a) and S1A1 (5 μg each) were run on SDS polyacrylamide gels (15%) and either stained with blue Coomassie (top panel) or transferred onto nitrocellulose paper for western blotting using a polyclonal antibody (Abcam No. ab41548) (bottom panel). (b) CC1 myoblasts were cultured in differentiation medium in the absence or presence of ng /ml ± increasing doses of a polyclonal antibody (Abcam No. ab41548), as indicated, and left undisturbed for days. Then, cells were lysed and cell lysates were subjected to western blotting for detection of the late myogenic marker, embryonic myosin heavy chain (emyhc) (bottom panel). Immunoblots of α-tubulin are included as loading controls. Results are means ± SEM from three experiments (upper panel). *p<.5, p<.1, p<.1 vs. control. (c) TA muscles were injected with at d, followed by injection with or antibody at d1 p.i. Treated muscle were excised at d3 and d7 p.i. for analyses. (d,e) +, MyoD+, +, Ki67 +, and RAGE + cells were detected at d3 (d) and at d7 (e) p.i. in muscles by immunohistochemistry. The scale bar represents 5 μm in (d and e). Figure S. affects macrophages in acutely injured muscles. (a) TA muscles were treated as described in the legend to Fig a. Muscles were excised at d3 or d7 p.i. (b) Macrophages were detected by immunohistochemistry. (c) Immunofluorescence detection of in macrophages isolated at d3 p.i. from muscles treated with or antibody. (d) Homogenates of muscles excised at d3 or d7 p.i. were subjected to western blotting. Immunoblots of are included as loading controls. (e) Double inos/ and CD163/ immunofluorescence at day 7 p.i. of muscles treated with or antibody at day 1 p.i. Nuclei were counterstained with DAPI. Merged images are shown. Note in -treated muscles the high number of macrophages (red channel) and the co-existence of inos + (M1) and CD163 + (M) macrophages as opposed to the almost complete absence of M1 macrophages and the low number of M macrophages in -treated (control) muscles. Arrows point to double inos + / + (M1) and CD163 + / + (M) macrophages. (f) staining of injured muscles. (g) Peritoneal macrophages were cultured for 4 h in the absence and presence of either, IFN-γ, IL-1 or IL-4 and analyzed by real-time PCR. (h) Macrophages isolated at d3 and d7 p.i. from injured muscles and analyzed for S1b levels by real-time PCR. (i) Detection of in activated ( + ) macrophages and in M1 (inos + ) and M (CD163 + ) macrophages by double immunofluorescence in injured muscles. Nuclei were counterstained with DAPI. The scale bar represents 5 μm in b and f and 1 μm in e and i. Figure S3. regulates muscle regeneration by acting on both myoblasts and macrophages. (a) Mice were intraperitoneally injected with vehicle or clodronate. Injured TA muscles were injected with 5
6 or antibody (day 1 p.i.). Treated muscle were excised at d3 p.i. (b) Histology of muscle tissue (upper panel) and counts of interstitial cells (lower panel). (c) immunohistochemistry (upper panels) and + cell counts (lower panel). (d) Western blots of, CD163 and inos in muscle homogenates. Immunoblots of are included as loading controls. (e) staining. (f) +, MyoD +, + and Ki67 + cell counts. (g) +, MyoD +, + and Ki67 + cells were detected at d3 by immunohistochemistry. Results are means ± SEM from at least six animals. *p<.5, p<.1, p<.1 vs. control. ##p<.1 (clodronate-treated vs. vehicle, b and f). The scale bar in (b, c and e) represents 5 μm. Figure S4. is required during the macrophage M phase for efficient regeneration. (a) Injured TA muscles were injected with or antibody at d4 p.i. Treated muscle were excised at d7 or d14 p.i. (b) +, MyoD+, +, Ki67 +, and + cells were detected at d7 and at d14 p.i. in muscles by immunohistochemistry. (c) staining of injured muscles and collagen IV detection by immunohistochemistry of - and -treated injured muscles at d7. The scale bar represents 5 μm. Figure S5. s ability to promote regeneration of acutely injured skeletal muscles requires RAGE at early, but not mid-late regeneration phase. (a) Macrophages were isolated from wild type and Ager / TA muscles at d7 p.i. and analyzed for expression levels of the indicated genes by real-time PCR. Results are expressed as fold-change of gene expression levels in Ager / vs. wild type macrophages. (b) Injured Ager / TA muscles were injected with or antibody at d1 p.i and excised at d3 or d5 p.i. (c) ) Histology (upper panel) and counts of interstitial cells and centrally nucleated myofibers (lower panel). (d) +, MyoD +, +, + and Ki67 + cell counts. (e) Macrophages isolated at d3 from - and -treated injured Ager / muscles and analyzed by real-time PCR. (f) Peritoneal macrophages from Ager / mice subjected to a migration assay using Boyden chambers in the presence of increasing doses. (g,h) Ager / TA muscles were injected with BaCl at day, followed by injection with or antibody at d4 p.i. and excision at d7 p.i. (g) for histology and collagen IV immunohistochemistry (h). (i) +, MyoD +, +, Ki67 +, and + cells were detected at d7 p.i. by immunohistochemistry. Shown are representative images. The scale bar represents 5 μm. Figure S6. Late blockade of results in altered bfgf/fgfr1 signaling. (a,b) Conditions were as in Fig 5c (a). Ager / muscles were excised at d7 p.i. and analyzed for +, MyoD +, +, Ki67 +, and + cells by immunohistochemistry (b). Shown are representative images. The scale bar represents 5 μm. (c) Same as in a except that macrophages isolated from injured muscles were analyzed for levels of 6
7 proinflammatory and antiinflammatory markers by real-time PCR. (d) Macrophages isolated at d4 p.i. from injured Ager / muscles were incubated for 3 min in the absence or presence of ( ng/ml) and lysed. Cell lysates were subjected to immunoprecipitation with antibody and immunoprecipitates were probed with and FGFR1 antibodies. Figure S7. Full-length blots of cropped blots from the manuscript (relative to Figures 1-3). Figure S8. Full-length blots of cropped blots from the manuscript (relative to Figures 4-7). 7
8 a M 5 µg S1A1 5 µg b.5 CC1, 48 h DM emyhc 1, ng/ml µg/ml tubulin c Treatment Harvest Harvest C57Bl/6 Day 1 p.i. d MyoD Ki67 RAGE MyoD Ki67 RAGE Day 7 post- injury Day 3 post- injury e 96±.5 97±1. Figure S1
9 a C57Bl/6 b Treatment d1 p.i. Harvest Harvest d3 p.i. d7 p.i., day 3 p.i., day 7 p.i. g Relative Quantity, a.u , ng/ml IFN-γ, 1 ng/ml IL-1, 1 ng/ml IL-4, ng/ml Arg MØ, 4h Relative Quantity, a.u. 6 4 Cd163a Relative Quantity, a.u , ng/ml IFN-γ, 1 ng/ml IL-1, 1 ng/ml IL-4, ng/ml Nos Relative Quantity,a.u Cd c -treated muscle MØ -treated muscle MØ h MØ /DAPI d 9 inos CD163 i //DAPI Relative Quantity, a.u S1b 3 7 Day post-injury /inos/dapi Day 5 p.i. /CD163/DAPI 1 α- actinin e Day 7 post-injury inos //dapi CD163//dapi -treated -treated * f staining, day 7 p.i Figure S
10 a C57Bl/6 or clodronate Treatment Harvest b H&E, day 3 p.i. Clodronate -1 d1 p.i. d3 p.i. d 9 CD163 inos e staining, day 3 p.i. Clodronate Interstitial cells/field Clodronate ## MyoD Myogenin Ki67 c, day 3 p.i. Clodronate g + cells/field Clodronate f Mononucletaed cells + /field 15 Ki Clodronate ## ## MyoD * ## ## ## ## ## Clodronate ## Figure S3
11 a Treatment C57Bl/6 Harvest Harvest Day 4 p.i. Day 14 p.i. b MyoD Ki67 c staining Collagen IV Day 7 post- injury MyoD Ki67 Day 14 post- injury Figure S4
12 a f Expression levels in Ager -/- vs. wild type MØ, fold change Nos Cd68 Ifng Il-6 Tnfa MØ, day 7 p.i. Cd86 Il-1β Il-1a Arg1 Cd163a Il-4 Il-1R1 Mrc1 Il-1 tgfb MØ, 4h μg/ml.. 4 Migrated cells/field b g Treatment Harvest Harvest Treatment Harvest Ager -/- Ager -/- Day 1 p.i. Day 5 p.i. Day 4 p.i. c H&E, day 3 p.i. H&E, day 5 p.i. h H&E Collagen IV Interstitial cells/field d e Relative Quantity Nos Cd68 Ifng Tnfa Il6 Arg1 Cd163a Il4 Il1R1 Il1 Tgfb 3 1 Interstitial cells/field Centrally nucleated myofibers/field Day 5 p.i. Day 5 p.i. i MyoD Positive cells/ field Day 3 post-injury Positive cells/ field Day 5 post-injury Ki67 Relative Quantity Figure S5
13 a DMSO or SU54 Ager -/- Treatment Harvest b Day 4 p.i. Day 5 p.i. Day 6 p.i. MyoD Ki67 Day 7 post- injury SU54 + SU54+ DMSO c Expression levels in - vs. - MØ, fold change Nos Cd68 Ifng Il6 Tnfa MØ, day 7 p.i. Cd86 Il1β Il1a Arg1 Cd163a Il4 Il1R1 Mrc1 Il1 Tgfb d MØ Ager -/-, day 4 p.i. IP: Input IP 1 WB:FGFR1 WB: Figure S6
14 GAPDH 18 MyoD cyclin D1 emyhc 18 RAGE 18 d Figure 1 MyoD cyclin D emyhc 18 RAGE GAPDH 18 Figure 1 pho-p65 p65 pho-p38 pho-erk1/ ERK1/ pho-akt tubulin g tubulin MØ, day 3 p.i. Figure 18 Collagen IV 17 1 i l 18 Figure Figure m Figure MØ-conditioned media MØ-conditioned media None IL tubulin None IL MyoD cyclin D1 emyhc 18 d GAPDH 18 Figure 3 #5 #6 GAPDH #5 #6 Figure S7
15 Figure 4 Figure 5 Figure 6 Figure 6 MyoD f pho-tyr a FGFR c MyoD 3X X #5 #6 #7 #8 3X X #5 #6 #7 #8 Collagen IV f 3X #5 3X #5 ogenin emyhc clin D g inos 18 CD163 Figure 7 C57/Bl1 mdx #5 #6 C57/Bl1 mdx #5 #6 C57/Bl1 mdx #5 #6 C57/Bl1 mdx #5 #6 emyhc 18 cyclin D1 GAPDH 3X X #5 #6 #7 #8 3X X #5 #6 #7 #8 3X X #5 #6 #7 #8 3X X #5 #6 #7 # #5 a b 3X Figure 7 Conditioned media C57/Bl1 mdx M #5 C57/Bl1 mdx M #5 18 -actinin APDH 18 C57/Bl1 mdx #5 #6 C57/Bl1 mdx #5 #6 RAGE 18 3X #5 #6 #7 #8 3X #5 X 17 1 GAPDH C57/Bl1 mdx #5 #6 3X #5 GAPDH GAPDH Figure S8
