Scientific Method. Name: NetID: Exam 1 Version 1 September 12, 2017 Dr. A. Pimentel
|
|
- Herbert Perry
- 6 years ago
- Views:
Transcription
1 Name: NetID: Exam 1 Version 1 September 12, 2017 Dr. A. Pimentel Each question has a value of 4 points and there is a total of 156 points in the exam. However, the maximum score of this exam will be capped at 150 points. Instructions: Select the BEST answer for each question Scientific Method 1- Insulin is a peptide hormone that reduces the amount of sugar in our bodies. What is the general sequence of cell-signaling events upon insulin binding to its receptor? A. 1. Receptor activation, 2. response, 3. signal transduction B. 1. Signal transduction, 2. response, 3. receptor activation C. 1. Response, 2. signal transduction, 3. receptor activation D. 1. Receptor activation, 2. signal transduction, 3. Response E. None of the answer choices are correct. 2- The mitogen-activated protein kinase (MAPK) are enzymes that are involved in a variety of cellular processes ranging from cell growth to cell survival. A scientist has identified MAPK-A, MAPK-B, and MAPK-C that appear to be involved in a cell survival pathway. What should the scientist do in order to determine the order in which these kinases act? A. Design an experiment using control cell lines to determine the order of the kinases. B. Design an experiment using cell lines with random mutations, which may affect a variety of processes in addition to mutating the kinases. C. Design an experiment using cell lines with specific mutations, which either permanently mutates the respective kinases to be either always on or always off. D. Choices B and C are both correct E. All of the answer choices are correct.
2 3- The scientist makes a statement stating, In order for the cell survival pathway to function properly, the MAPK-C kinase must function before MAPK-B. This is an example of a(n). A. Observation B. Hypothesis C. Prediction D. Experiment or new observation E. Theory 4- The scientist performed some initial experiments and she determined that MAPK-C functions before both MAPK-A and MAPK-B. She still does not know the proper order of MAPK-A and MAPK-B. These statements are an example of a(n). A. Observation B. Hypothesis C. Prediction D. New observation E. Experiment 5- The scientist determines that MAPK-C is present in an always on form, MAPK-A in an always off form, and MAPK-B in wild-type (normal) form. She believes that if she replaces the always off MAPK-A with a wild-type MAPK-A in a new experiment, it will result in the activation of wild-type MAPK-B. These statements are best described as an example of a(n). A. Observation B. Hypothesis C. Prediction D. Experiment or new observation E. Theory
3 6- After much research, the scientist confirmed and concluded that the proper order of the signaling pathway is MAPK-C MAPK-A MAPK-B. When MAPK-C is mutated to an always off form and MAPK-A is mutated to an always on form, what is activity of MAPK-B when the signal upstream MAPK-C is either present or absent? A. Signal present: ON, Signal absent: ON B. Signal present: OFF, Signal absent: OFF C. Signal present: ON, Signal absent: OFF D. Signal present: OFF, Signal absent: ON E. None of the answer choices are correct. 7- How does a scientific theory differ from a scientific hypothesis? A. Theories are proposed to test scientific hypotheses. B. A theory is an explanation for a very general phenomenon or observation that has been tested repeatedly; a hypothesis is an explanation about an observation. C. A hypothesis is an explanation for a very general phenomenon that has been tested over and over again; theories pertain to more specific issues. D. Theories define scientific laws; hypotheses are used to set up experiments. E. Hypotheses define scientific laws; theories are used to set up experiments. Amino acids are synthesized in a series of biochemical steps called metabolic pathways. The pathway to produce the amino acid arginine starts with a basic precursor molecule. The precursor molecule is processed by Enzyme 1 and gives rise to the first intermediate molecule called ornithine. It was also known that the molecule produced after ornithine is citrulline. Citrulline is finally used by Enzyme 3 to produce arginine. While the order of the molecules to produce arginine was clear, scientists knew little about the enzymes that are required to produce each of the intermediate molecules. They knew that three enzymes were involved in the pathway and only the position of Arg1 ( Enzyme 1 ) was known. The other two enzymes were ArgY and ArgW. Scientists decided to determine the correct order of enzymes ArgW and ArgY by mutating cells to produce cell lines in which either ArgY or ArgW was permanently inactive.
4 8- In order to inactivate the enzyme certain mutations should be created. This mutation must be done in which of the following molecules? A. Enzyme B. Proteins C. RNA D. DNA E. Carbohydrates 9- Which of the following is a plausible hypothesis? A. Ornithine ArgY Arginine ArgW Citrulline B. Ornithine ArgW Citrulline ArgY Arginine C. Precursor Enzyme 1 Ornithine ArgW D. Precursor ArgW Ornithine Enzyme 1 E. Arginine ArgY Citrulline ArgW Ornithine Cell Theory 10- Which of the following statements violate modern cell theory? A. All known living things are made up of one or more cells. B. Cells store hereditary information in the form of RNA and this is passed from cell to cell during cell division. C. Cells store hereditary information in the form of DNA and this is passed from cell to cell during cell division. D. All cells arise from pre-existing cells by division E. All of the answer choices are correct.
