Development of a Tissue Slice Culture Model for Prostate Cancer
|
|
|
- Charles Dickerson
- 6 years ago
- Views:
Transcription
1 Development of a Tissue Slice Culture Model for Prostate Cancer Hanneke van Zoggel, PhD Experimental Urology Erasmus MC ; JNI, Be 330 j.vanzoggel@erasmusmc.nl 3D workshop 23/
2 Create novel models that sufficiently represent tumor complexity = deconstruction 2D on Plastic 3D Spheroids 3D Co-culture 3D Bioreactor Tissue Slices Human tumor xenografts / GEMMs reconstruction 2
3 Create novel models that sufficiently represent tumor complexity = deconstruction 2D on Plastic 3D Spheroids 3D Co-culture 3D Bioreactor Tissue Slices Human tumor xenografts / GEMMs reconstruction Can a tissue slice represent the «steady state» of an in vivo tumor? 3
4 Overview part 1: development and characterization - Tissue slice technology - Culture conditions: rotation / floating / filter insert - Evaluation by immunohistochemistry - Live fluorescent viability evaluation - Luminescence as viability read-out part 2: manipulation - Establishment & utilization of live cell reporter assays - Lentiviral infection with m21 4
5 Overview Tissue Slicing Aim: Developing advanced & transferable tissue slice model for prostate cancer 5
6 6
7 Comparisation of different cutting techniques Surgery knife Semi-automatic tissue slicer (Campden Instruments Ltd.) Automatic tissue slicer (Krumdieck) Automatic tissue slicer (Leica VT1200 S) Very thick slices Inconsistent in size and shape Inconsistent in size and shape Machine handling: Bad quality of slices not possible to observe the tissue during slicing slice area =? Slice quality (by eye) better than previous techniques Nicole Verkaik / Romana Nijman (dept. of Genetics) Area selection Direct quality impression Thin slices Consistent in thickness Minimal vertical deflection Instrument: easy fast safe small
8 8
9 Floating Culture conditions: - floating / filter support - stagnant / rotation 65rpm Filter support Millipore Filters: - Millicell standing inserts - Biopore PFTE, 0.4 µm pore size, Ø 12mm 9
10 Culture conditions Ki67 staining PC310 (300 µm) : +/- filter support Not cultured (day 0) Floating Filter Support Day 2 Day 7 20x magnification 10
11 Culture conditions AR staining PC310 (300 µm) : day 3 Not cultured (day 0) Floating Filter support Stagnant Rotation 20x magnification 11
12 Culture conditions AR staining PC310 (300 µm) : + filter support not cultured (day 0) day 3 day 8 2.5x magnification 20x magnification No equal dispersion of AR expressing cells within tissue slices 12
13 13
14 Immunohistochemical Evaluation PC310: + filter support Time in culture Day 0 Day 3 Day 7 H&E Ki67 20x magnification 14
15 Immunohistochemical Evaluation PC310: + filter support Time in culture Day 0 Day 3 Day 7 AR PSA ERG 20x magnification 15
16 Live Fluorescent Viability Evaluation PC346C: + filter Time in culture Day 0 Day 2 Day 7 TMRM = intact, active mitochondria Caspase-3 = apoptotic cells Confocal Zeiss Laser Scanning Microscope; 20x magnification 16
17 Structure and density of slice PC346C: + filter Day 2 Day 7 TMRM = intact, active mitochondria Caspase-3 = apoptotic cells Confocal Zeiss Laser Scanning Microscope; 20x magnification 17
18 Bioluminescence as Read-Out Viability Evaluation Luciferase Luciferin + ATP +O2 Mg2+ Oxyluciferin + AMP + Ppi + CO2 + Viable, healthy cells = ATP and luciferase expression luciferin conversion luminescent signal 18
19 Imaging of tissue slices from luciferase-gfp (m21) labelled xenografts VCaP cells infected with m21 xenograft formation in mice slicing infection m21 = lentiviral vector with luciferase-gfp fusion gene (ffluc2-egfp) driven by a CMV promoter (clone: R980-M21-685; Day et al., 2009) 19
20 Imaging of tissue slices from luciferase-gfp (m21) tagged xenografts VCaP-m21 IVIS Imaging System (Living Image 3.2; Caliper LifeSciences) - luciferin 2 days in culture + luciferin 6 days in culture + luciferin 20
21 Summary part 1: Leica VT1200S most appropriate for our purposes Rotation does not add to the tissue slice quality PC tissue slices (300 µm) cultured on filter inserts are viable for up to 7 days look more healthy and are more structured (higher cell density) present more proliferating cells present more AR, PSA and ERG expressing cells 21
