Table S1. Oligonucleotide primer sequences

Revised: RG-RV2 by Fukuhara et al.

Supplemental Figure 1 The generation of Spns2 conditional knockout mice. (A) Schematic representation of the wild type Spns2 locus (Spns2 + ), the targeted allele, the floxed allele (Spns2 f ) and the

Percent survival. Supplementary fig. S3 A.

Supplementary fig. S3 A. B. 100 Percent survival 80 60 40 20 Ml 0 0 100 C. Fig. S3 Comparison of leukaemia incidence rate in the triple targeted chimaeric mice and germline-transmission translocator mice

Supplemental Table S1. RT-PCR primers used in this study

Supplemental Table S1. RT-PCR primers used in this study -----------------------------------------------------------------------------------------------------------------------------------------------

Nature Immunology: doi: /ni Supplementary Figure 1. Zranb1 gene targeting.

Supplementary Figure 1 Zranb1 gene targeting. (a) Schematic picture of Zranb1 gene targeting using an FRT-LoxP vector, showing the first 6 exons of Zranb1 gene (exons 7-9 are not shown). Targeted mice

(A-B) P2ry14 expression was assessed by (A) genotyping (upper arrow: WT; lower

Supplementary Figures S1. (A-B) P2ry14 expression was assessed by (A) genotyping (upper arrow: ; lower arrow: KO) and (B) q-pcr analysis with Lin- cells, The white vertical line in panel A indicates that

LRBA is Essential for Allogeneic Responses in Bone Marrow Transplantation

LRBA is Essential for Allogeneic Responses in Bone Marrow Transplantation Mi Young Park, 1# Raki Sudan, 1# Neetu Srivastava, 1 Sudha Neelam, 1 Christie Youngs, 1 Jia- Wang Wang, 4 Robert W. Engelman, 5,6,7

Supplementary Methods

Supplementary Methods Reverse transcribed Quantitative PCR. Total RNA was isolated from bone marrow derived macrophages using RNeasy Mini Kit (Qiagen), DNase-treated (Promega RQ1), and reverse transcribed

Supplementary Figures and Figure legends

Supplementary Figures and Figure legends 3 Supplementary Figure 1. Conditional targeting construct for the murine Satb1 locus with a modified FLEX switch. Schematic of the wild type Satb1 locus; the conditional

SUPPLEMENTARY INFORMATION

doi: 1.138/nature875 a promoter firefly luciferase CNS b Supplementary Figure 1. Dual luciferase assays on enhancer activity of CNS1, 2, and 3. a. promoter sequence was inserted upstream of firefly luciferase

Supplementary Figure 1. Xbp1 deficiency does not alter hematopoietic cellularity.

Supplementary Figure 1 Xbp1 deficiency does not alter hematopoietic cellularity. Absolute number of leukocytes obtained from bone marrow (BM, 2 tibias and 2 femurs per mouse) of Xbp1 f/f and Xbp1 Vav1

Tumour 2. Tumour 9. Tumour 25 Tumour 26. Tumour 27. t(6;16) doi: /nature06159 SUPPLEMENTARY INFORMATION Supplementary Figure 1

doi: 1.18/nature6159 SUPPLEMENTARY INFORMATION Supplementary Figure 1 Tumour Tumour 9 t(6;16) Tumour 5 Tumour 6 Tumour 7 www.nature.com/nature 1 doi: 1.18/nature6159 SUPPLEMENTARY INFORMATION Supplementary

PrimePCR Assay Validation Report

Gene Information Gene Name major histocompatibility complex, class II, DR beta 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID HLA-DRB1 Human HLA-DRB1 belongs

PrimePCR Assay Validation Report

Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID Glyceraldehyde-3-phosphate dehydrogenase Gapdh Rat This gene encodes a member of

Generation of App knock-in mice reveals deletion mutations protective against Alzheimer s. disease-like pathology. Nagata et al.