5 11- Fact: Photosynthesis is the process by which cells synthesize its own food using sunlight. Assertion Photosynthesis is an example of how energy flows in a living organism. Because Reason All plants have a common ancestor. 12- Assertion Because Reason All living organism are composed of cells. Cell division is the process by which cells divide and pass their DNA to their offspring. A. Assertion true, Reason true, Reason is the correct explanation B. Assertion true, Reason true, Reason is the correct explanation C. Assertion true, Reason false D. Assertion false, Reason true E. Assertion false, Reason true
6 Theory of Evolution 13- In evolution, a gene pool refers to. A. A group of individuals of the same species living in the same area at the same time. B. The total amount of gene variants in a population. C. A trait that increases the fitness of an individual in a given environment. D. the ability of an individual to produce offspring. E. None of the answer choices are correct. 14- Which of the following statement(s) is correct? I. Artificial selection selects traits based on human preference II. Natural selection chooses traits based on improving an organism s fitness III. Artificial selection does not necessarily improve fitness A. I, II B. I only C. III only D. I, II, III E. II only 15- The saguaro cactus is a native plant to the Sonoran Desert. In order to survive water shortage, young saguaro cacti grow under the shade of a nurse tree. This unique characteristic of saguaro cacti helps to increase their. A. Natural Selection B. Adaptation C. Evolution D. Fitness E. Artificial Selection
7 16- Assertion Adaptation refers to a trait that increases the fitness of an individual in a particular environment. Because Reason Under specific environmental pressures, some genetic traits that increase the fitness of individuals are more likely to be passed on. Samantha adores cats regularly rescues stray/mud cats from her community and takes them to the local animal rescue facilities so that they can be properly cared for and a new home can be found for them. One morning she rescues a litter of kittens and notices that one of them looks remarkably different from the rest. This kitten had extremely short legs but looks normal otherwise. The person called it Munchkin and decided to keep it because it looks cute. She was so attached to this munchkin that she decided to mate it and find out whether any offspring were born with the same trait. After various attempts, she got a couple of additional kittens with the same characteristic. She decided to keep mating those individuals with shorter legs until she could develop a new pure breed, which she called Munchkin.
8 17- She was able to develop the Munchkin breed because: A. She was persistence B. Shorter legs in cats increase their fitness C. The shorter leg trait was encoded in the DNA D. The shorter leg trait was encoded in the protein E. The shorter leg trait was encoded in the RNA 18- The description in the paragraph above is an example of. A. Natural selection B. Artificial selection C. Fitness D. Adaptation E. Genetic pool 19- The successful establishment of the Munchkin breed was possible because. A. There are genetic differences between the cat population B. Cats like to breed a lot C. There was not a selective pressure D. The size of the legs increases their fitness E. The size of their legs increases their adaptation to the city Molecules 20- Molecules that contain are able to form hydrogen bonds with water and easily dissolve in water. A. Non-polar covalent bonds B. Polar covalent bonds C. Hydrophobic interactions D. Dispersion forces E. None of the answer choices are correct
9 21- Naturally occurring Uranium is Uranium-238. The number refers to the atomic mass. However, for nuclear weapons to be the most catastrophic, Uranium-235, an isotope of natural Uranium, is used. What is the difference between Uranium-238 and Uranium-235? A. Uranium-238 has 3 more protons than Uranium-235 B. Uranium-238 has 3 more neutrons than Uranium-235 C. Uranium-235 has 3 more electrons than Uranium-238 D. Uranium-238 has 3 more electrical charges than Uranium-235 E. Uranium-235 has 3 more neutrons than Uranium Which of the following has the biggest effect on the chemical properties of an atom? A. The number of neutrons B. The mass number C. The number of electrons in the valence shell D. The number of orbitals the atom contains E. Whether or not the atom has protons 23- Assertion If atoms of fluoride (F) and radium (Ra) engaged in a chemical reaction, they will form a polar covalent bond. Reason There is a huge difference in the electronegativity value between fluoride (F) and radium (Ra).
10 Water 24- In the figure above, all of the molecules are linear monosaccharides. Based on the chemical structures shown in the figure, determine which monosaccharide will be the least soluble in water. 25- Assertion Because Reason The water molecule has a neutral ph. During the dissociation of the water molecule, equal number of hydrogen ions and hydroxide ions are produced.
11 ph 26- Fact: Human urine has a ph of 6, while the stomach acid has a ph of 2. Assertion The environment in the stomach is more acidic than typical human urine. Because Reason Compared to the urine, the stomach acid has a factor of more H+ (protons) than urine. 27- Industrial emissions contain toxic gases such as sulfur dioxide (SO 2) and nitrous oxide (NO). When these gases react with water in the atmosphere, they form sulfuric and nitric acids. These chemicals combine with rainwater and fall to the ground as acid rain (ph 4) and cause major environmental damages. When acid rain falls into ocean water (ph 8), the ph of the ocean decreases to 6, leading to toxic living conditions for marine life. Which of the following statements below is correct? A. The ocean water after acid rain contains approximately two times more [H+] than before acid rain. B. The ocean water before acid rain contains approximately two times more [H+] than after acid rain. C. The ocean water after acid rain contains approximately one hundred times more [H+] than before acid rain. D. The ocean water before acid rain contains approximately one hundred times more [H+] than after acid rain. E. The ocean water after acid rain contains approximately one thousand times more [H+] than before acid rain.