22 Overview part 1: development and characterization - Tissue slice technology - Culture conditions: rotation / floating / filter insert - Evaluation by immunohistochemistry - Live fluorescent viability evaluation - Luminescence as viability read-out part 2: manipulation - Establishment & utilization of live cell reporter assays - Lentiviral infection with m21 22
23 Tissue slice infection with luciferase-gfp (m21) and imaging PC h after slicing m21 virus addition (during 48h) Imaging infection Also infection with: - gfp - trfp - Katushka (FP635 = near infra red) 23
24 Luminescent imaging of m21 infected tissue slices PC310 + m21 virus 2 days after infection [Medium:virus volume] A 1:0 1:1 3:1 B 1:0 x 3:1 7 days after infection 24
25 Fluorescent imaging of m21 infected tissue slices PC310 + m21 virus 1:1 3:1 [Medium:virus volume] Normal fluorescent microscopy Green fluorescence (GFP) 5 days after infection 9 days after infection 25
26 Summary part 2: Proof of concept of tissue slice infection with bifunctional reporter fusion gene ffluc2/egfp (m21) Infection can be observed by luminescent activity (IVIS) by fluorescence (confocal microscopy) 26
27 Short term perspectives (1/2): - Manipulation of tissue slices - Standardized and validated lentiviral infection protocol - visualization and translation of infection efficiency on tissue slices for - reporter genes for the AP1 and AR pathways - AP1 and ARE-driven reporters (luciferase / GFP = m21) - reporter genes for the STATs, NFkB pathways - PSA reporter - Establish sirna transfection protocol 27
28 Short term perspectives (2/2): - Tissue slices as model for pathway perturbation - effect of androgen (R1881) - effect of antiandrogens (flutamide, bicalutamide and RD162/MDV3100) - effect of drugs (cmet-inhibitors, CYP17 inhibitors, kinase inhibitors,.) - Further optimize slice and culture technique - to extent culture time of PC tissue slices up to 10 days - Test other parameters for read-out measurements - medium components, cell secretions 28
29 Manipulation of tissue slices = Genetic modification of PC - reporter assays - gene knockout / overexpression Tissue slice manipulation - hormones - drugs Tissue Slices Human tumor xenografts / GEMMs 29
30 Manipulation of tissue slices = Genetic modification of PC - reporter assays - gene knockout / overexpression Tissue slice manipulation - hormones - drugs Tissue Slices Human tumor xenografts / GEMMs 30
31 Manipulation of tissue slices = Genetic modification of PC - reporter assays - gene knockout / overexpression Tissue slice manipulation - hormones - drugs Tissue Slices Human tumor xenografts / GEMMs 31
32 Tissue slice model for therapy prediction better predictability of cancer drug precision or personalized treatment Analyze markers / possible targets - protein level - RNA level Tissue Slices Tissue slice manipulation - hormones - drugs - other therapies 32
33 Acknowledgements Erasmus MC, Rotterdam Urology Corrina de Ridder Debra Stuurman Sander Hoeben Agnes Boer Sigrun Erkens Mirella Vredenbregt Yin Versluis Wytske van Weerden Guido Jenster Servier, Paris Mike Burbridge Francisco Cruzalegui Pathology Arno van Leenders Marije Hoogland Esther Verhoef 33
Gaussia Luciferase-a Novel Bioluminescent Reporter for Tracking Stem Cells Survival, Proliferation and Differentiation in Vivo
Gaussia Luciferase-a Novel Bioluminescent Reporter for Tracking Stem Cells Survival, Proliferation and Differentiation in Vivo Rampyari Raja Walia and Bakhos A. Tannous 1 2 1 Pluristem Innovations, 1453
a Award Number: W81XWH TITLE:
AD Award Number: W81XWH-04-1-0138 TITLE: Imaging Metastatic Prostate Cancer After Genetic Manipulation of Transcriptional Memory Regulators EZH2 and EED PRINCIPAL INVESTIGATOR: Lily Wu, M.D., Ph.D. CONTRACTING
Cancer cells that survive radiation therapy acquire HIF-1 activity and translocate toward tumor blood vessels Supplementary Information
Cancer cells that survive radiation therapy acquire HIF-1 activity and translocate toward tumor blood vessels Supplementary Information 1. Supplementary Figure S1-S10: Pages 2-11 2. Supplementary References:
SureSilencing sirna Array Technology Overview
SureSilencing sirna Array Technology Overview Pathway-Focused sirna-based RNA Interference Topics to be Covered Who is SuperArray? Brief Introduction to RNA Interference Challenges Facing RNA Interference
How To Choose a GeneCopoeia Luciferase System. Ed Davis, Ph.D.