Isolation, culture, and transfection of primary mammary epithelial organoids
Supplementary Experimental Procedures Isolation, culture, and transfection of primary mammary epithelial organoids Primary mammary epithelial organoids were prepared from 8-week-old CD1 mice (Charles River)
More informationSupplementary Figure 1: Derivation and characterization of RN ips cell lines. (a) RN ips cells maintain expression of pluripotency markers OCT4 and
Supplementary Figure 1: Derivation and characterization of RN ips cell lines. (a) RN ips cells maintain expression of pluripotency markers OCT4 and SSEA4 after 10 passages in mtesr 1 medium. (b) Schematic
More informationSegments of the obstructed intestinal loops were fixed in 4% paraformaldehyde
Supplementary text Supplementary materials and methods Histopathological examination Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde (PFA) and embedded in paraffin wax with
More informationRespiratory distress and early neonatal lethality in Hspa4l/Hspa4 double mutant mice
Respiratory distress and early neonatal lethality in Hspa4l/Hspa4 double mutant mice Belal A. Mohamed, Amal Z. Barakat, Torsten Held, Manar Elkenani, Christian Mühlfeld, Jörg Männer, and Ibrahim M. Adham
More informationSUPPLEMENTARY INFORMATION. Integrin alpha 11 in regulation of myofibroblasts phenotype: Implication for fibrotic diseases
SUPPLEMENTARY INFORMATION Integrin alpha 11 in regulation of myofibroblasts phenotype: Implication for fibrotic diseases Ruchi Bansal 1, Shigeki Nakagawa 2, Saleh Yazdani 1, Joop van Baarlen 3, Anu Venkatesh
More informationSupplementary Information. Title BRD3 and BRD4 BET Bromodomain Proteins Differentially Regulate Skeletal Myogenesis
Supplementary Information Title BRD3 and BRD4 BET Bromodomain Proteins Differentially Regulate Skeletal Myogenesis Authors Thomas C. Roberts 1,2, Usue Etxaniz 1, Alessandra Dall Agnese 1, Shwu-Yuan Wu
More informationFigure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion
Stem Cell Reports, Volume 1 Supplemental Information Robust Self-Renewal of Rat Embryonic Stem Cells Requires Fine-Tuning of Glycogen Synthase Kinase-3 Inhibition Yaoyao Chen, Kathryn Blair, and Austin
More informationSmooth Muscle-Specific Expression of ipla 2 β Participates in the Initiation and Early Progression of Vascular Inflammation and Neointima Formation
Smooth Muscle-Specific Expression of ipla 2 β Participates in the Initiation and Early Progression of Vascular Inflammation and Neointima Formation Shu Liu 1, Zhongwen Xie 2, Qingwei Zhao 2, Huan Pang
More informationDescription: Nuclear morphology and dynamics in nontargeting sirna transfected cells. HeLa Kyoto
Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Tables Title of file for HTML: Supplementary Movie 1 Description: Nuclear morphology and dynamics
More informationSupplementary Fig. S1. Schematic representation of mouse lines Pax6 fl/fl and mrx-cre used in this study. (A) To generate Pax6 fl/ fl
Supplementary Fig. S1. Schematic representation of mouse lines Pax6 fl/fl and mrx-cre used in this study. (A) To generate Pax6 fl/ fl, loxp sites flanking exons 3-6 (red arrowheads) were introduced into
More informationCell culture and drug treatment. Lineage - Sca-1+ CD31+ EPCs were cultured on
Supplemental Material Detailed Methods Cell culture and drug treatment. Lineage - Sca-1+ CD31+ EPCs were cultured on 5µg/mL human fibronectin coated plates in DMEM supplemented with 10% FBS and penicillin/streptomycin
More informationSupplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling
Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Glendining KA 1, Markie D 2, Gardner RJM 4, Franz EA 3, Robertson SP 4, Jasoni CL 1 Supplementary
More informationSANTA CRUZ BIOTECHNOLOGY, INC.
TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same
More informationRejuvenation of the muscle stem cell population restores strength to injured aged muscles
Rejuvenation of the muscle stem cell population restores strength to injured aged muscles Benjamin D Cosgrove, Penney M Gilbert, Ermelinda Porpiglia, Foteini Mourkioti, Steven P Lee, Stephane Y Corbel,
More informationFigure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab.