Generation of App knock-in mice reveals deletion mutations protective against Alzheimer s disease-like pathology Nagata et al. Supplementary Fig 1. Previous App knock-in model did not show Aβ accumulation

PrimePCR Assay Validation Report

Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID mcf.2 transforming sequence-like Mcf2l Mouse Description Not Available C130040G20Rik,

Supporting Information

(xe number cells) LSK (% gated) Supporting Information Youm et al../pnas. SI Materials and Methods Quantification of sjtrecs. CD + T subsets were isolated from splenocytes using mouse CD + T cells positive

Nature Immunology: doi: /ni.3694

Supplementary Figure 1 Expression of Bhlhe41 and Bhlhe40 in B cell development and mature B cell subsets. (a) Scatter plot showing differential expression of genes between splenic B-1a cells and follicular

Supplementary Figure 1. Characterization of the POP2 transcriptional and post-transcriptional regulatory elements. (A) POP2 nucleotide sequence

1 5 6 7 8 9 10 11 1 1 1 Supplementary Figure 1. Characterization of the POP transcriptional and post-transcriptional regulatory elements. (A) POP nucleotide sequence depicting the consensus sequence for

Development of CD11b-IRF8 transgenic and MTAG double transgenic mice The CMV-

Supplemental Data Development of CD11b-IRF8 transgenic and MTAG double transgenic mice The CMV- IRF8 transgenic mouse was previously developed by cloning complementary DNA, containing the IRF-8 coding

SUPPLEMENTARY INFORMATION

6 Relative levels of ma3 RNA 5 4 3 2 1 LN MG SG PG Spl Thy ma3 ß actin Lymph node Mammary gland Prostate gland Salivary gland Spleen Thymus MMTV target tissues Fig. S1: MMTV target tissues express ma3.

PrimePCR Assay Validation Report

Gene Information Gene Name collagen, type IV, alpha 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID COL4A1 Human This gene encodes the major type IV alpha

PrimePCR Assay Validation Report

Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID myeloperoxidase MPO Human Myeloperoxidase (MPO) is a heme protein synthesized during

We designed the targeting vector in such a way that the first exon was flanked by two LoxP sites and

Mice We designed the targeting vector in such a way that the first exon was flanked by two LoxP sites and an Frt flanked neo cassette (Fig. S1A). Targeted BA1 (C57BL/6 129/SvEv) hybrid embryonic stem cells

SUPPLEMENTARY INFORMATION

AS-NMD modulates FLM-dependent thermosensory flowering response in Arabidopsis NATURE PLANTS www.nature.com/natureplants 1 Supplementary Figure 1. Genomic sequence of FLM along with the splice sites. Sequencing

PrimePCR Assay Validation Report

Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID glyceraldehyde-3-phosphate dehydrogenase GAPDH Human The product of this gene catalyzes

Supplemental Figure 1

Supplemental Figure 1 Supplemental figure 1. Generation of gene targeted mice expressing an anti-id BCR. (A,B) Generation of the VDJ aid H KI mouse. (A) Targeting Construct. Top: Targeting construct for

SUPPLEMENTARY INFORMATION

Supplementary Figure 1. Defective T and B cell lineage development in the absence of 53BP1. a, Average number of thymocytes in WT, 53BP1 /, p53 /, 53BP1 / / p53, Nbs1 tr735 and 53BP1 / Nbs1 tr735 mice

PrimePCR Assay Validation Report

Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin)

PrimePCR Assay Validation Report

Gene Information Gene Name keratin 78 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID KRT78 Human This gene is a member of the type II keratin gene family

Fig. S1. eif6 expression in HEK293 transfected with shrna against eif6 or pcmv-eif6 vector.

Fig. S1. eif6 expression in HEK293 transfected with shrna against eif6 or pcmv-eif6 vector. (a) Western blotting analysis and (b) qpcr analysis of eif6 expression in HEK293 T cells transfected with either

PrimePCR Assay Validation Report

Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID Peptidyl-glycine alpha-amidating monooxygenase Peptidylglycine alpha-hydroxylating

Nature Biotechnology: doi: /nbt Supplementary Figure 1. In vitro validation of OTC sgrnas and donor template.

Supplementary Figure 1 In vitro validation of OTC sgrnas and donor template. (a) In vitro validation of sgrnas targeted to OTC in the MC57G mouse cell line by transient transfection followed by 4-day puromycin

Supplementary Data. Flvcr1a TCTAAGGCCCAGTAGGACCC GGCCTCAACTGCCTGGGAGC AGAGGGCAACCTCGGTGTCC

Supplementary Data Supplementary Materials and Methods Measurement of reactive oxygen species accumulation in fresh intestinal rings Accumulation of reactive oxygen species in fresh intestinal rings was