TECHNICAL NOTE How To Choose a GeneCopoeia Luciferase System Ed Davis, Ph.D. Introduction Luciferase reporter systems are invaluable tools for several applications, including regulation of gene expression
Factors to Consider for Designing and Optimizing Assays Applied to 3D Cultures
Factors to Consider for Designing and Optimizing Assays Applied to 3D Cultures Terry Riss 2016. Background and Justification for Using 3D Cell Culture Models Growing awareness of advantages of 3D cell
TITLE: Role of Hsp90 in Androgen-Refractory Prostate Cancer. CONTRACTING ORGANIZATION: University of Pittsburgh Pittsburgh, PA 15260
AD Award Number: W81XWH-07-1-0147 TITLE: Role of Hsp90 in Androgen-Refractory Prostate Cancer PRINCIPAL INVESTIGATOR: Zhou Wang, Ph.D. CONTRACTING ORGANIZATION: University of Pittsburgh Pittsburgh, PA
SUPPLEMENTAL FIGURE LEGENDS
SUPPLEMENTAL FIGURE LEGENDS Suppl. Fig. 1. Notch and myostatin expression is unaffected in the absence of p65 during postnatal development. A & B. Myostatin and Notch-1 expression levels were determined
Charles Shuler, Ph.D. University of Southern California Los Angeles, California Approved for Public Release; Distribution Unlimited
AD Award Number: DAMD17-01-1-0100 TITLE: Smad-Mediated Signaling During Prostate Growth and Development PRINCIPAL INVESTIGATOR: Charles Shuler, Ph.D. CONTRACTING ORGANIZATION: University of Southern California
TITLE: Elucidating Mechanisms of Farnesyltransferase Inhibitor Action and Resistance in Breast Cancer by Bioluminescence Imaging
AD Award Number: W81XWH-07-1-0426 TITLE: Elucidating Mechanisms of Farnesyltransferase Inhibitor Action and Resistance in Breast Cancer by Bioluminescence Imaging PRINCIPAL INVESTIGATOR: David Piwnica-Worms,
Developing Targeted Stem Cell Therapeutics for Cancer. Shawn Hingtgen, Ph.D. Assistant Professor UNC Eshelman School of Pharmacy May 22 nd, 2013
Developing Targeted Stem Cell Therapeutics for Cancer Shawn Hingtgen, Ph.D. Assistant Professor UNC Eshelman School of Pharmacy May 22 nd, 2013 The Challenge of Drug Delivery for Brain Cancer Stem Cells
Selected Techniques Part I
1 Selected Techniques Part I Gel Electrophoresis Can be both qualitative and quantitative Qualitative About what size is the fragment? How many fragments are present? Is there in insert or not? Quantitative
OriGene GFC-Arrays for High-throughput Overexpression Screening of Human Gene Phenotypes
OriGene GFC-Arrays for High-throughput Overexpression Screening of Human Gene Phenotypes High-throughput Gene Function Validation Tool Introduction sirna screening libraries enable scientists to identify
An Automated, Cell-based Platform for the Rapid Detection of Novel Androgen Receptor Modulators
A p p l i c a t i o n N o t e An Automated, Cell-based Platform for the Rapid Detection of Novel Androgen Receptor Modulators Brad Larson and Peter Banks, BioTek Instruments, Inc., Winooski, VT Bruce Sherf,
Cell Viability and Senescence Detection Kits
Cell Viability and Senescence Detection Kits Cell viability and proliferation assays Growth factor/cytokine assays Cell culture condition optimization Cell number determination Multiwell and automation
Supplementary Online Content
Supplementary Online Content Scher HI, Lu D, Schreiber NA, et al. Association of on circulating tumor cells as a treatment-specific biomarker with outcomes and survival in castration-resistant prostate
TITLE: Targeted Elimination of PCDH-PC Expressing Prostate Cancer Cells for Control of Hormone-Resistant Prostate Cancer
AD Award Number: W81XWH-06-01-0061 TITLE: Targeted Elimination of PCDH-PC Expressing Prostate Cancer Cells for Control of Hormone-Resistant Prostate Cancer PRINCIPAL INVESTIGATOR: Ralph Buttyan, Ph.D.
