Table S1. Oligonucleotide primer sequences
|
|
- Virginia Wright
- 5 years ago
- Views:
Transcription
1 Table S1. Oligonucleotide primer sequences Primer Name DNA Sequence (5 -> 3 ) Description CD19c CD19d Cre7 Sfpi1lox1 Sfpi1lox2 Sfpi1lox3 5 -AACCAGTCAACACCCTTCC-3 5 -CCAGACTAGATACAGACCAG-3 5 -TCAGCTACACCAGAGACGG-3 5 -CTTCACTGCCCATTCATTGGCTCATCA-3 5 -GCTGGGGACAAGGTTTGATAAGGGAA-3 5 -CAACCGGATCTAGACTCGAGGA-3 CD19 Cre genotyping CD19c+CD19d product size: 452 bp (wild type allele); CD19c + Cre7 product size: ~700 bp (knockin allele) Sfpi1 lox genotyping wild type product 395 bp; lox allele product size: 533 bp. Spib forward Spib reverse PGK reverse sfpi1 exon 34 forward sfpi1 exon 34 reverse 5' -GGGCTCCTTGGCTTATGCTCC -3' 5' CGCGCTGTCAAACTGGTAGGT-3' 5 -CAGAAAGCGAAGGAGCAAAGCTG-3 5 -CGAGTTTGAGAACCTCCCTGAGAACCAC GGACAAGGTTTGATAAGGGAAGCACATCCG - 3 Spib - genotyping Wild type product 950 bp; knockout allele product size: 1100 bp Primer pair to amplify intron between Sfpi1 exons 3 and 4 Product size: 995 bp spfi1 exon AGACAGGCGAGGTGAAGAAAGTCA -3 forward spfi1 exon 5 reverse 5 - GGCACACACATGGCACACATACAT -3 Primer pair to amplify between Sfpi1 exons 5 and 3 UTR Product size: 1667 bp front internal sequencing end internal sequencing 5 - TCAAGAGTTTGCGTGTGCCG -3 Sequencing primer for Sfpi1 exons 3 to 4 PCR product 5 - CCTCAGGAAACACAAACCC -3 Sequencing primer for Sfpi1 exon 5 to 3 UTR product lox-exon4 forward 5 - ATGATCGGAATTCCTCGACGGT -3 qpcr primers to detect intact Sfpi1 lox allele frequency lox-exon4 reverse 5 - TTCCAACTGTGGCCTCTGGTTT -3 Product size: 85 bp cko1 5 - CTTCACTGCCCATTCATTGGCTCATCA -3 cko2 5 - CAACCGGATCTAGACTCGAGGA -3 qpcr primers to detect deleted Sfpi1 lox allele (Sfpi1Δ) frequency Product size: 298 bp
2 β-actin promoter fwd β-actin promoter rev 5 -CCCCGCGTGTCCCTC-3 5 -AACCACCCCAGGACCCTC-3 qpcr primers to detect intact β- actin promoter gene frequency Product size: 122 bp RT-q PCR primers Gapdh fwd 5 -GAACATCATCCCTGCATCCA-3 Gapdh rev 5 -CCAGTGAGCTTCCCGTTCA-3 Product size: 78 bp IL7αR fwd 5 -ACGATCACTCCTTCTGGTGC -3 IL7αR rev 5 - GCATTTCACTCGTAAAAGAGCC-3 Product size: 140 bp VpreB1fwd 5 -ACGTCTGTCCTGCTCATGCT-3 VpreB1 rev 5 -TGTTATGGTCGTTGCTCAGG-3 Product size: 136 bp CD23 fwd 5 - TGGCTCCATTTCCAACAGAAGTGC-3 CD23 rev 5 - ATTGAGATCCTGGAGGCCAATCCA-3 Product size: 183 bp CD19 fwd 5 -ACCAGTTGGCAGGATGATGGACTT -3 CD19 rev 5 -TTCATGACTGGGACCGGACTGAAT -3 Product size: 160 bp Pax5 fwd 5 -CGGGTCAGCCATGGTTGTG -3 Pax5 rev 5 -GTGCTGTCTCTCAAACACG-3 Product size: 561 bp Btk fwd 5 -GCTCTGTAGGCTCCAAGTTTC -3 Btk rev 5 -ATCTCTCATACGGCATCTTCC-3 Product size: 144 bp Blnk fwd 5 -TCCAAGTCATCTTTGCCTGCC -3 Blnk rev 5 -TGCATTCGGTACGGGAGGAAC -3 Product size: 102 bp E12 fwd 5 -GGGAGGAGAAAGAGGATGA -3 E12 rev 5 -GCTCCGCCTTCTGCTCTG-3 Product size: 138 bp E47 rev 5 -CCGGTCCCTCAGGTCCTTC-3 Combined with E12 fwd. Product size: 138 bp Id2 fwd 5 -CACAGAGTACTTTGCTATCATTCG-3 Id2 rev 5 -CCTGAACACGGACATCAGC-3 Product size: 83 bp Id3 fwd 5 -CACTTACCCTGAACTCAACGCC-3 Id3 rev 5 -CCCATTCTCGGAAAAGCCAG-3 Product size: 160 bp