Materials and Methods

Materials and Methods Construction of noxa / mice and genotyping The targeting vector (see Fig. S) was prepared from a C57BL/6 DNA λ phage library (Stratagene) by replacing a 2.7 kb region encompassing

Supplemental Information. Inflammatory Ly6C high Monocytes Protect. against Candidiasis through IL-15-Driven. NK Cell/Neutrophil Activation

Immunity, Volume 46 Supplemental Information Inflammatory Ly6C high Monocytes Protect against Candidiasis through IL-15-Driven NK Cell/Neutrophil Activation Jorge Domínguez-Andrés, Lidia Feo-Lucas, María

Nature Immunology: doi: /ni Supplementary Figure 1

Supplementary Figure 1 Sox2 localizes in neutrophils of mouse spleen. (a) Microscopy analysis of Sox2 and MPO in wild-type mouse spleen. Nucl, nucleus. (b) Immunohistochemistry staining of Sox2 and MPO

PrimePCR Assay Validation Report

Gene Information Gene Name cholinergic receptor, nicotinic, alpha 9 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID CHRNA9 Human This gene is a member of

Figure S Relative MUC4 transcript level* CD18/HPAF CD18/HPAF-Scr CD18/HPAF-siMUC4

Figure S1 Relative MUC4 transcript level* 1.4 1.2 1 0.8 0.6 0.4 0.2 0 CD18/HPAF CD18/HPAF-Scr CD18/HPAF-siMUC4 Figure S2 * * CD18/HPAF-Scr CD18/HPAF-siMUC4 CD18/HPAF-Scr CD18/HPAF-siMUC4 Figure S3 CD18/HPAF-Scr

PrimePCR Assay Validation Report

Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID protein kinase N1 PKN1 Human The protein encoded by this gene belongs to the protein

Nature Immunology: doi: /ni Supplementary Figure 1

Supplementary Figure 1 PPAR-γ is dispensable for the development of tissue macrophages in the heart, kidneys, lamina propria and white adipose tissue. Plots show the expression of F4/80 and CD11b (a) or

PrimePCR Assay Validation Report

Gene Information Gene Name keratin associated protein 9-2 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID KRTAP9-2 Human This protein is a member of the keratin-associated

PrimePCR Assay Validation Report

Gene Information Gene Name minichromosome maintenance complex component 8 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID MCM8 Human The protein encoded by

PrimePCR Assay Validation Report

Gene Information Gene Name SRY (sex determining region Y)-box 6 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID SOX6 Human This gene encodes a member of the

PrimePCR Assay Validation Report

Gene Information Gene Name keratin 3 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID KRT3 Human The protein encoded by this gene is a member of the keratin

Nature Immunology: doi: /ni Supplementary Figure 1. Construction of lnckdm2b RFP reporter and lnckdm2b-knockout mice.

Supplementary Figure 1 Construction of lnckdm2b RFP reporter and lnckdm2b-knockout mice. (a) ILC3s (Lin CD45 lo CD90 hi ) were isolated from small intestines, followed by immunofluorescence staining. LncKdm2b

Supplementary Materials for

advances.sciencemag.org/cgi/content/full/4/9/eaat5401/dc1 Supplementary Materials for GLK-IKKβ signaling induces dimerization and translocation of the AhR-RORγt complex in IL-17A induction and autoimmune

PrimePCR Assay Validation Report

Gene Information Gene Name integrin, alpha 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID ITGA1 Human This gene encodes the alpha 1 subunit of integrin

PrimePCR Assay Validation Report

Gene Information Gene Name heat shock 10kDa protein 1 (chaperonin 10) Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID HSPE1 Human This gene encodes a major

Supplementary Table S1

Primers used in RT-qPCR, ChIP and Bisulphite-Sequencing. Quantitative real-time RT-PCR primers Supplementary Table S1 gene Forward primer sequence Reverse primer sequence Product TRAIL CAACTCCGTCAGCTCGTTAGAAAG

PrimePCR Assay Validation Report

Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID thyroglobulin TG Human Thyroglobulin (Tg) is a glycoprotein homodimer produced

Who pairs with whom? High-throughput sequencing of the human paired heavy and light chain repertoire