12 Proteins 28- Which of the following functional groups are found in nucleotide above? I.Phosphate group II. Hydroxyl group III.Carboxyl group IV. Amino group V.Carbonyl group A. I, II B. II, IV, V C. III, IV, V D. I, III, V E. I, II, IV 29- Which of the following best summarizes the relationship between dehydration reactions and hydrolysis? A. Dehydration reactions break down polymers and hydrolysis reactions create polymers. B. Macromolecular synthesis occurs through the addition of water and digestion occurs through the removal of water. C. Dehydration reactions can occur only after hydrolysis. D. Hydrolysis creates monomers, and dehydration reactions break down polymers. E. Dehydration reactions assemble polymers and hydrolysis reactions break down polymers.
13 Nucleic Acids 30- Assertion During RNA polymerization, RNA polymerase facilitates the formation of a phosphodiester bond. Because Reason In the RNA sequence 5 -AAUGC-3, the 3 hydroxyl group of guanine forms a phosphodiester bond with 5 phosphate group of uracil. 31- Which of the following statements about DNA and RNA is false? A. DNA is more stable relative to RNA B. The nucleotides in DNA and RNA can both form hydrogen bonding interactions C. DNA and RNA are both synthesized in the 5 to 3 direction D. Nucleic acids in the DNA contain deoxyribose sugars and nucleic acids in RNA contain ribose sugars E. All of the answer choices are correct. 32- If 30% of a double-stranded DNA molecule is composed of Guanine, what percent of Thymine is present in the DNA? A. 20% B. 30% C. 40% D. 50% E. 60%
14 Transcription 33- What is the proper order of events in which a pre-mrna is converted into a mature mrna? 1. 3 poly(a) tail 2. Splicing of introns and exons 3. 5 cap A. 1, 2, 3 B. 1, 3, 2 C. 3, 2, 1 D. 3, 1, 2 E. 2, 1, Evolutionarily, alternative splicing has enabled eukaryotic cells to? A. Create more unique protein coding messages from a given gene B. Create less unique protein coding messages from a given gene C. Maintain the same amount of protein coding messages for a given gene D. Reduce the size of their genome as more proteins can now be encoded for with less physical genes E. Both A and D are correct 35- Assertion In prokaryotes, transcription stops when RNA polymerase encounters a transcription termination signal. Because Reason Formation of RNA hairpin structure causes RNA polymerase to dissociate from DNA in prokaryotes.
15 36- Assertion Because Reason During transcription, the template is read from the 3 to 5 but the mrna is synthesized in the 5 to 3 direction. During transcription, the growing nucleic acid contains a ribose sugar and uracil nucleotide. 37- Assertion Because Reason If a RNA molecule contains 30% cytosine then this molecule must contain 30% guanine, 20% uracil and 20% adenine The RNA molecule contains uracil instead of thymine
16 38- A mutation caused by radiation in a prokaryotic organism destroys the -10 box of the promoter. Select the statement that correctly describes the most likely consequence of this mutation. A. The general transcription factor will no longer bind to the promoter. B. The transcriptional activator proteins will no longer bind to the promoter. C. The mediator protein will no longer bind to the promoter. D. The DNA will not bend to bring the enhancers closer to the promoter. E. The sigma subunit will no longer bind to the promoter. Extra Credit: 39- What is the correct mrna sequence synthesized based on the following template DNA sequence: 5 -AGTGCCTGATCT-3? A. 5 -AGUGCCUGAUCU-3 B. 5 -AGATCAGGCACT-3 C. 5 -AGAUCAGGCACU-3 D. 5 -TCACGGACTAGA-3 E. 5 -UCACGGACUAGA-3 Electronegativity Table:
17
DNA and RNA Structure. Unit 7 Lesson 1
Unit 7 Lesson 1 Students will be able to: Explain the structure and function of the DNA and RNA. Illustrate the structure of nucleotide. Summarize the differences between DNA and RNA. Identify the different
More informationDNA and RNA Structure Guided Notes
Nucleic acids, especially DNA, are considered as the key biomolecules that guarantee the continuity of life. DNA is the prime genetic molecule which carry all the hereditary information that's passed from
More informationVideos. Lesson Overview. Fermentation
Lesson Overview Fermentation Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast
More informationChapter 12: Molecular Biology of the Gene
Biology Textbook Notes Chapter 12: Molecular Biology of the Gene p. 214-219 The Genetic Material (12.1) - Genetic Material must: 1. Be able to store information that pertains to the development, structure,
More informationChapter 13. From DNA to Protein
Chapter 13 From DNA to Protein Proteins All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequenceof a gene The Path From Genes to
More informationBIOLOGY 111. CHAPTER 6: DNA: The Molecule of Life
BIOLOGY 111 CHAPTER 6: DNA: The Molecule of Life Chromosomes and Inheritance Learning Outcomes 6.1 Describe the structure of the DNA molecule and how this structure allows for the storage of information,
More informationMolecular Genetics. The flow of genetic information from DNA. DNA Replication. Two kinds of nucleic acids in cells: DNA and RNA.