/ 36B4 mrna ratio Figure S1 * 2. 1.6 1.2.8 *.4 control TNFα BRL49653 Figure S2 Su bw AT p iw Anti- (COOH-terminal peptide) Ab Blot : Anti-GST-(45-127) Ab β-actin Figure S3 HB2 HW AT BA T Figure S4 A TAG
More informationThis Document Contains:
This Document Contains: 1. In-Cell Western Protocol II. Cell Seeding and Stimulation Supplemental Protocol III. Complete Assay Example: Detailing the Seeding, Stimulation and Detection of the A431 Cellular
More informationTechnical Note Detection of post-immunoprecipitation proteins by Western blot using the Quick Western Kit IRDye 680RD
Technical Note Detection of post-immunoprecipitation proteins by Western blot using the Quick Western Kit IRDye 680RD Developed for: Aerius, Odyssey Classic, Odyssey CLx and Odyssey Sa Imaging Systems
More informationSupplemental Information. Inflammatory Ly6C high Monocytes Protect. against Candidiasis through IL-15-Driven. NK Cell/Neutrophil Activation
Immunity, Volume 46 Supplemental Information Inflammatory Ly6C high Monocytes Protect against Candidiasis through IL-15-Driven NK Cell/Neutrophil Activation Jorge Domínguez-Andrés, Lidia Feo-Lucas, María
More informationManuscript Skeletal muscle Heat shock protein 60 increases after endurance training and induces peroxisome proliferator-activated
Supplementary informations Manuscript Skeletal muscle Heat shock protein 60 increases after endurance training and induces peroxisome proliferator-activated receptor gamma coactivator 1 α1 expression Rosario
More informationKostandin V. Pajcini, Stephane Y. Corbel, Julien Sage, Jason H. Pomerantz, and Helen M. Blau
Cell Stem Cell, Volume 7 Supplemental Information Transient Inactivation of Rb and ARF Yields Regenerative Cells from Postmitotic Mammalian Muscle Kostandin V. Pajcini, Stephane Y. Corbel, Julien Sage,
More informationSupporting Information
Supporting Information Cieslewicz et al. 10.1073/pnas.1312197110 SI Results Human and mouse lesions of atherosclerosis contain both M1 and M2 macrophage phenotypes (1, 2). Previous work has suggested the
More informationInitial genotyping of all new litters was performed by Transnetyx (Memphis,
SUPPLEMENTAL INFORMATION MURILLO ET AL. SUPPLEMENTAL EXPERIMENTAL PROCEDURES Mouse Genotyping Initial genotyping of all new litters was performed by Transnetyx (Memphis, USA). Assessment of LoxPpα recombination
More informationMayumi Egawa, Kaori Mukai, Soichiro Yoshikawa, Misako Iki, Naofumi Mukaida, Yohei Kawano, Yoshiyuki Minegishi, and Hajime Karasuyama
Immunity, Volume 38 Supplemental Information Inflammatory Monocytes Recruited to Allergic Skin Acquire an Anti-inflammatory M2 Phenotype via Basophil-Derived Interleukin-4 Mayumi Egawa, Kaori Mukai, Soichiro
More informationSUPPLEMENTAL INFORMATION
UTX/KDM6A demethylase activity is required for satellite cell-mediated muscle regeneration Hervé Faralli 1,2, Chaochen Wang 3, Kiran Nakka 1,2, Soji Sebastian 1,, Aissa Benyoucef 1,2, Lenan Zhuang 3, Alphonse
More informationSupplementary Figure 1
Supplementary Figure 1 Ex2 promotor region Cre IRES cherry pa Ex4 Ex5 Ex1 untranslated Ex3 Ex5 untranslated EYFP pa Rosa26 STOP loxp loxp Cre recombinase EYFP pa Rosa26 loxp 1 kb Interleukin-9 fate reporter
More informationCycles of vascular plexus formation within the nephrogenic zone of the developing mouse kidney
1 Supplementary text and data for: 2 3 4 5 Cycles of vascular plexus formation within the nephrogenic zone of the developing mouse kidney Authors: David A. D. Munro 1*, Peter Hohenstein 2, and Jamie A.