3 Figure S1. Analysis of gene expression in sorted follicular B cells (A) Changes in frequencies of mrna transcripts in FO B cells lacking Spi-B or both PU.1 and Spi-B. Cell sorting was used to enrich B220 + CD93 IgM + CD23 + follicular (FO) B cells from the spleen of 9-week old Wild Type, CD Sfpi1 lox lox Spib, or CD 19+/Cre Sfpi1 lox lox Spib mice. Gating was performed as shown in Fig. 1D, upper panels. RNA was prepared from each sample and RT-qPCR used to measure relative frequencies of steady-state mrna transcript levels for genes indicated on the x-axis. Transcript frequencies were normalized to Gapdh transcript levels. The y-axis represents fold change in transcripts in CD Sfpi1 lox lox Spib FO B cells or CD19 +/Cre Sfpi1 lox lox Spib FO B cells relative to Wild Type FO B cells. (B) Changes in frequencies of mrna transcripts in Sfpi1 + Spib FO B cells. Cell sorting was used to enrich (FO) B cells from the spleen of 9-week old Wild Type or Sfpi1 + Spib (PUB) mice as described above. The y-axis represents fold change in transcripts in Sfpi1 + Spib FO B cells relative to Wild Type FO B cells. Figure S2. Blastic lymphocytes are present in spleen, lymph node, bone marrow, and blood of moribund CD19 +/Cre Sfpi1 lox lox Spib mice (A) Histology of the spleen in moribund CD19 +/Cre Sfpi1 lox lox Spib mice (original magnification, 60 ). (B) Histology of an enlarged lymph node in moribund CD19 +/Cre Sfpi1 lox lox Spib mice (original magnification, 60 ). (C) Histology of the bone marrow in moribund CD19 +/Cre Sfpi1 lox lox Spib mice (original magnification, 60 ) (D) Elevated lymphocyte counts in the blood of week old CD19 +/Cre Sfpi1 lox lox Spib mice. Complete blood cell counts were performed on mice of the indicated genotypes. A legend is provided on the right; EO, eosinophils; MO, monocytes; LY, lymphocytes; NE, neutrophils. Basophils were counted but are not shown (<50/µl).
4 Figure S3. High frequency of pre-b cells in the thymus, spleen, and lymph node of moribund CD19 +/Cre Sfpi1 lox/lox Spib -/- mice. (A) High frequency of pre-b cells in the thymus of a 24-week old CD19 +/Cre Sfpi1 lox/lox Spib -/- mouse. Flow cytometric analysis was used to analyze expression of cell surface CD4, CD8, CD19, and B220 on thymocytes from a 6-week old C57Bl/6 mouse as a control (left panels) or a 24-week old CD19 +/Cre Sfpi1 lox/lox Spib -/- mouse (right panels). (B) Pre-B cells in the thymus of CD19 +/Cre Sfpi1 lox/lox Spib -/- mice express CD44, BP-1, and low levels of CD45. Flow cytometric analysis was used to analyze expression of cell surface CD19, CD44, BP-1, and CD45.2 on thymocytes from a 20-week old CD19 +/+ Sfpi1 lox/lox Spib -/- mouse (left panels) or a CD19 +/Cre Sfpi1 lox/lox Spib -/- mouse (right panels). (C) High frequency of pre-b cells in the spleen of 24-week old CD19 +/Cre Sfpi1 lox/lox Spib -/- mice. Flow cytometric analysis was used to analyze expression of cell surface CD19, B220, and CD93 on splenocytes from a 6-week old C57Bl/6 mouse (left panels) or a 24-week old CD19 +/Cre Sfpi1 lox/lox Spib -/- mouse (right panels). (D) High frequency of pre-b cells in an enlarged lymph node of a 24-week old CD19 +/Cre Sfpi1 lox/lox Spib -/- mouse. Flow cytometric analysis was used to analyze expression of cell surface CD19, B220, and CD93 on cells from the enlarged lymph node of a 24-week old CD19 +/Cre Sfpi1 lox/lox Spib -/- mouse.