Who pairs with whom? High-throughput sequencing of the human paired heavy and light chain repertoire Technical Journal Club September 15 th Christina Müller Background - antibody repertoire is the sum

a Lamtor1 (gene) b Lamtor1 (mrna) c WT Lamtor1 Lamtor1 flox Lamtor2 A.U. p = LysM-Cre Lamtor3 Lamtor4 Lamtor5 BMDMs: Φ WT Φ KO β-actin WT BMDMs

a Lamtor (gene) b Lamtor (mrna) c BMDMs: Φ WT Φ KO Lamtor flox 8 bp LysM-Cre 93 bp..5 p =.4 WT BMDMs: Φ WT Φ KO Lamtor (protein) BMDMs: Φ WT Φ KO Lamtor 8 kda Lamtor 4 kda Lamtor3 4 kda Lamtor4 kda Lamtor5.5

PrimePCR Assay Validation Report

Gene Information Gene Name keratin 5 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID KRT5 Human The protein encoded by this gene is a member of the keratin

PrimePCR Assay Validation Report

Gene Information Gene Name growth differentiation factor 6 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID GDF6 Human This gene encodes a member of the bone

Student Learning Outcomes (SLOS)

Student Learning Outcomes (SLOS) KNOWLEDGE AND LEARNING SKILLS USE OF KNOWLEDGE AND LEARNING SKILLS - how to use Annhyb to save and manage sequences - how to use BLAST to compare sequences - how to get

PrimePCR Assay Validation Report

Gene Information Gene Name 3-hydroxybutyrate dehydrogenase, type 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID BDH1 Human This gene encodes a member of

PrimePCR Assay Validation Report

Gene Information Gene Name sortilin 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID SORT1 Human This gene encodes a protein that is a multi-ligand type-1

PrimePCR Assay Validation Report

Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID peptidylglycine alpha-amidating monooxygenase PAM Human This gene encodes a multifunctional

Supplementary Figure S1: (A) Schematic representation of the Jarid2 Flox/Flox

Supplementary Figure S1: (A) Schematic representation of the Flox/Flox locus and the strategy used to visualize the wt and the Flox/Flox mrna by PCR from cdna. An example of the genotyping strategy is

PrimePCR Assay Validation Report

Gene Information Gene Name laminin, beta 3 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID LAMB3 Human The product encoded by this gene is a laminin that

Supplemental Information

Supplemental Information Itemized List Materials and Methods, Related to Supplemental Figures S5A-C and S6. Supplemental Figure S1, Related to Figures 1 and 2. Supplemental Figure S2, Related to Figure

PrimePCR Assay Validation Report

Gene Information Gene Name transforming growth factor, beta 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID TGFB1 Human This gene encodes a member of the

PrimePCR Assay Validation Report

Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID caspase 9, apoptosis-related cysteine peptidase CASP9 Human This gene encodes a

PrimePCR Assay Validation Report

Gene Information Gene Name bestrophin 3 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID BEST3 Human BEST3 belongs to the bestrophin family of anion channels

PrimePCR Assay Validation Report

Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID STE20-related kinase adaptor alpha STRADA Human The protein encoded by this gene

Receptor Revision Diminishes the Autoreactive B Cell Response after Antigen. PNA Tet. Day 8. Day 16

Receptor Revision Diminishes the Autoreactive Cell Response after Antigen Activation Ying-Hua Wang and etty Diamond Supplemental data: PNA Tet 5 8 11 16 Supplemental Figure 1: Kinetic analysis of tetramer-binding

PrimePCR Assay Validation Report

Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase

Supplementary Material & Methods

Supplementary Material & Methods Affymetrix micro-array Total RNA was extracted using Trizol reagent (Invitrogen, Carlsbad, USA). RNA concentration and quality was determined using the ND-1000 spectrophotometer

Recombination Lecture, Dr. Aguilera 2/17/2014

Lymphocytes and Antigen Receptors Thymus T-Cells Lymph nodes Spleen } T+B-cells Paper Presentation: Bone Marrow Stem cells and B-cells Nat. Rev. Immunol. STEM CELL CLP Committed Lymphocyte Precursor T-cells

PrimePCR Assay Validation Report

Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID protein phosphatase, Mg2+/Mn2+ dependent, 1A PPM1A Human The protein encoded by

PrimePCR Assay Validation Report

Gene Information Gene Name cytochrome P450, family 2, subfamily C, polypeptide 9 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID CYP2C9 Human This gene encodes

SUPPLEMENTARY DATA. Table S1 Clinical features of new SS/MF patients enrolled in SNP6.0 and 10K analysis. % of TCRVß+ within CD3+CD4+