Molecular Genetics DNA Replication Two kinds of nucleic acids in cells: DNA and RNA. DNA function 1: DNA transmits genetic information from parents to offspring. DNA function 2: DNA controls the functions
More informationFermentation. Lesson Overview. Lesson Overview 13.1 RNA
13.1 RNA THINK ABOUT IT DNA is the genetic material of cells. The sequence of nucleotide bases in the strands of DNA carries some sort of code. In order for that code to work, the cell must be able to
More informationVideos. Bozeman Transcription and Translation: Drawing transcription and translation:
Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast RNA and DNA. 29b) I can explain
More informationI. Gene Expression Figure 1: Central Dogma of Molecular Biology
I. Gene Expression Figure 1: Central Dogma of Molecular Biology Central Dogma: Gene Expression: RNA Structure RNA nucleotides contain the pentose sugar Ribose instead of deoxyribose. Contain the bases
More informationLesson Overview. Fermentation 13.1 RNA
13.1 RNA The Role of RNA Genes contain coded DNA instructions that tell cells how to build proteins. The first step in decoding these genetic instructions is to copy part of the base sequence from DNA
More informationBiology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall
Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 Essential Question What is transcription and translation and how do they take place? 3 of 39 12 3 RNA and Protein Synthesis Genes are coded
More informationBiology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall
Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 12 3 RNA and Protein Synthesis Genes are coded DNA instructions that control the production of proteins. Genetic messages can be decoded by
More informationProtein Synthesis ~Biology AP~
Protein Synthesis ~Biology AP~ A Meridian Study Guide by David Guan, Jennifer Zheng [Edited by Lei Gong] Introduction: - DNA and RNA are essential for life because they code for enzymes, which regulate
More informationFeedback D. Incorrect! No, although this is a correct characteristic of RNA, this is not the best response to the questions.
Biochemistry - Problem Drill 23: RNA No. 1 of 10 1. Which of the following statements best describes the structural highlights of RNA? (A) RNA can be single or double stranded. (B) G-C pairs have 3 hydrogen
More informationDNA Function: Information Transmission
DNA Function: Information Transmission DNA is called the code of life. What does it code for? *the information ( code ) to make proteins! Why are proteins so important? Nearly every function of a living
More informationUnit 1: DNA and the Genome. Sub-Topic (1.3) Gene Expression
Unit 1: DNA and the Genome Sub-Topic (1.3) Gene Expression Unit 1: DNA and the Genome Sub-Topic (1.3) Gene Expression On completion of this subtopic I will be able to State the meanings of the terms genotype,
More informationThe Flow of Genetic Information
Chapter 17 The Flow of Genetic Information The DNA inherited by an organism leads to specific traits by dictating the synthesis of proteins and of RNA molecules involved in protein synthesis. Proteins
More informationProtein Synthesis
HEBISD Student Expectations: Identify that RNA Is a nucleic acid with a single strand of nucleotides Contains the 5-carbon sugar ribose Contains the nitrogen bases A, G, C and U instead of T. The U is
More informationMake the protein through the genetic dogma process.
Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino
More informationQ. No. 1. How can RNA be distinguished from DNA?
Frequently asked questions (FAQS): Q. No. 1. How can RNA be distinguished from DNA? Ans. RNA and DNA are both nucleic acids, but differ in three main ways. First, unlike DNA which is generally double-stranded,
More informationPage 1. C) DNA molecules, only D) both DNA and RNA molecules. C) nitrogenous bases D) amino acids. C) starch and glycogen D) fats and oils
Name: 1) Which molecules are composed of units known as nucleotides? A) messenger RNA molecules, only B) transfer RNA molecules, only 2) The individuality of an organism is determined by the organism's
More informationLesson 8. DNA: The Molecule of Heredity. Gene Expression and Regulation. Introduction to Life Processes - SCI 102 1
Lesson 8 DNA: The Molecule of Heredity Gene Expression and Regulation Introduction to Life Processes - SCI 102 1 Genes and DNA Hereditary information is found in discrete units called genes Genes are segments
More informationKey Area 1.3: Gene Expression
Key Area 1.3: Gene Expression RNA There is a second type of nucleic acid in the cell, called RNA. RNA plays a vital role in the production of protein from the code in the DNA. What is gene expression?