5
6
7
Revised: RG-RV2 by Fukuhara et al.
Supplemental Figure 1 The generation of Spns2 conditional knockout mice. (A) Schematic representation of the wild type Spns2 locus (Spns2 + ), the targeted allele, the floxed allele (Spns2 f ) and the
More informationPercent survival. Supplementary fig. S3 A.
Supplementary fig. S3 A. B. 100 Percent survival 80 60 40 20 Ml 0 0 100 C. Fig. S3 Comparison of leukaemia incidence rate in the triple targeted chimaeric mice and germline-transmission translocator mice
More informationSupplemental Table S1. RT-PCR primers used in this study
Supplemental Table S1. RT-PCR primers used in this study -----------------------------------------------------------------------------------------------------------------------------------------------
More informationNature Immunology: doi: /ni Supplementary Figure 1. Zranb1 gene targeting.
Supplementary Figure 1 Zranb1 gene targeting. (a) Schematic picture of Zranb1 gene targeting using an FRT-LoxP vector, showing the first 6 exons of Zranb1 gene (exons 7-9 are not shown). Targeted mice
More information(A-B) P2ry14 expression was assessed by (A) genotyping (upper arrow: WT; lower
Supplementary Figures S1. (A-B) P2ry14 expression was assessed by (A) genotyping (upper arrow: ; lower arrow: KO) and (B) q-pcr analysis with Lin- cells, The white vertical line in panel A indicates that
More informationLRBA is Essential for Allogeneic Responses in Bone Marrow Transplantation
LRBA is Essential for Allogeneic Responses in Bone Marrow Transplantation Mi Young Park, 1# Raki Sudan, 1# Neetu Srivastava, 1 Sudha Neelam, 1 Christie Youngs, 1 Jia- Wang Wang, 4 Robert W. Engelman, 5,6,7
More informationSupplementary Methods
Supplementary Methods Reverse transcribed Quantitative PCR. Total RNA was isolated from bone marrow derived macrophages using RNeasy Mini Kit (Qiagen), DNase-treated (Promega RQ1), and reverse transcribed
More informationSupplementary Figures and Figure legends
Supplementary Figures and Figure legends 3 Supplementary Figure 1. Conditional targeting construct for the murine Satb1 locus with a modified FLEX switch. Schematic of the wild type Satb1 locus; the conditional
More informationSUPPLEMENTARY INFORMATION
doi: 1.138/nature875 a promoter firefly luciferase CNS b Supplementary Figure 1. Dual luciferase assays on enhancer activity of CNS1, 2, and 3. a. promoter sequence was inserted upstream of firefly luciferase
More informationSupplementary Figure 1. Xbp1 deficiency does not alter hematopoietic cellularity.
Supplementary Figure 1 Xbp1 deficiency does not alter hematopoietic cellularity. Absolute number of leukocytes obtained from bone marrow (BM, 2 tibias and 2 femurs per mouse) of Xbp1 f/f and Xbp1 Vav1
More informationTumour 2. Tumour 9. Tumour 25 Tumour 26. Tumour 27. t(6;16) doi: /nature06159 SUPPLEMENTARY INFORMATION Supplementary Figure 1
doi: 1.18/nature6159 SUPPLEMENTARY INFORMATION Supplementary Figure 1 Tumour Tumour 9 t(6;16) Tumour 5 Tumour 6 Tumour 7 www.nature.com/nature 1 doi: 1.18/nature6159 SUPPLEMENTARY INFORMATION Supplementary
More informationPrimePCR Assay Validation Report
Gene Information Gene Name major histocompatibility complex, class II, DR beta 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID HLA-DRB1 Human HLA-DRB1 belongs
More informationPrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID Glyceraldehyde-3-phosphate dehydrogenase Gapdh Rat This gene encodes a member of
More informationGeneration of App knock-in mice reveals deletion mutations protective against Alzheimer s. disease-like pathology. Nagata et al.