Targeting hexokinase 2 enhances response to radio-chemotherapy in glioblastoma
www.impactjournals.com/oncotarget/ Oncotarget, Supplementary Materials 2016 Targeting hexokinase 2 enhances response to radio-chemotherapy in glioblastoma Supplementary Materials Transfection of plasmids,
University of Pennsylvania Perelman School of Medicine High Throughput Screening Core
University of Pennsylvania Perelman School of Medicine High Throughput Screening Core Sara Cherry, Ph. D. David C. Schultz, Ph. D. dschultz@mail.med.upenn.edu (215) 573 9641 67 John Morgan Building Mission
OmicsLink shrna Clones guaranteed knockdown even in difficult-to-transfect cells
OmicsLink shrna Clones guaranteed knockdown even in difficult-to-transfect cells OmicsLink shrna clone collections consist of lentiviral, and other mammalian expression vector based small hairpin RNA (shrna)
Pre-made Reporter Lentivirus for p53 Signal Pathway
Pre-made Reporter for p53 Signal Pathway Cat# Product Name Amounts LVP977-P or: LVP977-P-PBS P53-GFP (Puro) LVP978-P or: LVP978-P-PBS P53-RFP (Puro) LVP979-P or: LVP979-P-PBS P53-Luc (Puro) LVP980-P or:
Firefly Luciferase Assay Kit
Firefly Luciferase Assay Kit Catalog Number: 30003-1 (150 assays) 30003-2 (1000 assays) Contact Information Address: Biotium, Inc. 3159 Corporate Place Hayward, CA 94545 USA Telephone: (510) 265-1027 Fax:
Supplementary Information
Supplementary Information Supplementary Figures Supplementary Figure 1. MLK1-4 phosphorylate MEK in the presence of RAF inhibitors. (a) H157 cells were transiently transfected with Flag- or HA-tagged MLK1-4
TITLE: Identification of Androgen Receptor-Regulated Genes in Castration-Recurrent Prostate Cancer
AD Award Number: W81XWH-11-1-0116 TITLE: Identification of Androgen Receptor-Regulated Genes in Castration-Recurrent Prostate Cancer PRINCIPAL INVESTIGATOR: Irwin H. Gelman, Ph.D. CONTRACTING ORGANIZATION:
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2743 Figure S1 stabilizes cellular protein level, post-transcriptionally. (a, b) and DDR1 were RNAi-depleted from HEK.293.-CBG cells. Western blots with indicated antibodies (a). RT-PCRs
3D Transfection System
3D Transfection System Why 3D Technology? Introduction to Three Dimensional (3D) Cell Culture The goal of three-dimensional (3D) cell culture is to eliminate the stress and artificial responses cells experience
Supplementary Figures
Supplementary Figures Supplementary Figure 1. Description of the observed lymphatic metastases in two different SIX1-induced MCF7 metastasis models (Nude and NOD/SCID). Supplementary Figure 2. MCF7-SIX1
A549-luc mock cells, A549-luc/shCon cells and A549-luc/shYY1 cells were seeded onto 35 mm
Supplementary Material and Methods Real-time luciferase gene expression in A549-luc cells A549-luc mock cells, A549-luc/shCon cells and A549-luc/shYY1 cells were seeded onto 35 mm dishes (100,000 cells/dish),
Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate
Supplementary Figure Legends Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate BC041951 in gastric cancer. (A) The flow chart for selected candidate lncrnas in 660 up-regulated
SUPPLEMENTARY INFORMATION
VOLUME: 1 ARTICLE NUMBER: 0011 In the format provided by the authors and unedited. In situ Activation of Platelets with Checkpoint Inhibitors for Post-Surgical Cancer Immunotherapy Chao Wang 1, 2, Wujin
UTR Reporter Vectors and Viruses
UTR Reporter Vectors and Viruses 3 UTR, 5 UTR, Promoter Reporter (Version 1) Applied Biological Materials Inc. #1-3671 Viking Way Richmond, BC V6V 2J5 Canada Notice to Purchaser All abm products are for
Partial list of differentially expressed genes from cdna microarray, comparing MUC18-
Supplemental Figure legends Table-1 Partial list of differentially expressed genes from cdna microarray, comparing MUC18- silenced and NT-transduced A375SM cells. Supplemental Figure 1 Effect of MUC-18
NanoPro Characterize cell signaling in your smallest samples
NanoPro 1000 Characterize cell signaling in your smallest samples Technology A NEW TAKE ON IMMUNOASSAYS The NanoPro 1000 is a capillary-based nano-immunoassay platform. As in Western blot analysis, proteins
Dihydrotestosterone synthesis pathways from
Dihydrotestosterone synthesis pathways from inactive androgen 5 -androstane-3,17 -diol in prostate cancer cells: Inhibition of intratumoural 3 -hydroxysteroid dehydrogenase activities by abiraterone Takashi
What goes into my Biological Inventory?