SUPPLEMENTARY DATA Table S1 Clinical features of new SS/MF patients enrolled in SNP6.0 and 10K analysis Sample ID % of TCRVß+ Disease Sex/Age TCRVß Family CD4/CD8 Sample material within CD3+CD4+ 10K SNPs

amplify the conditional allele (2-lox) and recombined allele (1-lox) following tamoxifen

Supplementary data Supplementary Table 1. Real-time PCR primer sequences Supplementary Fig. 1. (A) Genomic map of the Vhl (2-lox) conditional allele. Numbered boxes represent exon 1, which is targeted

Figure S1. Generation of HspA4 -/- mice. (A) Structures of the wild-type (Wt) HspA4 -/- allele, targeting vector and targeted allele are shown together with the relevant restriction sites. The filled rectangles

PrimePCR Assay Validation Report

Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID PARK2 co-regulated PACRG Human This gene encodes a protein that is conserved across

Supporting Information

Supporting Information Tomura et al. 1.173/pnas.8227815 WT CFSE Con A stimulation Before After 2 3 1 CFSE Kaede- Tg No photoconversion Photoconversion Kaede Red Fig. S1. Dilution of photoconverted Kaede

Supplementary Fig. 1: Characterization of Asxl2 -/- mouse model. (a) HSCs and their

Supplementary Fig. 1: Characterization of Asxl2 -/- mouse model. (a) HSCs and their differentiated cell populations were sorted from the BM of WT mice using respective surface markers, and Asxl2 mrna expression

Supplementary Figure 1 An overview of pirna biogenesis during fetal mouse reprogramming. (a) (b)

Supplementary Figure 1 An overview of pirna biogenesis during fetal mouse reprogramming. (a) A schematic overview of the production and amplification of a single pirna from a transposon transcript. The

PrimePCR Assay Validation Report

Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID coagulation factor XIII, A1 polypeptide F13A1 Human This gene encodes the coagulation

PrimePCR Assay Validation Report

Gene Information Gene Name peptidylprolyl isomerase A (cyclophilin A) Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID PPIA Human This gene encodes a member

embryos. Asterisk represents loss of or reduced expression. Brackets represent

Supplemental Figures Supplemental Figure 1. tfec expression is highly enriched in tail endothelial cells (A- B) ISH of tfec at 15 and 16hpf in WT embryos. (C- D) ISH of tfec at 36 and 38hpf in WT embryos.

A novel tool for monitoring endogenous alpha-synuclein transcription by NanoLuciferase

A novel tool for monitoring endogenous alpha-synuclein transcription by NanoLuciferase tag insertion at the 3 end using CRISPR-Cas9 genome editing technique Sambuddha Basu 1, 3, Levi Adams 1, 3, Subhrangshu

SUPPLEMENTAL MATERIAL

SUPPLEMENTAL MATERIAL MATERIALS AND METHODS Generation of TSPOΔ/Δ murine embryonic fibroblasts Embryos were harvested from 13.5-day pregnant TSPOfl/fl mice. After dissection to eviscerate and remove the

Table S1. Primers used in the study

Table S1. Primers used in the study Primer name Application Sequence I1F16 Genotyping GGCAAGTGAGTGAGTGCCTA I1R11 Genotyping CCCACTCGTATTGACGCTCT V19 Genotyping GGGTCTCAAAGTCAGGGTCA D18Mit184-F Genotyping

HC70AL SUMMER 2014 PROFESSOR BOB GOLDBERG Gene Annotation Worksheet

HC70AL SUMMER 2014 PROFESSOR BOB GOLDBERG Gene Annotation Worksheet NAME: DATE: QUESTION ONE Using primers given to you by your TA, you carried out sequencing reactions to determine the identity of the

WT Day 90 after injections

Supplementary Figure 1 a Day 1 after injections Day 9 after injections Klf5 +/- Day 1 after injections Klf5 +/- Day 9 after injections BLM PBS b Day 1 after injections Dermal thickness (μm) 3 1 Day 9 after

administration of tamoxifen. Bars show mean ± s.e.m (n=10-11). P-value was determined by

Supplementary Figure 1. Chimerism of CD45.2 + GFP + cells at 1 month post transplantation No significant changes were detected in chimerism of CD45.2 + GFP + cells between recipient mice repopulated with