Generation of App knock-in mice reveals deletion mutations protective against Alzheimer s disease-like pathology Nagata et al. Supplementary Fig 1. Previous App knock-in model did not show Aβ accumulation
More informationPrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID mcf.2 transforming sequence-like Mcf2l Mouse Description Not Available C130040G20Rik,
More informationSupporting Information
(xe number cells) LSK (% gated) Supporting Information Youm et al../pnas. SI Materials and Methods Quantification of sjtrecs. CD + T subsets were isolated from splenocytes using mouse CD + T cells positive
More informationNature Immunology: doi: /ni.3694
Supplementary Figure 1 Expression of Bhlhe41 and Bhlhe40 in B cell development and mature B cell subsets. (a) Scatter plot showing differential expression of genes between splenic B-1a cells and follicular
More informationSupplementary Figure 1. Characterization of the POP2 transcriptional and post-transcriptional regulatory elements. (A) POP2 nucleotide sequence
1 5 6 7 8 9 10 11 1 1 1 Supplementary Figure 1. Characterization of the POP transcriptional and post-transcriptional regulatory elements. (A) POP nucleotide sequence depicting the consensus sequence for
More informationDevelopment of CD11b-IRF8 transgenic and MTAG double transgenic mice The CMV-
Supplemental Data Development of CD11b-IRF8 transgenic and MTAG double transgenic mice The CMV- IRF8 transgenic mouse was previously developed by cloning complementary DNA, containing the IRF-8 coding
More informationSUPPLEMENTARY INFORMATION
6 Relative levels of ma3 RNA 5 4 3 2 1 LN MG SG PG Spl Thy ma3 ß actin Lymph node Mammary gland Prostate gland Salivary gland Spleen Thymus MMTV target tissues Fig. S1: MMTV target tissues express ma3.
More informationPrimePCR Assay Validation Report
Gene Information Gene Name collagen, type IV, alpha 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID COL4A1 Human This gene encodes the major type IV alpha
More informationPrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID myeloperoxidase MPO Human Myeloperoxidase (MPO) is a heme protein synthesized during
More informationWe designed the targeting vector in such a way that the first exon was flanked by two LoxP sites and
Mice We designed the targeting vector in such a way that the first exon was flanked by two LoxP sites and an Frt flanked neo cassette (Fig. S1A). Targeted BA1 (C57BL/6 129/SvEv) hybrid embryonic stem cells
More informationSUPPLEMENTARY INFORMATION
AS-NMD modulates FLM-dependent thermosensory flowering response in Arabidopsis NATURE PLANTS www.nature.com/natureplants 1 Supplementary Figure 1. Genomic sequence of FLM along with the splice sites. Sequencing
More informationPrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID glyceraldehyde-3-phosphate dehydrogenase GAPDH Human The product of this gene catalyzes
More informationSupplemental Figure 1
Supplemental Figure 1 Supplemental figure 1. Generation of gene targeted mice expressing an anti-id BCR. (A,B) Generation of the VDJ aid H KI mouse. (A) Targeting Construct. Top: Targeting construct for
More informationSUPPLEMENTARY INFORMATION
Supplementary Figure 1. Defective T and B cell lineage development in the absence of 53BP1. a, Average number of thymocytes in WT, 53BP1 /, p53 /, 53BP1 / / p53, Nbs1 tr735 and 53BP1 / Nbs1 tr735 mice
More informationPrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin)
More informationPrimePCR Assay Validation Report
Gene Information Gene Name keratin 78 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID KRT78 Human This gene is a member of the type II keratin gene family
More informationFig. S1. eif6 expression in HEK293 transfected with shrna against eif6 or pcmv-eif6 vector.
Fig. S1. eif6 expression in HEK293 transfected with shrna against eif6 or pcmv-eif6 vector. (a) Western blotting analysis and (b) qpcr analysis of eif6 expression in HEK293 T cells transfected with either
More informationPrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID Peptidyl-glycine alpha-amidating monooxygenase Peptidylglycine alpha-hydroxylating
More informationNature Biotechnology: doi: /nbt Supplementary Figure 1. In vitro validation of OTC sgrnas and donor template.