What goes into my Biological Inventory? What Information is Required for an Effective Risk Assessment? According to the Laboratory Biosafety Guidelines (2004), the risk group of an organism is determined
SUPPLEMENTARY INFORMATION
A diphtheria toxin resistance marker for in vitro and in vivo selection of stably transduced human cells Gabriele Picco, Consalvo Petti, Livio Trusolino, Andrea Bertotti and Enzo Medico SUPPLEMENTARY INFORMATION
Factors to Consider When Choosing Cell- Based Assays for Use with 3D Cultures
Factors to Consider When Choosing Cell- Based Assays for Use with 3D Cultures Corning Webinar December 16, 2014 Terry.riss@Promega.com 2012, Promega Corporation. Outline Justification for using 3D cell
Supporting Online Material for
www.sciencemag.org/cgi/content/full/327/5969/1126/dc1 Supporting Online Material for A Nodule-Specific Protein Secretory Pathway Required for Nitrogen- Fixing Symbiosis Dong Wang, Joel Griffitts, Colby
RayBio ApoSENSOR TM ATP Cell Viability Assay Kit
RayBio ApoSENSOR TM ATP Cell Viability Assay Kit User Manual Version 1.0 October 1 st, 2015 Cat#: 68CV-ATP-S200 Cat#: 68CV-ATP-S1000 RayBiotech, Inc. We Provide You With Excellent Support And Service Tel:(Toll
A histone H1-binding-aptide based apoptosis-imaging probe for monitoring
Electronic Supplementary Material (ESI) for MedChemComm. This journal is The Royal Society of Chemistry 2017 Supporting Information A histone H1-binding-aptide based apoptosis-imaging probe for monitoring
PROTOCOL. Live Cell Imaging of 3D Cultures Grown on Alvetex Scaffold Using Confocal Microscopy. Introduction
Page 1 Introduction Live cell imaging allows real time monitoring of cell shape and form during cell differentiation, proliferation and migration. Alvetex Scaffold offers a unique ability to study cell
detect and identify Junior LB 9509 The portable tube luminometer
detect and identify Junior LB 9509 The portable tube luminometer Junior LB 9509 The portable tube luminometer The Junior is a small portable tube luminometer designed for all common applications using
Supporting Online Material for
www.sciencemag.org/cgi/content/full/323/5911/256/dc1 Supporting Online Material for HDAC4 Regulates Neuronal Survival in Normal and Diseased Retinas Bo Chen and Constance L. Cepko E-mail: bochen@genetics.med.harvard.edu,
SKIN BIOLOGY A VALUABLE TOOL FOR THE INNOVATION AND DEVELOPMENT OF NOVEL THERAPEUTIC ALTERNATIVES IN DERMATOLOGY
SKIN BIOLOGY A VALUABLE TOOL FOR THE INNOVATION AND DEVELOPMENT OF NOVEL THERAPEUTIC ALTERNATIVES IN DERMATOLOGY COMPANY BACKGROUND Specializes in liquid and semi-solid topical products Rx, OTC & Therapeutic
FRAUNHOFER IME SCREENINGPORT
FRAUNHOFER IME SCREENINGPORT Detection technologies used in drug discovery Introduction Detection technologies in drug discovery is unlimited only a biased snapshot can be presented Differences can presented
Cell Culture Flasks DATA SHEET
DATA SHEET Cell Culture Flasks In research cell culture flasks are used as a matter of routine for the cultivation of eukaryotic cells. They are optimal products for adherent cells as well as for suspension
SUPPLEMENTARY INFORMATION
doi:10.1038/nature09732 Supplementary Figure 1: Depletion of Fbw7 results in elevated Mcl-1 abundance. a, Total thymocytes from 8-wk-old Lck-Cre/Fbw7 +/fl (Control) or Lck-Cre/Fbw7 fl/fl (Fbw7 KO) mice
TE5 KYSE510 TE7 KYSE70 KYSE140
TE5 KYSE5 TT KYSE7 KYSE4 Supplementary Figure. Hockey stick plots showing input normalized, rank ordered H3K7ac signals for the candidate SE-associated lncrnas in this study. Rpm Rpm Rpm Chip-seq H3K7ac
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Supplementary Figure 1. Detecting ESR1-CCDC170 and P2RY6-ARHGEF17 chimerical transcripts in breast cancer cell lines by RT-PCR. (a) RT-PCR results using a forward primer (AACAGGCTCGAAAGGTCCATGC)
ATPlite Assay Performance in Human Primary Cells
A P P L I C AT I O N N O T E Cell Viability Assays Author: Verena Brucklacher-Waldert Crescendo Biologics Cambridge, UK Assay Performance in Human Primary Cells Introduction In vitro assays using primary
Supplemental Information. Loss of MicroRNA-7 Regulation Leads. to a-synuclein Accumulation and. Dopaminergic Neuronal Loss In Vivo