More informationResources. How to Use This Presentation. Chapter 10. Objectives. Table of Contents. Griffith s Discovery of Transformation. Griffith s Experiments
How to Use This Presentation To View the presentation as a slideshow with effects select View on the menu bar and click on Slide Show. To advance through the presentation, click the right-arrow key or
More informationThe Structure of Proteins The Structure of Proteins. How Proteins are Made: Genetic Transcription, Translation, and Regulation
How Proteins are Made: Genetic, Translation, and Regulation PLAY The Structure of Proteins 14.1 The Structure of Proteins Proteins - polymer amino acids - monomers Linked together with peptide bonds A
More information1.5 Nucleic Acids and Their Functions Page 1 S. Preston 1
AS Unit 1: Basic Biochemistry and Cell Organisation Name: Date: Topic 1.5 Nucleic Acids and their functions Page 1 From the syllabus: 1.5 Nucleic Acids and Their Functions Page 1 S. Preston 1 l. Nucleic
More informationPROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein
PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein This is also known as: The central dogma of molecular biology Protein Proteins are made
More informationReview Quizzes Chapters 11-16
Review Quizzes Chapters 11-16 1. In pea plants, the allele for smooth seeds (S) is dominant over the allele for wrinkled seeds (s). In an experiment, when two hybrids are crossed, what percent of the offspring
More informationNucleic Acids. OpenStax College. 1 DNA and RNA
OpenStax-CNX module: m44403 1 Nucleic Acids OpenStax College This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 4.0 By the end of this section, you will be
More informationBundle 5 Test Review
Bundle 5 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? _Nucleic
More informationGene Expression: Transcription, Translation, RNAs and the Genetic Code
Lecture 28-29 Gene Expression: Transcription, Translation, RNAs and the Genetic Code Central dogma of molecular biology During transcription, the information in a DNA sequence (a gene) is copied into a
More informationBig Idea 3C Basic Review
Big Idea 3C Basic Review 1. A gene is a. A sequence of DNA that codes for a protein. b. A sequence of amino acids that codes for a protein. c. A sequence of codons that code for nucleic acids. d. The end
More informationRNA, & PROTEIN SYNTHESIS. 7 th Grade, Week 4, Day 1 Monday, July 15, 2013
RNA, & PROTEIN SYNTHESIS 7 th Grade, Week 4, Day 1 Monday, July 15, 2013 The Central Dogma RNA vs. DNA Ribonucleic Acid RNA is required for translation of genetic information stored in DNA into protein
More informationExam 2 Key - Spring 2008 A#: Please see us if you have any questions!
Page 1 of 5 Exam 2 Key - Spring 2008 A#: Please see us if you have any questions! 1. A mutation in which parts of two nonhomologous chromosomes change places is called a(n) A. translocation. B. transition.
More informationFind this material useful? You can help our team to keep this site up and bring you even more content consider donating via the link on our site.
Find this material useful? You can help our team to keep this site up and bring you even more content consider donating via the link on our site. Still having trouble understanding the material? Check
More informationThe Structure of RNA. The Central Dogma
12-3 12-3 RNA and Protein Synthesis The Structure of RNA The Central Dogma Phenotype A gene is a SEQUENCE of DNA that codes for a protein (or functional RNA). Phenotype is the individual s observable trait
More informationDNA REPLICATION. DNA structure. Semiconservative replication. DNA structure. Origin of replication. Replication bubbles and forks.
DNA REPLICATION 5 4 Phosphate 3 DNA structure Nitrogenous base 1 Deoxyribose 2 Nucleotide DNA strand = DNA polynucleotide 2004 Biology Olympiad Preparation Program 2 2004 Biology Olympiad Preparation Program
More informationTranscription. The sugar molecule found in RNA is ribose, rather than the deoxyribose found in DNA.
Transcription RNA (ribonucleic acid) is a key intermediary between a DNA sequence and a polypeptide. RNA is an informational polynucleotide similar to DNA, but it differs from DNA in three ways: RNA generally
More informationDNA Structure & the Genome. Bio160 General Biology
DNA Structure & the Genome Bio160 General Biology Lecture Outline I. DNA A nucleic acid II. Chromosome Structure III. Chromosomes and Genes IV. DNA vs. RNA I. DNA A Nucleic Acid Structure of DNA: Remember:
More informationNucleic Acids and the Encoding of Biological Information. Chapter 3
Nucleic Acids and the Encoding of Biological Information Chapter 3 GRIFFITH S EXPERIMENT ON THE NATURE OF THE GENETIC MATERIAL In 1928, Frederick Griffith demonstrated that molecules can transfer genetic
More informationChapter 16 DNA: The Genetic Material. The Nature of Genetic Material. Chemical Nature of Nucleic Acids. Chromosomes - DNA and protein
Chapter 16 DNA: The Genetic Material The Nature of Genetic Material Chromosomes - DNA and protein Genes are subunits DNA = 4 similar nucleotides C(ytosine) A(denine) T(hymine) G(uanine) Proteins = 20 different
More informationUnit 6: Biomolecules
Unit 6: Biomolecules Name: Period: Test 1 Table of Contents Title of Page Page Number Due Date Unit 6 Warm-Ups 3-4 Unit 6 KUDs 5-6 Biomolecules Cheat Sheet 7 Biomolecules Sorting Review 8-9 Unit 6 Vocabulary
More informationProteins and Protein Synthesis body structures, hormones, enzymes & antibodies amino acids sequence number DNA chemical code codon 'initiator'
Proteins and Protein Synthesis - Proteins : large complex molecules that make up body structures, hormones, enzymes & antibodies : are composed of subunits called amino acids : there are 20 different amino
More information12 1 DNA. Slide 1 of 37. End Show. Copyright Pearson Prentice Hall:
12 1 DNA 1 of 37 http://www.biologyjunction.com/powerpoints_dragonfly_book_prent.htm 12 1 DNA Griffith and Transformation Griffith and Transformation In 1928, Fredrick Griffith was trying to learn how
More informationMolecular Genetics Student Objectives
Molecular Genetics Student Objectives Exam 1: Enduring understanding 3.A: Heritable information provides for continuity of life. Essential knowledge 3.A.1: DNA, and in some cases RNA, is the primary source
More informationChapter 14: From DNA to Protein
Chapter 14: From DNA to Protein Steps from DNA to Proteins Same two steps produce all proteins: 1) DNA is transcribed to form RNA Occurs in the nucleus RNA moves into cytoplasm 2) RNA is translated in
More informationNucleic Acids. By Sarah, Zach, Joanne, and Dean
Nucleic Acids By Sarah, Zach, Joanne, and Dean Basic Functions Carry genetic information (DNA storing it) Protein synthesis Helps in cell division (DNA replicates itself) RNA- numerous functions during
More informationtranslation The building blocks of proteins are? amino acids nitrogen containing bases like A, G, T, C, and U Complementary base pairing links
The actual process of assembling the proteins on the ribosome is called? translation The building blocks of proteins are? Complementary base pairing links Define and name the Purines amino acids nitrogen
More informationLecture Summary: Regulation of transcription. General mechanisms-what are the major regulatory points?