More informationSupplementary Figure Legend
Supplementary Figure Legend Supplementary Figure S1. Effects of MMP-1 silencing on HEp3-hi/diss cell proliferation in 2D and 3D culture conditions. (A) Downregulation of MMP-1 expression in HEp3-hi/diss
More informationCenter Drive, University of Michigan Health System, Ann Arbor, MI
Leukotriene B 4 -induced reduction of SOCS1 is required for murine macrophage MyD88 expression and NFκB activation Carlos H. Serezani 1,3, Casey Lewis 1, Sonia Jancar 2 and Marc Peters-Golden 1,3 1 Division
More informationWnt16 smact merge VK/AB
A WT Wnt6 smact merge VK/A KO ctrl IgG WT KO Wnt6 smact DAPI SUPPLEMENTAL FIGURE I: Wnt6 expression in MGP-deficient aortae. Immunostaining for Wnt6 and smooth muscle actin (smact) in aortae from 7 day
More informationsupplementary information
DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /
More informationSupplementary Information
Supplementary Information Supplementary Figure 1. ZBTB20 expression in the developing DRG. ZBTB20 expression in the developing DRG was detected by immunohistochemistry using anti-zbtb20 antibody 9A10 on
More informationGibco Life Technologies, Frederick, MD. Rockford, IL. R&D Systems, Minneapolis, 6057-NG-025. R&D Systems, Minneapolis,
Supplementary Table 1. Reagents Reagents were made up as concentrated stock and aliquots stored at -20 or -80. Reagent Source Catalog Number Recombinant Human IL1 Receptor PeproTech, Rocky Hill, NJ 200-01RA
More informationReal-time PCR. Total RNA was isolated from purified splenic or LP macrophages using
Supplementary Methods Real-time PCR. Total RNA was isolated from purified splenic or LP macrophages using the Qiagen RNeasy Mini Kit, according to the manufacturer s protocol with on-column DNase digestion
More informationSupplemental Material for
Supplemental Material for TXI TELNGIECTSI MUTTED (TM)-MEDITED DN DMGE RESPONSE IN OXIDTIVE STRESS-INDUCED VSCULR ENDOTHELIL CELL SENESCENCE Hong Zhan 1, Toru Suzuki 1,2, Kenichi izawa 1, Kiyoshi Miyagawa,
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Legends for Supplementary Tables. Supplementary Table 1. An excel file containing primary screen data. Worksheet 1, Normalized quantification data from a duplicated screen: valid
More informationSupplementary Table 1. The Q-PCR primer sequence is summarized in the following table.
Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of
More information(A) Schematic illustration of sciatic nerve ligation. P, proximal; D, distal to the ligation site.
SUPPLEMENTRY INFORMTION SUPPLEMENTL FIGURES Figure S1. () Schematic illustration of sciatic nerve ligation. P, proximal; D, distal to the ligation site. () Western blot of ligated and unligated sciatic
More informationTitle. CitationThe Journal of clinical investigation, 124(5): Issue Date Doc URL. Type. Additional There Information
Title Laminins affect T cell trafficking and allograft fat Author(s)Warren, Kristi J.; Iwami, Daiki; Harris, Donald G.; CitationThe Journal of clinical investigation, 124(): 224- Issue Date 214--1 Doc
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Dynamic Phosphorylation of HP1 Regulates Mitotic Progression in Human Cells Supplementary Figures Supplementary Figure 1. NDR1 interacts with HP1. (a) Immunoprecipitation using
More information1,500 1,000. LPS + alum. * * Casp1 p10. Casp1 p45
a NLRP3 Non-stimulation R46 BAY SI TAT LPS R46 BAY SI TAT 1,5 1, c 15 1 5 5 Pro-IL-18 Pro-IL-1 LPS + alum d e f IL-1 p17 Pro-IL-1 1 75 5 5 Casp1 p1 NLRP3 LPS + alum Supplementary Figure 1 Inhiition of
More informationSupplemental Materials. Matrix Proteases Contribute to Progression of Pelvic Organ Prolapse in Mice and Humans
Supplemental Materials Matrix Proteases Contribute to Progression of Pelvic Organ Prolapse in Mice and Humans Madhusudhan Budatha, Shayzreen Roshanravan, Qian Zheng, Cecilia Weislander, Shelby L. Chapman,
More informationThyroid peroxidase gene expression is induced by lipopolysaccharide involving Nuclear Factor (NF)-κB p65 subunit phosphorylation
1 2 3 4 5 SUPPLEMENTAL DATA Thyroid peroxidase gene expression is induced by lipopolysaccharide involving Nuclear Factor (NF)-κB p65 subunit phosphorylation Magalí Nazar, Juan Pablo Nicola, María Laura
More informationSupplemental figures Supplemental Figure 1: Fluorescence recovery for FRAP experiments depicted in Figure 1.
Supplemental figures Supplemental Figure 1: Fluorescence recovery for FRAP experiments depicted in Figure 1. Percent of original fluorescence was plotted as a function of time following photobleaching
More informationASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG
Supplemental Materials and Methods Plasmids: the following plasmids were used in the supplementary data: pwzl-myc- Lats2 (Aylon et al, 2006), pretrosuper-vector and pretrosuper-shp53 (generous gift of
More informationSupplemental Information Inventory
Cell Stem Cell, Volume 6 Supplemental Information Distinct Hematopoietic Stem Cell Subtypes Are Differentially Regulated by TGF-β1 Grant A. Challen, Nathan C. Boles, Stuart M. Chambers, and Margaret A.
More informationConfocal immunofluorescence microscopy
Confocal immunofluorescence microscopy HL-6 and cells were cultured and cytospun onto glass slides. The cells were double immunofluorescence stained for Mt NPM1 and fibrillarin (nucleolar marker). Briefly,
More informationNature Immunology: doi: /ni Supplementary Figure 1. Zranb1 gene targeting.