Supplementary Figure 1 In vitro validation of OTC sgrnas and donor template. (a) In vitro validation of sgrnas targeted to OTC in the MC57G mouse cell line by transient transfection followed by 4-day puromycin
More informationSupplementary Data. Flvcr1a TCTAAGGCCCAGTAGGACCC GGCCTCAACTGCCTGGGAGC AGAGGGCAACCTCGGTGTCC
Supplementary Data Supplementary Materials and Methods Measurement of reactive oxygen species accumulation in fresh intestinal rings Accumulation of reactive oxygen species in fresh intestinal rings was
More informationMaterials and Methods
Materials and Methods Construction of noxa / mice and genotyping The targeting vector (see Fig. S) was prepared from a C57BL/6 DNA λ phage library (Stratagene) by replacing a 2.7 kb region encompassing
More informationSupplemental Information. Inflammatory Ly6C high Monocytes Protect. against Candidiasis through IL-15-Driven. NK Cell/Neutrophil Activation
Immunity, Volume 46 Supplemental Information Inflammatory Ly6C high Monocytes Protect against Candidiasis through IL-15-Driven NK Cell/Neutrophil Activation Jorge Domínguez-Andrés, Lidia Feo-Lucas, María
More informationNature Immunology: doi: /ni Supplementary Figure 1
Supplementary Figure 1 Sox2 localizes in neutrophils of mouse spleen. (a) Microscopy analysis of Sox2 and MPO in wild-type mouse spleen. Nucl, nucleus. (b) Immunohistochemistry staining of Sox2 and MPO
More informationPrimePCR Assay Validation Report
Gene Information Gene Name cholinergic receptor, nicotinic, alpha 9 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID CHRNA9 Human This gene is a member of
More informationFigure S Relative MUC4 transcript level* CD18/HPAF CD18/HPAF-Scr CD18/HPAF-siMUC4
Figure S1 Relative MUC4 transcript level* 1.4 1.2 1 0.8 0.6 0.4 0.2 0 CD18/HPAF CD18/HPAF-Scr CD18/HPAF-siMUC4 Figure S2 * * CD18/HPAF-Scr CD18/HPAF-siMUC4 CD18/HPAF-Scr CD18/HPAF-siMUC4 Figure S3 CD18/HPAF-Scr
More informationPrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID protein kinase N1 PKN1 Human The protein encoded by this gene belongs to the protein
More informationNature Immunology: doi: /ni Supplementary Figure 1
Supplementary Figure 1 PPAR-γ is dispensable for the development of tissue macrophages in the heart, kidneys, lamina propria and white adipose tissue. Plots show the expression of F4/80 and CD11b (a) or
More informationPrimePCR Assay Validation Report
Gene Information Gene Name keratin associated protein 9-2 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID KRTAP9-2 Human This protein is a member of the keratin-associated
More informationPrimePCR Assay Validation Report
Gene Information Gene Name minichromosome maintenance complex component 8 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID MCM8 Human The protein encoded by
More informationPrimePCR Assay Validation Report
Gene Information Gene Name SRY (sex determining region Y)-box 6 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID SOX6 Human This gene encodes a member of the
More informationPrimePCR Assay Validation Report
Gene Information Gene Name keratin 3 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID KRT3 Human The protein encoded by this gene is a member of the keratin
More informationNature Immunology: doi: /ni Supplementary Figure 1. Construction of lnckdm2b RFP reporter and lnckdm2b-knockout mice.
Supplementary Figure 1 Construction of lnckdm2b RFP reporter and lnckdm2b-knockout mice. (a) ILC3s (Lin CD45 lo CD90 hi ) were isolated from small intestines, followed by immunofluorescence staining. LncKdm2b
More informationSupplementary Materials for
advances.sciencemag.org/cgi/content/full/4/9/eaat5401/dc1 Supplementary Materials for GLK-IKKβ signaling induces dimerization and translocation of the AhR-RORγt complex in IL-17A induction and autoimmune
More informationPrimePCR Assay Validation Report
Gene Information Gene Name integrin, alpha 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID ITGA1 Human This gene encodes the alpha 1 subunit of integrin
More informationPrimePCR Assay Validation Report
Gene Information Gene Name heat shock 10kDa protein 1 (chaperonin 10) Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID HSPE1 Human This gene encodes a major
More informationSupplementary Table S1