BCH 401G Lecture 37 Andres Lecture Summary: Regulation of transcription. General mechanisms-what are the major regulatory points? RNA processing: Capping, polyadenylation, splicing. Why process mammalian
More informationNeurospora mutants. Beadle & Tatum: Neurospora molds. Mutant A: Mutant B: HOW? Neurospora mutants
Chapter 10: Central Dogma Gene Expression and Regulation Mutant A: Neurospora mutants Mutant B: Not made Not made Fact 1: DNA contains information but is unable to carry out actions Fact 2: Proteins are
More informationChapter 12. DNA TRANSCRIPTION and TRANSLATION
Chapter 12 DNA TRANSCRIPTION and TRANSLATION 12-3 RNA and Protein Synthesis WARM UP What are proteins? Where do they come from? From DNA to RNA to Protein DNA in our cells carry the instructions for making
More informationIntroduction to Cellular Biology and Bioinformatics. Farzaneh Salari
Introduction to Cellular Biology and Bioinformatics Farzaneh Salari Outline Bioinformatics Cellular Biology A Bioinformatics Problem What is bioinformatics? Computer Science Statistics Bioinformatics Mathematics...
More informationNucleic Acids: DNA and RNA
Nucleic Acids: DNA and RNA Living organisms are complex systems. Hundreds of thousands of proteins exist inside each one of us to help carry out our daily functions. These proteins are produced locally,
More information3.1.5 Nucleic Acids Structure of DNA and RNA
alevelbiology.co.uk 3.1.5 Nucleic Acids 3.1.5.1 Structure of DNA and RNA SPECIFICATION Deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) are important information-carrying molecules. In all living
More informationChapter 12-3 RNA & Protein Synthesis Notes From DNA to Protein (DNA RNA Protein)
Chapter 12-3 RNA & Protein Synthesis Notes From DNA to Protein (DNA RNA Protein) I. Review A. Cells copy their DNA (in S phase of Interphase)-Why? Prepare for Cell Division (Mitosis & Cytokinesis) Genes
More informationDNA and Biotechnology Form of DNA Form of DNA Form of DNA Form of DNA Replication of DNA Replication of DNA
21 DNA and Biotechnology DNA and Biotechnology OUTLINE: Replication of DNA Gene Expression Mutations Regulating Gene Activity Genetic Engineering Genomics DNA (deoxyribonucleic acid) Double-stranded molecule
More informationLecture Overview. Overview of the Genetic Information. Marieb s Human Anatomy and Physiology. Chapter 3 DNA & RNA Protein Synthesis Lecture 6
Marieb s Human Anatomy and Physiology Marieb Hoehn Chapter 3 DNA & RNA Protein Synthesis Lecture 6 Lecture Overview The Genetic Information Structure of DNA/RNA DNA Replication Overview of protein synthesis
More informationFrom Gene to Protein
8.2 Structure of DNA From Gene to Protein deoxyribonucleic acid - (DNA) - the ultimate source of all information in a cell This information is used by the cell to produce the protein molecules which are
More informationDNA. translation. base pairing rules for DNA Replication. thymine. cytosine. amino acids. The building blocks of proteins are?
2 strands, has the 5-carbon sugar deoxyribose, and has the nitrogen base Thymine. The actual process of assembling the proteins on the ribosome is called? DNA translation Adenine pairs with Thymine, Thymine
More informationWhat Are the Chemical Structures and Functions of Nucleic Acids?
THE NUCLEIC ACIDS What Are the Chemical Structures and Functions of Nucleic Acids? Nucleic acids are polymers specialized for the storage, transmission, and use of genetic information. DNA = deoxyribonucleic
More informationC. Incorrect! Threonine is an amino acid, not a nucleotide base.
MCAT Biology - Problem Drill 05: RNA and Protein Biosynthesis Question No. 1 of 10 1. Which of the following bases are only found in RNA? Question #01 (A) Ribose. (B) Uracil. (C) Threonine. (D) Adenine.