Supplementary Figure 1 Zranb1 gene targeting. (a) Schematic picture of Zranb1 gene targeting using an FRT-LoxP vector, showing the first 6 exons of Zranb1 gene (exons 7-9 are not shown). Targeted mice
More informationmcherry Monoclonal Antibody (16D7) Catalog Number M11217 Product data sheet
Website: thermofisher.com Customer Service (US): 1 800 955 6288 ext. 1 Technical Support (US): 1 800 955 6288 ext. 441 mcherry Monoclonal Antibody (16D7) Catalog Number M11217 Product data sheet Details
More informationTECHNICAL BULLETIN. Color. Fig.1. Cell-Based protein phosphorylation procedure
Cell-Based ELISA Sampler Kit for detecting phospho-erk1/2 (pthr 202 /ptyr 204 ), phospho-jnk (pthr 183 /ptyr 185 ), and phospho-p38 MAPK (pthr 180 /ptyr 182 ) in cultured cell lines adequate for 192 assays
More informationDolphin-Chemi Plus. Aim: To visualise and evaluate the performance of chemiluminescent immunoblots using Wealtec s Dolphin-Chemi plus image system
Application Note 03 Dolphin-Chemi plus 8/22/2007 Dolphin-Chemi Plus Aim: To visualise and evaluate the performance of chemiluminescent immunoblots using Wealtec s Dolphin-Chemi plus image system INTRODUCTION
More informationINOS. Colorimetric Cell-Based ELISA Kit. Catalog #: OKAG00807
INOS Colorimetric Cell-Based ELISA Kit Catalog #: OKAG00807 Please read the provided manual entirely prior to use as suggested experimental protocols may have changed. Research Purposes Only. Not Intended
More informationSupplemental Information. The TRAIL-Induced Cancer Secretome. Promotes a Tumor-Supportive Immune. Microenvironment via CCR2
Molecular Cell, Volume 65 Supplemental Information The TRAIL-Induced Cancer Secretome Promotes a Tumor-Supportive Immune Microenvironment via CCR2 Torsten Hartwig, Antonella Montinaro, Silvia von Karstedt,
More informationSupplemental Data Supplementary Figure Legends and Scheme Figure S1.
Supplemental Data Supplementary Figure Legends and Scheme Figure S1. UTK1 inhibits the second EGF-induced wave of lamellipodia formation in TT cells. A and B, EGF-induced lamellipodia formation in TT cells,
More informationSupplementary Information
Journal : Nature Biotechnology Supplementary Information Targeted genome engineering in human cells with RNA-guided endonucleases Seung Woo Cho, Sojung Kim, Jong Min Kim, and Jin-Soo Kim* National Creative
More informationRegulation and Function of the IL-1 Family Cytokine IL-1F9 in Human Bronchial Epithelial Cells
Online Data Supplement Regulation and Function of the IL-1 Family Cytokine IL-1F9 in Human Bronchial Epithelial Cells Regina T. Chustz 1, Deepti R. Nagarkar 1, Julie A. Poposki 1, Silvio Favoreto, Jr 1,
More informationShort hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna
Supplemental Materials and Methods Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna (Mission shrna, Sigma) against mouse MMP14 were transfected into HEK293 cells using FuGene6
More informationSupplemental Data. Regulating Gene Expression. through RNA Nuclear Retention
Supplemental Data Regulating Gene Expression through RNA Nuclear Retention Kannanganattu V. Prasanth, Supriya G. Prasanth, Zhenyu Xuan, Stephen Hearn, Susan M. Freier, C. Frank Bennett, Michael Q. Zhang,
More informationModulation of the anti-tumor immune response by complement. Maciej M. Markiewski, Robert A. DeAngelis, Fabian Benencia, Salome K.
Modulation of the anti-tumor immune response by complement Maciej M. Markiewski, Robert A. DeAngelis, Fabian Benencia, Salome K. Ricklin- Lichtsteiner, Anna Koutoulaki, Craig Gerard, George Coukos & John
More informationcdna by PCR with primers BglII-PacI-MAML (5 -GGCCAGATCTTTAATTAAGCCGCCAC CATGGCGCTGCCGCGGCACA-3 ) and XhoI-PmeI-GFP (5 - GGCCCTCGAGGTTTAAACT
Supplementary Materials and Methods Generation of ptof-dnmaml1 Platinum Pfx DNA polymerase (Invitrogen) was used to amplify GFP-DNMAML1 cdna by PCR with primers BglII-PacI-MAML (5 -GGCCAGATCTTTAATTAAGCCGCCAC
More informationSupplementary Materials: Viral Protein Kinetics of Piscine Orthoreovirus Infection in Atlantic Salmon Blood Cells
S1of S7 Supplementary Materials: Viral Protein Kinetics of Piscine Orthoreovirus Infection in Atlantic Salmon Blood Cells Hanne Merethe Haatveit, Øystein Wessel, Turhan Markussen, Morten Lund, Bernd Thiede,
More informationSupplementary Figure 1. RAD51 and RAD51 paralogs are enriched spontaneously onto
Supplementary Figure legends Supplementary Figure 1. and paralogs are enriched spontaneously onto the S-phase chromatin during DN replication. () Chromatin fractionation was carried out as described in
More informationFigure S1. Purity of primary cultures of renal proximal tubular epithelial culture ascertained by cytokeratin staining.