Rassf1a -/- Sav1 +/- mice. Supplementary Figures:

1 Supplementary Figures: Figure S1: Genotyping of Rassf1a and Sav1 mutant mice. A. Rassf1a knockout mice lack exon 1 of the Rassf1 gene. A diagram and typical PCR genotyping of wildtype and Rassf1a -/-

Supplemental Materials. Matrix Proteases Contribute to Progression of Pelvic Organ Prolapse in Mice and Humans

Supplemental Materials Matrix Proteases Contribute to Progression of Pelvic Organ Prolapse in Mice and Humans Madhusudhan Budatha, Shayzreen Roshanravan, Qian Zheng, Cecilia Weislander, Shelby L. Chapman,

Somatic Primary pirna Biogenesis Driven by cis-acting RNA Elements and Trans-Acting Yb

Cell Reports Supplemental Information Somatic Primary pirna Biogenesis Driven by cis-acting RNA Elements and Trans-Acting Yb Hirotsugu Ishizu, Yuka W. Iwasaki, Shigeki Hirakata, Haruka Ozaki, Wataru Iwasaki,

Supplementary Figure 1 Generation of migg1-yf mice. (A) Targeting strategy. Upper panel: schematic organization of the murine ɣ1 immunoglobulin

Supplementary Figure 1 Generation of migg1-yf mice. (A) Targeting strategy. Upper panel: schematic organization of the murine ɣ1 immunoglobulin locus. The EcoRI restriction site between exons M1 and M2

Relative Quantification: Data Management & Analysis Settings

Relative Quantification: Data Management & Analysis Settings Ray Meng, Ph.D. International Field Applications Specialist Gene Expression Division Bio-Rad Laboratories Gene Expression AMPLIFICATION Assay

4 Themes in B cell development + Ig class switch and somatic mutation Tony DeFranco, 10/28/13 Checkpoints in B cell development: feedback from Ig

4 Themes in B cell development + Ig class switch and somatic mutation Tony DeFranco, 10/28/13 Checkpoints in B cell development: feedback from Ig gene rearrangements Lineage commitment: transcription factors

File name: Supplementary Information Description: Supplementary figures and supplementary tables. File name: Peer review file Description:

File name: Supplementary Information Description: Supplementary figures and supplementary tables. File name: Peer review file Description: Supplementary figure 1 Flow diagram summarizing the overall experimental

Pei et al. Supplementary Figure S1

Pei et al. Supplementary Figure S1 C H-CUL9: + + + + + Myc-ROC1: - - + + + U2OS/pcDN3 U2OS/H-CUL9 U2OS/ + H-CUL9 IP: -H -myc input -H -myc 1 2 3 4 5 H-CUL9 Myc-ROC1 -H -H -H -H H-CUL9: wt RR myc-roc1:

A Low salt diet. C Low salt diet + mf4-31c1 3. D High salt diet + mf4-31c1 3. B High salt diet

A Low salt diet GV [AU]:. [mmhg]: 0..... 09 9 7 B High salt diet GV [AU]:. [mmhg]: 7 8...0. 7.8 8.. 0 8 7 C Low salt diet + mf-c GV [AU]:. [mmhg]:.0.9 8.7.7. 7 8 0 D High salt diet + mf-c E Lymph capillary

C57BL/6N Female. C57BL/6N Male. Prl2 WT Allele. Prl2 Targeted Allele **** **** WT Het KO PRL bp. 230 bp CNX. C57BL/6N Male 30.

A Prl Allele Prl Targeted Allele 631 bp 1 3 4 5 6 bp 1 SA β-geo pa 3 4 5 6 Het B Het 631 bp bp PRL CNX C 1 C57BL/6N Male (14) Het (7) (1) 1 C57BL/6N Female (19) Het (31) (1) % survival 5 % survival 5 ****

BS 50 Genetics and Genomics Week of Oct 24

BS 50 Genetics and Genomics Week of Oct 24 Additional Practice Problems for Section Question 1: The following table contains a list of statements that apply to replication, transcription, both, or neither.

Ramp1 EPD0843_4_B11. EUCOMM/KOMP-CSD Knockout-First Genotyping

EUCOMM/KOMP-CSD Knockout-First Genotyping Introduction The majority of animals produced from the EUCOMM/KOMP-CSD ES cell resource contain the Knockout-First-Reporter Tagged Insertion allele. As well as