YMTHE, Volume 25 Supplemental Information Loss of MicroRNA-7 Regulation Leads to a-synuclein Accumulation and Dopaminergic Neuronal Loss In Vivo Kirsty J. McMillan, Tracey K. Murray, Nora Bengoa-Vergniory,
NanoPro 1000 System. characterize cell signaling in your smallest samples
NanoPro 1000 System characterize cell signaling in your smallest samples Technology The NanoPro 1000 system is a capillary-based nano-immunoassay platform. As in Western blot analysis, proteins from complex
Mystery microscope images
Mystery microscope images Equipment: 6X framed microscopy images 6X cards saying what each microscope image shows 6X cards with the different microscopy techniques written on them 6X cards with the different
Pre-made Lentiviral Expression Particles for Luciferase (firefly, Gaussia, Renilla and Cypridina)
Pre-made Lentiviral Expression Particles for Luciferase (firefly, Gaussia, Renilla and Cypridina) Cat# Product Name Amounts LVP326 LVP326-PBS LVP325 LVP325-PBS LVP283 LVP283-PBS LVP323 LVP323-PBS LVP020
ToxiLight BioAssay Kit
Lonza Rockland, Inc. www.lonza.com biotechserv@lonza.com Tech Service: 800-521-0390 Customer Service: 800-638-8174 Document # 18882-1007-02 Rockland, ME 04841 USA ToxiLight BioAssay Kit Non Destructive
Supplementary Figure 1. APP cleavage assay. HEK293 cells were transfected with various
Supplementary Figure 1. APP cleavage assay. HEK293 cells were transfected with various GST-tagged N-terminal truncated APP fragments including GST-APP full-length (FL), APP (123-695), APP (189-695), or
Labware compatibility report. Directly order at:
Labware compatibility report Directly order at: https://ibidi.com/12-labware Contents 1. Introduction 3 2. Compatible Labware 4 A. 35 mm dishes - high borders 4 µ-dish 35 mm, high 4 µ-dish 35mm, high Glass
Androgen Receptor Antagonism Drives Efficacy of CYP17 Inhibitors in CRPC
Supplemental Material Androgen Receptor Antagonism Drives Efficacy of CYP17 Inhibitors in CRPC John D. Norris 1#, Stephanie J. Ellison 1#, Jennifer G. Baker 1, David B. Stagg 1, Suzanne E. Wardell 1, Sunghee
Multiplexing Cell-Based Assays:
Multiplexing Cell-Based Assays: Get More Biologically Relevant Data Fall 2010 Click this icon to view speakers notes for each slide. 2010, Promega Corporation. Multiplexing assays for more informative
Loss of Cul3 in Primary Fibroblasts
PSU McNair Scholars Online Journal Volume 5 Issue 1 Humans Being: People, Places, Perspectives and Processes Article 15 2011 Loss of Cul3 in Primary Fibroblasts Paula Hanna Portland State University Let
Brightfield and Fluorescence Imaging using 3D PrimeSurface Ultra-Low Attachment Microplates
A p p l i c a t i o n N o t e Brightfield and Fluorescence Imaging using 3D PrimeSurface Ultra-Low Attachment Microplates Brad Larson, BioTek Instruments, Inc., Winooski, VT USA Anju Dang, S-BIO, Hudson,
CONCERNING HUMAN CANCER CELL LINES
VALIDATION OF TRANSFECTION PROTOCOL CONCERNING HUMAN CANCER CELL LINES dott. Luca Bruni Department of Genetic, Biology of Microorganisms, Anthropology and Evolution, University of Parma; Laboratory of
Ectopic Gene Expression in Mammalian Cells
Ectopic Gene Expression in Mammalian Cells Dr. Stefan Stein AG Grez Methodenseminar BCII Praktikum am Georg-Speyer-Haus 11.01. & 01.02.2012 1 Ectopic Gene Expression in Mammalian Cells Definition: ectopic
Confocal Microscopy Analyzes Cells
Choosing Filters for Fluorescence A Laurin Publication Photonic Solutions for Biotechnology and Medicine November 2002 Confocal Microscopy Analyzes Cells Reprinted from the November 2002 issue of Biophotonics
Supplementary Materials and Methods:
Supplementary Materials and Methods: Preclinical chemoprevention experimental design Mice were weighed and each mammary tumor was manually palpated and measured with digital calipers once a week from 4
Focus Application. Cell Migration. Featured Study: Inhibition of Cell Migration by Gene Silencing. xcelligence System Real-Time Cell Analyzer
xcelligence System Real-Time Cell Analyzer Focus Application Cell Migration Featured Study: Inhibition of Cell Migration by Gene Silencing Markus Greiner and Richard Zimmermann Department of Medical Biochemistry
Supplementary Figure 1. α-synuclein is truncated in PD and LBD brains. Nature Structural & Molecular Biology: doi: /nsmb.