Primers used in RT-qPCR, ChIP and Bisulphite-Sequencing. Quantitative real-time RT-PCR primers Supplementary Table S1 gene Forward primer sequence Reverse primer sequence Product TRAIL CAACTCCGTCAGCTCGTTAGAAAG
More informationPrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID thyroglobulin TG Human Thyroglobulin (Tg) is a glycoprotein homodimer produced
More informationWho pairs with whom? High-throughput sequencing of the human paired heavy and light chain repertoire
Who pairs with whom? High-throughput sequencing of the human paired heavy and light chain repertoire Technical Journal Club September 15 th Christina Müller Background - antibody repertoire is the sum
More informationa Lamtor1 (gene) b Lamtor1 (mrna) c WT Lamtor1 Lamtor1 flox Lamtor2 A.U. p = LysM-Cre Lamtor3 Lamtor4 Lamtor5 BMDMs: Φ WT Φ KO β-actin WT BMDMs
a Lamtor (gene) b Lamtor (mrna) c BMDMs: Φ WT Φ KO Lamtor flox 8 bp LysM-Cre 93 bp..5 p =.4 WT BMDMs: Φ WT Φ KO Lamtor (protein) BMDMs: Φ WT Φ KO Lamtor 8 kda Lamtor 4 kda Lamtor3 4 kda Lamtor4 kda Lamtor5.5
More informationPrimePCR Assay Validation Report
Gene Information Gene Name keratin 5 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID KRT5 Human The protein encoded by this gene is a member of the keratin
More informationPrimePCR Assay Validation Report
Gene Information Gene Name growth differentiation factor 6 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID GDF6 Human This gene encodes a member of the bone
More informationStudent Learning Outcomes (SLOS)
Student Learning Outcomes (SLOS) KNOWLEDGE AND LEARNING SKILLS USE OF KNOWLEDGE AND LEARNING SKILLS - how to use Annhyb to save and manage sequences - how to use BLAST to compare sequences - how to get
More informationPrimePCR Assay Validation Report
Gene Information Gene Name 3-hydroxybutyrate dehydrogenase, type 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID BDH1 Human This gene encodes a member of
More informationPrimePCR Assay Validation Report
Gene Information Gene Name sortilin 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID SORT1 Human This gene encodes a protein that is a multi-ligand type-1
More informationPrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID peptidylglycine alpha-amidating monooxygenase PAM Human This gene encodes a multifunctional
More informationSupplementary Figure S1: (A) Schematic representation of the Jarid2 Flox/Flox
Supplementary Figure S1: (A) Schematic representation of the Flox/Flox locus and the strategy used to visualize the wt and the Flox/Flox mrna by PCR from cdna. An example of the genotyping strategy is
More informationPrimePCR Assay Validation Report
Gene Information Gene Name laminin, beta 3 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID LAMB3 Human The product encoded by this gene is a laminin that
More informationSupplemental Information
Supplemental Information Itemized List Materials and Methods, Related to Supplemental Figures S5A-C and S6. Supplemental Figure S1, Related to Figures 1 and 2. Supplemental Figure S2, Related to Figure
More informationPrimePCR Assay Validation Report
Gene Information Gene Name transforming growth factor, beta 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID TGFB1 Human This gene encodes a member of the
More informationPrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID caspase 9, apoptosis-related cysteine peptidase CASP9 Human This gene encodes a
More informationPrimePCR Assay Validation Report
Gene Information Gene Name bestrophin 3 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID BEST3 Human BEST3 belongs to the bestrophin family of anion channels
More informationPrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID STE20-related kinase adaptor alpha STRADA Human The protein encoded by this gene
More informationReceptor Revision Diminishes the Autoreactive B Cell Response after Antigen. PNA Tet. Day 8. Day 16
Receptor Revision Diminishes the Autoreactive Cell Response after Antigen Activation Ying-Hua Wang and etty Diamond Supplemental data: PNA Tet 5 8 11 16 Supplemental Figure 1: Kinetic analysis of tetramer-binding
More informationPrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase
More informationSupplementary Material & Methods
Supplementary Material & Methods Affymetrix micro-array Total RNA was extracted using Trizol reagent (Invitrogen, Carlsbad, USA). RNA concentration and quality was determined using the ND-1000 spectrophotometer