More informationGene function at the level of traits Gene function at the molecular level
Gene expression Gene function at the level of traits Gene function at the molecular level Two levels tied together since the molecular level affects the structure and function of cells which determines
More informationWinter Quarter Midterm Exam
1. For a science fair project, two students decided to repeat the Hershey and Chase experiment, with modifications. They decided to label the nitrogen of the DNA, rather than the phosphate. They reasoned
More informationChapter 3 Nucleic Acids, Proteins, and Enzymes
3 Nucleic Acids, Proteins, and Enzymes Chapter 3 Nucleic Acids, Proteins, and Enzymes Key Concepts 3.1 Nucleic Acids Are Informational Macromolecules 3.2 Proteins Are Polymers with Important Structural
More informationChapter 10: Gene Expression and Regulation
Chapter 10: Gene Expression and Regulation Fact 1: DNA contains information but is unable to carry out actions Fact 2: Proteins are the workhorses but contain no information THUS Information in DNA must
More informationWarm Up #15: Using the white printer paper on the table:
Warm Up #15: Using the white printer paper on the table: 1. Fold it into quarters. 2. Draw out the possible structure of what you think this picture is showing in one of the boxes (Hint: This is a macromolecule).
More informationThe discovery of the role of RNA RNA structure, synthesis and function
Central Dogma The discovery of the role of RNA RNA structure, synthesis and function! Fundamental observations in genetics!! Genes are located in nuclei (in eukaryotes)!! Polypeptides are synthesised in
More informationWhat is necessary for life?
Life What is necessary for life? Most life familiar to us: Eukaryotes FREE LIVING Or Parasites First appeared ~ 1.5-2 10 9 years ago Requirements: DNA, proteins, lipids, carbohydrates, complex structure,
More informationRNA & PROTEIN SYNTHESIS
RNA & PROTEIN SYNTHESIS DNA & RNA Genes are coded DNA instructions that control the production of proteins within the cell. The first step in decoding these genetic messages is to copy part of the nucleotide
More informationChapter 2. An Introduction to Genes and Genomes
PowerPoint Lectures for Introduction to Biotechnology, Second Edition William J.Thieman and Michael A.Palladino Chapter 2 An Introduction to Genes and Genomes Lectures by Lara Dowland Chapter Contents
More informationChromosomes. Chromosomes. Genes. Strands of DNA that contain all of the genes an organism needs to survive and reproduce
Chromosomes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce Genes Segments of DNA that specify how to build a protein genes may specify more than one
More informationNucleic Acids. Nucleic Acids. Nucleotides. Types of Nucleotides. Function: Examples: Structure: 3 parts. 2 types of nucleotides.
Nucleic Acids Nucleic Acids : store & transmit hereditary information : RNA (ribonucleic acid) DNA (deoxyribonucleic acid) Structure: monomers = nucleotides Nucleotides 3 parts nitrogen base (C-N ring)
More informationCentral Dogma. 1. Human genetic material is represented in the diagram below.
Central Dogma 1. Human genetic material is represented in the diagram below. 4. If 15% of a DNA sample is made up of thymine, T, what percentage of the sample is made up of cytosine, C? A) 15% B) 35% C)
More informationAP Biology Book Notes Chapter 3 v Nucleic acids Ø Polymers specialized for the storage transmission and use of genetic information Ø Two types DNA
AP Biology Book Notes Chapter 3 v Nucleic acids Ø Polymers specialized for the storage transmission and use of genetic information Ø Two types DNA Encodes hereditary information Used to specify the amino
More informationProofreading, post-replication modification of DNA. Mitesh Shrestha
Proofreading, post-replication modification of DNA Mitesh Shrestha Proofreading During DNA replication (copying), most DNA polymerases can check their work with each base that they add. This process is
More informationThe study of the structure, function, and interaction of cellular proteins is called. A) bioinformatics B) haplotypics C) genomics D) proteomics
Human Biology, 12e (Mader / Windelspecht) Chapter 21 DNA Which of the following is not a component of a DNA molecule? A) a nitrogen-containing base B) deoxyribose sugar C) phosphate D) phospholipid Messenger
More informationDNA, Replication and RNA
DNA, Replication and RNA The structure of DNA DNA, or Deoxyribonucleic Acid, is the blue prints for building all of life. DNA is a long molecule made up of units called NUCLEOTIDES. Each nucleotide is
More informationCh Molecular Biology of the Gene
Ch. 12 - Molecular Biology of the Gene AP BIOLOGY CHAPTER GUIDE 1. In the middle of the unraveling the mysteries of DNA, researchers knew that genetic material must be able to. It must be stable so it
More informationTranscription Eukaryotic Cells
Transcription Eukaryotic Cells Packet #20 1 Introduction Transcription is the process in which genetic information, stored in a strand of DNA (gene), is copied into a strand of RNA. Protein-encoding genes
More informationBiotechnology Unit 3: DNA to Proteins. From DNA to RNA
From DNA to RNA Biotechnology Unit 3: DNA to Proteins I. After the discovery of the structure of DNA, the major question remaining was how does the stored in the 4 letter code of DNA direct the and of
More informationSection 14.1 Structure of ribonucleic acid
Section 14.1 Structure of ribonucleic acid The genetic code Sections of DNA are transcribed onto a single stranded molecule called RNA There are two types of RNA One type copies the genetic code and transfers
More informationProtein Synthesis. DNA to RNA to Protein
Protein Synthesis DNA to RNA to Protein From Genes to Proteins Processing the information contained in DNA into proteins involves a sequence of events known as gene expression and results in protein synthesis.