Supplementary Figure 1 α-synuclein is truncated in PD and LBD brains. (a) Specificity of anti-n103 antibody. Anti-N103 antibody was coated on an ELISA plate and different concentrations of full-length
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3240 Supplementary Figure 1 GBM cell lines display similar levels of p100 to p52 processing but respond differentially to TWEAK-induced TERT expression according to TERT promoter mutation
OUR WISH LIST RESEARCH EQUIPMENT
OUR WISH LIST RESEARCH EQUIPMENT YOU CAN MAKE A TANGIBLE DIFFERENCE! The South Australian Health and Medical Research Institute (SAHMRI) is one of the most exciting developments in the field of health
OUR WISH LIST RESEARCH EQUIPMENT
OUR WISH LIST RESEARCH EQUIPMENT WITH YOUR PHILANTHROPIC SUPPORT, WE CAN WORK TOGETHER TO COMPLETE OUR FULLY-FUNCTIONAL FACILITY BY PURCHASING THE CUTTING-EDGE EQUIPMENT AND RESOURCES TO SUPPORT SAHMRI
1st Faculty of Medicine, Charles University in Prague Center for Advanced Preclinical Imaging (CAPI)
ADVANTAGES Optical Imaging OI Optical Imaging is based on the detection of weak light by a highly sensitive and high resolution CCD camera DISADVANTAGES High sensitivity Limited penetration depth Easy
promote ROS production and metastasis of HCC cells
MCU-dependent mitochondrial Ca 2+ inhibits NAD+/SIRT3/SOD2 pathway to promote ROS production and metastasis of HCC cells Tingting Ren 1#, Hui Zhang 2#, Jiaojiao Wang 1, Jianjun Zhu 1, Mingpeng Jin 1,Yousheng
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/10/496/eaam6291/dc1 Supplementary Materials for Regulation of autophagy, NF-κB signaling, and cell viability by mir-124 in KRAS mutant mesenchymal-like NSCLC cells
Nature Biotechnology: doi: /nbt Supplementary Figure 1
Supplementary Figure 1 Generation of the AARE-Gene system construct. (a) Position and sequence alignment of AAREs extracted from human Trb3, Chop or Atf3 promoters. AARE core sequences are boxed in grey.
SDR and SRG SCID Rats
SDR and SRG SCID Rats Precision Toxicology & Efficacy CRO Services Cancer Xenografts Liver & Immune system Humanization Hera BioLabs services@herabiolabs.com About Hera BioLabs Precision Toxicology & Efficacy:
CELL BIOLOGY - CLUTCH CH TECHNIQUES IN CELL BIOLOGY.
!! www.clutchprep.com CONCEPT: LIGHT MICROSCOPE A light microscope uses light waves and magnification to view specimens Can be used to visualize transparent, and some cellular components - Can visualize
Types of product/intervention
January 2017 This document contains information and guidance to assist users in selecting the appropriate type when reporting a medical product or intervention. This guidance is provided and governed by
3 P p25. p43 p41 28 FADD. cflips. PE-Cy5 [Fluorescence intensity]
![3 P p25. p43 p41 28 FADD. cflips. PE-Cy5 [Fluorescence intensity]](/thumbs/87/97394430.jpg "3 P p25. p43 p41 28 FADD. cflips. PE-Cy5 [Fluorescence intensity]")
L S p4 3 D3 76 N S L Ve ct or p4 3 D3 76 N S L Ve ct or A aspase 8 FADD TRAF2 D95-R - + Vector D95L TL I S L D376N T RAIL-R1 T RAIL-R2 D95-R E-y5 [Fluorescence intensity] Supplemental Fig. 1 Different
Janos Szabad Department of Biology University of Szeged 6720 Szeged, Somogyi str
Janos Szabad Department of Biology University of Szeged 6720 Szeged, Somogyi str. 4. E-mail: szabad.janos@med.u-szeged.hu - Through the use of antibodies - against the protein - against a fusion partner
Cell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan).