More informationRecombination Lecture, Dr. Aguilera 2/17/2014
Lymphocytes and Antigen Receptors Thymus T-Cells Lymph nodes Spleen } T+B-cells Paper Presentation: Bone Marrow Stem cells and B-cells Nat. Rev. Immunol. STEM CELL CLP Committed Lymphocyte Precursor T-cells
More informationPrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID protein phosphatase, Mg2+/Mn2+ dependent, 1A PPM1A Human The protein encoded by
More informationPrimePCR Assay Validation Report
Gene Information Gene Name cytochrome P450, family 2, subfamily C, polypeptide 9 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID CYP2C9 Human This gene encodes
More informationSUPPLEMENTARY DATA. Table S1 Clinical features of new SS/MF patients enrolled in SNP6.0 and 10K analysis. % of TCRVß+ within CD3+CD4+
SUPPLEMENTARY DATA Table S1 Clinical features of new SS/MF patients enrolled in SNP6.0 and 10K analysis Sample ID % of TCRVß+ Disease Sex/Age TCRVß Family CD4/CD8 Sample material within CD3+CD4+ 10K SNPs
More informationamplify the conditional allele (2-lox) and recombined allele (1-lox) following tamoxifen
Supplementary data Supplementary Table 1. Real-time PCR primer sequences Supplementary Fig. 1. (A) Genomic map of the Vhl (2-lox) conditional allele. Numbered boxes represent exon 1, which is targeted
More informationFigure S1. Generation of HspA4 -/- mice. (A) Structures of the wild-type (Wt) HspA4 -/- allele, targeting vector and targeted allele are shown together with the relevant restriction sites. The filled rectangles
More informationPrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID PARK2 co-regulated PACRG Human This gene encodes a protein that is conserved across
More informationSupporting Information
Supporting Information Tomura et al. 1.173/pnas.8227815 WT CFSE Con A stimulation Before After 2 3 1 CFSE Kaede- Tg No photoconversion Photoconversion Kaede Red Fig. S1. Dilution of photoconverted Kaede
More informationSupplementary Fig. 1: Characterization of Asxl2 -/- mouse model. (a) HSCs and their
Supplementary Fig. 1: Characterization of Asxl2 -/- mouse model. (a) HSCs and their differentiated cell populations were sorted from the BM of WT mice using respective surface markers, and Asxl2 mrna expression
More informationSupplementary Figure 1 An overview of pirna biogenesis during fetal mouse reprogramming. (a) (b)
Supplementary Figure 1 An overview of pirna biogenesis during fetal mouse reprogramming. (a) A schematic overview of the production and amplification of a single pirna from a transposon transcript. The
More informationPrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID coagulation factor XIII, A1 polypeptide F13A1 Human This gene encodes the coagulation
More informationPrimePCR Assay Validation Report
Gene Information Gene Name peptidylprolyl isomerase A (cyclophilin A) Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID PPIA Human This gene encodes a member
More informationembryos. Asterisk represents loss of or reduced expression. Brackets represent
Supplemental Figures Supplemental Figure 1. tfec expression is highly enriched in tail endothelial cells (A- B) ISH of tfec at 15 and 16hpf in WT embryos. (C- D) ISH of tfec at 36 and 38hpf in WT embryos.
More informationA novel tool for monitoring endogenous alpha-synuclein transcription by NanoLuciferase
A novel tool for monitoring endogenous alpha-synuclein transcription by NanoLuciferase tag insertion at the 3 end using CRISPR-Cas9 genome editing technique Sambuddha Basu 1, 3, Levi Adams 1, 3, Subhrangshu
More informationSUPPLEMENTAL MATERIAL
SUPPLEMENTAL MATERIAL MATERIALS AND METHODS Generation of TSPOΔ/Δ murine embryonic fibroblasts Embryos were harvested from 13.5-day pregnant TSPOfl/fl mice. After dissection to eviscerate and remove the
More informationTable S1. Primers used in the study
Table S1. Primers used in the study Primer name Application Sequence I1F16 Genotyping GGCAAGTGAGTGAGTGCCTA I1R11 Genotyping CCCACTCGTATTGACGCTCT V19 Genotyping GGGTCTCAAAGTCAGGGTCA D18Mit184-F Genotyping
More informationHC70AL SUMMER 2014 PROFESSOR BOB GOLDBERG Gene Annotation Worksheet
HC70AL SUMMER 2014 PROFESSOR BOB GOLDBERG Gene Annotation Worksheet NAME: DATE: QUESTION ONE Using primers given to you by your TA, you carried out sequencing reactions to determine the identity of the