More informationChapter 11. Gene Expression and Regulation. Lectures by Gregory Ahearn. University of North Florida. Copyright 2009 Pearson Education, Inc..
Chapter 11 Gene Expression and Regulation Lectures by Gregory Ahearn University of North Florida Copyright 2009 Pearson Education, Inc.. 11.1 How Is The Information In DNA Used In A Cell? Most genes contain
More informationIndependent Study Guide The Blueprint of Life, from DNA to Protein (Chapter 7)
Independent Study Guide The Blueprint of Life, from DNA to Protein (Chapter 7) I. General Principles (Chapter 7 introduction) a. Morse code distinct series of dots and dashes encode the 26 letters of the
More informationGENE EXPRESSION AT THE MOLECULAR LEVEL. Copyright (c) The McGraw-Hill Companies, Inc. Permission required for reproduction or display.
GENE EXPRESSION AT THE MOLECULAR LEVEL Copyright (c) The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 1 Gene expression Gene function at the level of traits Gene function
More informationProkaryotic Transcription
Prokaryotic Transcription Transcription Basics DNA is the genetic material Nucleic acid Capable of self-replication and synthesis of RNA RNA is the middle man Nucleic acid Structure and base sequence are
More informationChapter 17. From Gene to Protein. AP Biology
Chapter 17. From Gene to Protein Metabolism teaches us about genes Metabolic defects studying metabolic diseases suggested that genes specified proteins alkaptonuria (black urine from alkapton) PKU (phenylketonuria)
More informationDNA, RNA, Replication and Transcription
Harriet Wilson, Lecture Notes Bio. Sci. 4 - Microbiology Sierra College DNA, RNA, Replication and Transcription The metabolic processes described earlier (glycolysis, cellular respiration, photophosphorylation,
More informationLecture for Wednesday. Dr. Prince BIOL 1408
Lecture for Wednesday Dr. Prince BIOL 1408 THE FLOW OF GENETIC INFORMATION FROM DNA TO RNA TO PROTEIN Copyright 2009 Pearson Education, Inc. Genes are expressed as proteins A gene is a segment of DNA that
More informationReplication Review. 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells?
Replication Review 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells? 3. Where does DNA Replication take place in the cell cycle? 4. 4. What guides DNA Replication?
More informationNotes: (Our Friend) DNA. DNA Structure DNA is composed of 2 chains of repeating. A nucleotide = + +
Notes: (Our Friend) DNA Some DNA Basics DNA stands for DNA functions to & genetic info. This information tells an organism s cells what to make and when to make them. Proteins form cell structures and
More informationMolecular Genetics Quiz #1 SBI4U K T/I A C TOTAL
Name: Molecular Genetics Quiz #1 SBI4U K T/I A C TOTAL Part A: Multiple Choice (15 marks) Circle the letter of choice that best completes the statement or answers the question. One mark for each correct
More informationCh 10 Molecular Biology of the Gene
Ch 10 Molecular Biology of the Gene For Next Week Lab -Hand in questions from 4 and 5 by TUES in my mailbox (Biology Office) -Do questions for Lab 6 for next week -Lab practical next week Lecture Read
More informationTRANSCRIPTION COMPARISON OF DNA & RNA TRANSCRIPTION. Umm AL Qura University. Sugar Ribose Deoxyribose. Bases AUCG ATCG. Strand length Short Long
Umm AL Qura University TRANSCRIPTION Dr Neda Bogari TRANSCRIPTION COMPARISON OF DNA & RNA RNA DNA Sugar Ribose Deoxyribose Bases AUCG ATCG Strand length Short Long No. strands One Two Helix Single Double
More informationBiochemistry study of the molecular basis of life
Biochemistry : An Introduction Biochemistry study of the molecular basis of life n Study of the chemistry of living organisms Studies organic molecules & organic reactions in living organisms n Living
More informationDNA & Protein Synthesis UNIT D & E
DNA & Protein Synthesis UNIT D & E How this Unit is broken down Chapter 10.1 10.3 The structure of the genetic material Chapter 10.4 & 10.5 DNA replication Chapter 10.6 10.15 The flow of genetic information
More informationDNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test
DNA is the genetic material Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test Dr. Amy Rogers Bio 139 General Microbiology Hereditary information is carried by DNA Griffith/Avery
More informationClassical and Modern Genetics
Classical and Modern Genetics Chapter 23 Great Idea: All living things use the same genetic code to guide the chemical reactions in every cell. 1 Chapter Outline Classical Genetics DNA and the Birth of
More informationCELL BIOLOGY: DNA. Generalized nucleotide structure: NUCLEOTIDES: Each nucleotide monomer is made up of three linked molecules:
BIOLOGY 12 CELL BIOLOGY: DNA NAME: IMPORTANT FACTS: Nucleic acids are organic compounds found in all living cells and viruses. Two classes of nucleic acids: 1. DNA = ; found in the nucleus only. 2. RNA
More information