1 2 3 4 5 6 7 8 Supplemental Materials and Methods Cell proliferation assay Cell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan). GCs were plated at 96-well
Gene therapy has gained significant attention over the past two decades as a potential method for treating genetic disorders such as severe combined
Abstract Gene therapy has gained significant attention over the past two decades as a potential method for treating genetic disorders such as severe combined immunodeficiency, cystic fibrosis, and Parkinson
Figure S1. Optimization of reverse-transfection protocols using GAPDH sirnas. MDA- MB-231 cells were seeded in 96-well plates at a density of 5000
Figure S1. Optimization of reverse-transfection protocols using GAPDH sirnas. MDA- MB-231 cells were seeded in 96-well plates at a density of 5000 cells per well, and reverse transfected with the indicated
Genome Engineering. Brian Petuch
Genome Engineering Brian Petuch Guiding Principles An understanding of the details of gene engineering is essential for understanding protocols when making recommendations on: Risk assessment Containment
Electronic Supplementary Information
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 215 Electronic Supplementary Information Selective cell elimination in vitro and in vivo cell elimination
Supplemental Information. The TRAIL-Induced Cancer Secretome. Promotes a Tumor-Supportive Immune. Microenvironment via CCR2
Molecular Cell, Volume 65 Supplemental Information The TRAIL-Induced Cancer Secretome Promotes a Tumor-Supportive Immune Microenvironment via CCR2 Torsten Hartwig, Antonella Montinaro, Silvia von Karstedt,
TITLE: Molecular Targeting of the P13K/Akt Pathway to Prevent the Development Hormone Resistant Prostate Cancer
AD Award Number: TITLE: Molecular Targeting of the P13K/Akt Pathway to Prevent the Development Hormone Resistant Prostate Cancer PRINCIPAL INVESTIGATOR: Jonathan Walker, M.D. CONTRACTING ORGANIZATION:
Cell Structure and Function
Cell Structure and Function Dead White Men Who Discovered (and were made of) Cells: Anton Van Leeuwenhoek Robert Hooke Where the Magic Happened Schleiden Cell Theory All plants are made of cells Schwann
Imaging of endocrine organs
Imaging of endocrine organs Helen Christian Department of Physiology, Anatomy & Genetics St Anne s College, University of Oxford Diabetesforum, Stockholm 2017 Islets of Langerhan Pituitary gland Renin
Outline and learning objectives. From Proteomics to Systems Biology. Integration of omics - information
From to Systems Biology Outline and learning objectives Omics science provides global analysis tools to study entire systems How to obtain omics - What can we learn Limitations Integration of omics - In-class
Personalized CAR-T Immunotherapy Platform
GLP, GMP, and CLIA-Certified Lab Personalized CAR-T Immunotherapy Platform Accelerate your cancer research and drug discovery Platform Overview 1500 Existing Hybridomas and Antibody Engineering Custom
TITLE: Highly specific targeting of the TMPRSS2/ERG fusion gene in prostate cancer using liposomal nanotechnology
AD Award Number: W81XWH-09-1-0385 TITLE: Highly specific targeting of the TMPRSS2/ERG fusion gene in prostate cancer using liposomal nanotechnology PRINCIPAL INVESTIGATOR: Bulent Ozpolat, M.D., Ph.D. Michael
Principles of translational medicine: imaging, biomarker imaging, theranostics
Principles of translational medicine: imaging, biomarker imaging, theranostics Compiled by: Endre Mikus PhD, CEO Budapest, 21/9/2015 Imaging and imaging biomarkers An imaging biomarker is an anatomic,
Figure S1. Mechanism of ON induced MM cell death.
Figure S1. Mechanism of ON123300 induced MM cell death. To elucidate whether ON123300 induced decrease of viability of MM cells was associated with induction of apoptosis, the number of apoptotic cells
We performed RT-PCR, cloning, sequencing and qrt-pcr in murine melanoma. cell lines and melanocytic tumors from RET-mice in accordance with the method
Supplementary Material and Methods Quantitative RT-PCR (qrt-pcr) We performed RT-PCR, cloning, sequencing and qrt-pcr in murine melanoma cell lines and melanocytic tumors from RET-mice in accordance with
Expressed genes profiling (Microarrays) Overview Of Gene Expression Control Profiling Of Expressed Genes
Expressed genes profiling (Microarrays) Overview Of Gene Expression Control Profiling Of Expressed Genes Genes can be regulated at many levels Usually, gene regulation, are referring to transcriptional
ToxiLight bioassay kit
ToxiLight bioassay kit Non destructive cytotoxicity assay www.lonza.com U.S. Scientific Support: 800-521-0390 scientific.support@lonza.com EU/ROW Scientific Support: +49-221-99199-400 scientific.support.eu@lonza.com
Switch On Protein-Protein Interactions
Switch On Protein-Protein Interactions Rapid and specific control of signal transduction pathways, protein activity, protein localization, transcription, and more Dimerizer protein 1 protein 2 Clontech
Cell Health and Mechanistic Toxicity Assays
Cell Health and Mechanistic Toxicity Assays Frank Fan, Ph.D. Director of Research March, 2014 Outline Bioluminescent assays Live and Dead Cell Assays Real Time Assays Apoptosis Stress Events Leading to
In Vivo Programs. Contract Research Services. Programs
P r o d u c t N o t e Contract Research Services In Vivo Programs Key Features Evaluation of drug properties Drug efficacy studies Biodistribution studies Complementary tissue analysis services CDAS In
Direct Cell Counting Assays for Immuno Therapy
Direct Cell Counting Assays for Immuno Therapy Cytotoxicity assays play a central role in studying the function of immune effector cells such as cytolytic T lymphocytes (CTL) and natural killer (NK) cells.