Supplementary information Supplementary figures Figure S1. Purity of primary cultures of renal proximal tubular epithelial culture ascertained by cytokeratin staining. Figure S2. Induction of Nur77 in
More informationAzure Biosystems Western Blotting Workflow
Azure Biosystems Western Blotting Workflow PROBE PLAN SEPARATE ANALYZE VISUALIZE PLAN Plan your experiment and choose your detection method Chemiluminescent Western Blotting The most common method for
More informationTECHNICAL BULLETIN. MEK Activity Assay Kit. Product Code CS0490 Storage Temperature 20 C
MEK Activity Assay Kit Product Code CS0490 Storage Temperature 20 C TECHNICAL BULLETIN Product Description The MAP kinase kinases (MAPKK, mitogen-activated protein kinase kinase, also termed MEK) are a
More informationGFP CCD2 GFP IP:GFP
D1 D2 1 75 95 148 178 492 GFP CCD1 CCD2 CCD2 GFP D1 D2 GFP D1 D2 Beclin 1 IB:GFP IP:GFP Supplementary Figure 1: Mapping domains required for binding to HEK293T cells are transfected with EGFP-tagged mutant
More informationSupplemental Online Material. The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/-
#1074683s 1 Supplemental Online Material Materials and Methods Cell lines and tissue culture The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/- knock-out animals
More informationSupporting Information
Supporting Information Horie et al. 10.1073/pnas.1008499107 SI Materials and Methods ell ulture and Reagents. THP-1 cells were obtained from the American Type ell ollection. THP-1 cells were transformed
More informationmcherry Polyclonal Antibody Catalog Number PA Product data sheet
Website: thermofisher.com Customer Service (US): 1 800 955 6288 ext. 1 Technical Support (US): 1 800 955 6288 ext. 441 mcherry Polyclonal Antibody Catalog Number PA5-34974 Product data sheet Details Size
More informationExperimental Protocol for Multiplex Fluorescent Blotting Using the ChemiDoc MP Imaging System
Experimental Protocol for Multiplex Fluorescent Blotting Using the ChemiDoc MP Imaging System Protocol Bulletin 6570 Stefanie L. Ritter and Donald G. Rainie, Deparment of Behavioral Neuroscience and Psychiatric
More informationPHT1;2-CFP YFP-PHF + PHT1;2-CFP YFP-PHF
YFP-PHF1 CFP-PHT1;2 PHT1;2-CFP YFP-PHF + PHT1;2-CFP YFP-PHF + CFP-PHT1;2 Negative control!-gfp Supplemental Figure 1: PHT1;2 accumulation is PHF1 dependent. Immunoblot analysis on total protein extract
More informationab Hypoxic Response Human Flow Cytometry Kit
ab126585 Hypoxic Response Human Flow Cytometry Kit Instructions for Use For measuring protein levels by flow cytometry: hypoxia-inducible factor 1-alpha (HIF1A) and BCL2/adenovirus E1B 19 kda proteininteracting
More informationKinase Reaction and Alkylation Protocol
Kinase Reaction and Alkylation Protocol Protocol for the treatment of substrates prior to detection by Thiophosphate Ester antibodies This product is for research use only and is not intended for diagnostic
More informationColeman et al., Supplementary Figure 1
Coleman et al., Supplementary Figure 1 BrdU Merge G1 Early S Mid S Supplementary Figure 1. Sequential destruction of CRL4 Cdt2 targets during the G1/S transition. HCT116 cells were synchronized by sequential
More informationSupplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate
Supplementary Figure Legends Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate BC041951 in gastric cancer. (A) The flow chart for selected candidate lncrnas in 660 up-regulated
More informationAmersham * ECL * Gel horizontal electrophoresis system
GE Healthcare Life Sciences Data file 28-9970-20 AB Electrophoresis products Amersham * ECL * Gel horizontal electrophoresis system Amersham ECL Gel and Amersham ECL Gel Box constitute a horizontal mini-gel
More informationSupplement Figure 1. Characterization of the moab. (A) A series of moabs that are anti-hαiib-specific were tested for their ability to bind to
Supplement Figure 1. Characterization of the 312.8 moab. (A) A series of moabs that are anti-hαiib-specific were tested for their ability to bind to platelets. The black line represents the 312.8 moab
More informationENCODE RBP Antibody Characterization Guidelines
ENCODE RBP Antibody Characterization Guidelines Approved on November 18, 2016 Background An integral part of the ENCODE Project is to characterize the antibodies used in the experiments. This document
More informationENCODE DCC Antibody Validation Document
ENCODE DCC Antibody Validation Document Date of Submission 06/15/2012 Name: Trupti Kawli Email: trupti@stanford.edu Lab Snyder Antibody Name: CDP (sc6327) Target: CDP Company/ Source: Santa Cruz Catalog
More informationEGFR (Phospho-Ser695)
Assay Biotechnology Company www.assaybiotech.com Tel: 1-877-883-7988 Fax: 1-877-610-9758 EGFR (Phospho-Ser695) Colorimetric Cell-Based ELISA Kit Catalog #: OKAG02090 Please read the provided manual entirely
More informationSupplemental information
Supplemental information - Control samples (200 subjects) - Immunohistochemistry of rat brain - Immunocytochemistry on neuronal cultures - Immunocompetition assay - Immunoprecipitation - Immunocytochemistry
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1. Description of the observed lymphatic metastases in two different SIX1-induced MCF7 metastasis models (Nude and NOD/SCID). Supplementary Figure 2. MCF7-SIX1
More information64 CuCl 2 in 50 µl 0.1N NaOAc buffer, and 20 µg of each DOTA-antibody conjugate in 40 µl
Number of DOTA per antibody The average number of DOTA chelators per antibody was measured using a reported procedure with modifications (1,2). Briefly, nonradioactive CuCl 2 (80-fold excess of DOTA antibodies)
More information2D gel Western blotting using antibodies against ubiquitin, SUMO and acetyl PTM
2D gel Western blotting using antibodies against ubiquitin, SUMO and acetyl PTM Nancy Kendrick, Jon Johansen & Matt Hoelter, Kendrick Labs Inc www.kendricklabs.com Talk Outline Significance Method description
More informationSUPPLEMENTAL METHODS Reverse transcriptase PCR (RT-PCR) and quantitative real-time PCR (Q-RT-PCR) RNA was isolated with TRIZOL (Invitrogen), and
SUPPLEMENTAL METHODS Reverse transcriptase PCR (RT-PCR) and quantitative real-time PCR (Q-RT-PCR) RNA was isolated with TRIZOL (Invitrogen), and first strand cdna was synthesized using 1 μg of RNA and
More informationGENESDEV/2007/ Supplementary Figure 1 Elkabetz et al.,
GENESDEV/2007/089581 Supplementary Figure 1 Elkabetz et al., GENESDEV/2007/089581 Supplementary Figure 2 Elkabetz et al., GENESDEV/2007/089581 Supplementary Figure 3 Elkabetz et al., GENESDEV/2007/089581
More informationTo isolate single GNS 144 cell clones, cells were plated at a density of 1cell/well
Supplemental Information: Supplemental Methods: Cell culture To isolate single GNS 144 cell clones, cells were plated at a density of 1cell/well in 96 well Primaria plates in GNS media and incubated at
More informationSupporting Online Material, Matsumoto et al.