More informationWT Day 90 after injections
Supplementary Figure 1 a Day 1 after injections Day 9 after injections Klf5 +/- Day 1 after injections Klf5 +/- Day 9 after injections BLM PBS b Day 1 after injections Dermal thickness (μm) 3 1 Day 9 after
More informationadministration of tamoxifen. Bars show mean ± s.e.m (n=10-11). P-value was determined by
Supplementary Figure 1. Chimerism of CD45.2 + GFP + cells at 1 month post transplantation No significant changes were detected in chimerism of CD45.2 + GFP + cells between recipient mice repopulated with
More informationRassf1a -/- Sav1 +/- mice. Supplementary Figures:
1 Supplementary Figures: Figure S1: Genotyping of Rassf1a and Sav1 mutant mice. A. Rassf1a knockout mice lack exon 1 of the Rassf1 gene. A diagram and typical PCR genotyping of wildtype and Rassf1a -/-
More informationSupplemental Materials. Matrix Proteases Contribute to Progression of Pelvic Organ Prolapse in Mice and Humans
Supplemental Materials Matrix Proteases Contribute to Progression of Pelvic Organ Prolapse in Mice and Humans Madhusudhan Budatha, Shayzreen Roshanravan, Qian Zheng, Cecilia Weislander, Shelby L. Chapman,
More informationSomatic Primary pirna Biogenesis Driven by cis-acting RNA Elements and Trans-Acting Yb
Cell Reports Supplemental Information Somatic Primary pirna Biogenesis Driven by cis-acting RNA Elements and Trans-Acting Yb Hirotsugu Ishizu, Yuka W. Iwasaki, Shigeki Hirakata, Haruka Ozaki, Wataru Iwasaki,
More informationSupplementary Figure 1 Generation of migg1-yf mice. (A) Targeting strategy. Upper panel: schematic organization of the murine ɣ1 immunoglobulin
Supplementary Figure 1 Generation of migg1-yf mice. (A) Targeting strategy. Upper panel: schematic organization of the murine ɣ1 immunoglobulin locus. The EcoRI restriction site between exons M1 and M2
More informationRelative Quantification: Data Management & Analysis Settings
Relative Quantification: Data Management & Analysis Settings Ray Meng, Ph.D. International Field Applications Specialist Gene Expression Division Bio-Rad Laboratories Gene Expression AMPLIFICATION Assay
More information4 Themes in B cell development + Ig class switch and somatic mutation Tony DeFranco, 10/28/13 Checkpoints in B cell development: feedback from Ig
4 Themes in B cell development + Ig class switch and somatic mutation Tony DeFranco, 10/28/13 Checkpoints in B cell development: feedback from Ig gene rearrangements Lineage commitment: transcription factors
More informationFile name: Supplementary Information Description: Supplementary figures and supplementary tables. File name: Peer review file Description:
File name: Supplementary Information Description: Supplementary figures and supplementary tables. File name: Peer review file Description: Supplementary figure 1 Flow diagram summarizing the overall experimental
More informationPei et al. Supplementary Figure S1
Pei et al. Supplementary Figure S1 C H-CUL9: + + + + + Myc-ROC1: - - + + + U2OS/pcDN3 U2OS/H-CUL9 U2OS/ + H-CUL9 IP: -H -myc input -H -myc 1 2 3 4 5 H-CUL9 Myc-ROC1 -H -H -H -H H-CUL9: wt RR myc-roc1:
More informationA Low salt diet. C Low salt diet + mf4-31c1 3. D High salt diet + mf4-31c1 3. B High salt diet
A Low salt diet GV [AU]:. [mmhg]: 0..... 09 9 7 B High salt diet GV [AU]:. [mmhg]: 7 8...0. 7.8 8.. 0 8 7 C Low salt diet + mf-c GV [AU]:. [mmhg]:.0.9 8.7.7. 7 8 0 D High salt diet + mf-c E Lymph capillary
More informationC57BL/6N Female. C57BL/6N Male. Prl2 WT Allele. Prl2 Targeted Allele **** **** WT Het KO PRL bp. 230 bp CNX. C57BL/6N Male 30.
A Prl Allele Prl Targeted Allele 631 bp 1 3 4 5 6 bp 1 SA β-geo pa 3 4 5 6 Het B Het 631 bp bp PRL CNX C 1 C57BL/6N Male (14) Het (7) (1) 1 C57BL/6N Female (19) Het (31) (1) % survival 5 % survival 5 ****
More informationBS 50 Genetics and Genomics Week of Oct 24
BS 50 Genetics and Genomics Week of Oct 24 Additional Practice Problems for Section Question 1: The following table contains a list of statements that apply to replication, transcription, both, or neither.
More informationRamp1 EPD0843_4_B11. EUCOMM/KOMP-CSD Knockout-First Genotyping
EUCOMM/KOMP-CSD Knockout-First Genotyping Introduction The majority of animals produced from the EUCOMM/KOMP-CSD ES cell resource contain the Knockout-First-Reporter Tagged Insertion allele. As well as
More information