Supporting Online Material, Matsumoto et al. Material and Methods Library. Poly(A) + mrna was purified from RAW264.7 cells stimulated with murine IFN-γ (100 units/ml) and bacterial LPS (100 ng/ml) for
More informationBD Biosciences BD Cytometric Bead Array (CBA) Product List. For Research Use Only. Not for use in diagnostic or therapeutic procedures.
BD Biosciences BD Cytometric Bead Array (CBA) Product List For Research Use Only. Not for use in diagnostic or therapeutic procedures. Highlights of BD CBA Products Reagents with Superior Quality and Reproducibility
More informationNotes to accompany the slidecast on theory of SDS PAGE and Western blotting
S317 Biological science: from genes to species Notes to accompany the slidecast on theory of SDS PAGE and Western blotting SDS PAGE SDS PAGE is a standard technique for determining the molecular size of
More informationTrkB knockdown cell lines (i.e., BBM1-KD and 361-KD cells) were prepared by
Supplemental Information Cell Culture TrkB knockdown cell lines (i.e., BBM1-KD and 361-KD cells) were prepared by transducing BBM1 or 361 cells with a lentivirus encoding shrna for TrkB. Transduction was
More informationby Neurobasal medium (supplemented with B27, 0.5mM glutamine, and 100 U/mL
Supplementary Materials and methods Neuronal cultures and transfection The hippocampus was dissected from E8 rat embryos, dissociated, and neurons plated onto glass coverslips coated with poly-ornithine
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/1137999/dc1 Supporting Online Material for Disrupting the Pairing Between let-7 and Enhances Oncogenic Transformation Christine Mayr, Michael T. Hemann, David P. Bartel*
More informationSupplemental Information. Neutrophil-Derived IL-1b Impairs the Efficacy. of NF-kB Inhibitors against Lung Cancer
Cell Reports, Volume 16 Supplemental Information Neutrophil-Derived IL-1b Impairs the Efficacy of NF-kB Inhibitors against Lung Cancer Allyson G. McLoed, Taylor P. Sherrill, Dong-Sheng Cheng, Wei Han,
More information*Corresponding author. Tel: ;
1 SUPPLEMENTARY DATA 2 3 4 5 6 7 8 9 10 11 Integrin 2 1 in nonactivated conformation can induce focal adhesion kinase signaling Maria Salmela 1, Johanna Jokinen 1,2, Silja Tiitta 1, Pekka Rappu 1, Holland
More informationTISSUE-SPECIFIC STEM CELLS
TISSUE-SPECIFIC STEM CELLS Notch3 Null Mutation in Mice Causes Muscle Hyperplasia by Repetitive Muscle Regeneration TAKEO KITAMOTO, KAZUNORI HANAOKA Laboratory of Molecular Embryology, Department of Bioscience,
More informationSupplementary Fig. 1. Characteristics of transcription elongation by YonO. a. YonO forms a saltstable EC. Immobilized ECs were washed with
Supplementary Fig. 1. Characteristics of transcription elongation by YonO. a. YonO forms a saltstable EC. Immobilized ECs were washed with transcription buffer with or without a high salt concentration
More informationInt. J. Mol. Sci. 2016, 17, 1259; doi: /ijms
S1 of S5 Supplementary Materials: Fibroblast-Derived Extracellular Matrix Induces Chondrogenic Differentiation in Human Adipose-Derived Mesenchymal Stromal/Stem Cells in Vitro Kevin Dzobo, Taegyn Turnley,
More informationSupplementary Figure and Table Legends
1 Supplementary Figure and Table Legends Figure S1: Whole-animal metabolic analysis. 12 week old WT and Dvl1 / were singly housed in CLAMS cages (Comprehensive Laboratory Animals Monitoring System) for
More information