TE5 KYSE510 TE7 KYSE70 KYSE140
|
|
|
- Luke Logan
- 6 years ago
- Views:
Transcription
1 TE5 KYSE5 TT KYSE7 KYSE4 Supplementary Figure. Hockey stick plots showing input normalized, rank ordered H3K7ac signals for the candidate SE-associated lncrnas in this study.
2 Rpm Rpm Rpm Chip-seq H3K7ac 5.8 5kb 4.5 KYSE5 Predicted Super-enhancer FAM83H-AS 3.9 3kb.5 KYSE5 Predicted Super-enhancer PVT 5kb 3..4 KYSE5 MIR5HG Predicted Super-enhancer Supplementary Figure. H3K7ac ChIP-Seq binding profiles of representative SE-associated lncrnas in ESCC cell lines.
3 KYSE5 Relative fold change (mrna level) Relative fold change in mrna level Relative fold change in mrna level Relative fold change (mrna level) Relative fold change in mrna level Relative fold change in mrna level.5 FAM83H-AS.5 LINC53.5 MIR5HG THZ (hours) THZ (hours) THZ (hours).5 FAM83H-AS.5 LINC53.5 PVT THZ (hours) THZ (hours) THZ (hours) Supplementary Figure 3. Real-time PCR validation of RNA-Seq results of candidate SE-associated lncrnas upon THZ (CDK7 inhibitor, 5nM) treatment in and KYSE5 cells.
4 RSEM (log) FAM83H-AS MIR5HG PVT Supplementary Figure 4. Expression characteristics of candidate SE-associated LncRNAs identified in the study. Plots highlighting the expression of FAM83H-AS, MIR5HG ( and PVT ( in different cancer/tissue types. Each point represents one RNA-seq tissue sample.
5 OD value OD value.5.5 KYSE5 sifam83h-as sipvt sifam83h-as sipvt.5 simir5hg.5 simir5hg Days 3 4 Days Supplementary Figure 5. Effect of lncrnas on cell proliferation. sirna-pools against FAM83H-AS, PVT or MIR5HG were transfected into and KYSE5 cells, and MTT assays were performed to measure cell proliferation. Mean ± s.d. are shown, n = 3.
6 Input Negative LINC53 Pull down Ribosomal Protein LP Supplementary Figure 6. Western blotting analysis of Ribosomal Protein LP (RPLP) following pull-down of LINC53 or negative RNA (LncRNA A333F4Rik ).
7 Relative mrna level Relative mrna level A 3, kb 3, kb 3, 4 kb 3, 6 kb 3, 8 kb 3, kb KYSE5 LINC53 Exon Exon Exon3 Exon4 B. KYSE Exon/ Exon/3 Exon3/4 Exon/ Exon/3 Exon3/4 Supplementary Figure 7. A new splice isoform of LINC53 identified in ESCC cell lines. A, RNA-Seq analysis of the new splice isoform of LINC53 containing Exons -4. B, qrt-pcr validation.
8 Rpm ( ) Rpm ( ) Rpm ( ) Rpm ( ) A 3. R Viewpoint (E) kb 5kb 3. R Viewpoint (E) kb 5kb.. Bin Size (kb) Bin Size (kb) R R.. Bin Size (kb) Bin Size (kb) 5. LINC53 5. LINC53 B LINC53 Supplementary Figure 8. (A) 4C-seq showing long-range interactions anchored on the SE upstream of LINC53 in cells. Two repeats (R and R) in each viewpoint (E and E). (B) Significant interactions determined by 4C. Deeper red colors indicate higher interaction frequency.
9 Relative luciferase Relative luciferase Relative luciferase Relative luciferase A TE B KYSE4 C FLO- D OE33 Supplementary Figure 9. Enhancer activity measured by luciferase reporter assays in ESCC cells (A and B) and EAC cells (C and D). Mean ± s.d. are shown, n = 3.
10 Relative mrna levels shtp63 shtp63/ev shtp63/δnp63 mrna Levels of LINC53 Relative luciferase Relative luciferase A 6 TE5 TE5 shtp ns B 5 FLO- 4 FLO- shtp63 3 ns ns ns C TE5. TP63 LINC TE5 KYS E5 D TP63 GAPDH TP63 GAPDH TP63 GAPDH E TE5 Supplementary Figure. TP63 activates the transcription of LINC53 by mediating the activity of its super-enhancer. (A and B) E segment was divided into two constituents (EA and EB) and the luciferase activities of E, EA and EB were measured in ESCC cells (A) and EAC cells (B) upon TP63 silencing. (C) Expression of LINC53 and TP63 was determined by qrt-pcr in TP63 knockdown ESCC cells using two independent shrnas (shtp63- and sh-tp63-3). (D, E) ΔNTP63 expression plasmid was transfected into TP63 knockdown ESCC cells; Western blotting was used to detect the expression of ΔNTP63 (D). The levels of LINC53 were recovered upon ΔNTP63 expression (E). Mean ± s.d. are shown, n = 3. n.s., not significant., P.5.
11 Relative mrna levels Relative mrna levels. SOX LINC53 KYSE5.4. SOX LINC shsox- shsox- shsox- shsox- Supplementary Figure. Effect of SOX knockdown on the expression levels of LINC53 was determined by qrt-pcr.
12 A Chip-seq Mb H3K7ac TP63 CCBL LRRC8A DOLK SH3GLB DOLPP PPPR4 IER5L C9orf6 LINC963 C9orf5 PPRX PTGES TORB LINC53 B Predicted Super-Enhancer C Supplementary Figure. Effect of TP63 silencing on the expressions of 3 transcripts within Mb of the LINC53-SE. (A) Transcripts located in the region within Mb of the LINC53-SE. (B) qpcr analysis for the expressions of these transcripts in TP63 silencing cells. (C) ΔNTP63 expression plasmid was transfected into TP63 knockdown ESCC cells and the level of CCBL was recovered upon ΔNTP63 expression.
13 Relative mrna level of CCBL Relative mrna level of CCBL A..5 siccbl B. siccbl KYSE5.5 Day Day Day 3 Day 4 siccbl siccbl Day Day Day 3 Day 4 Supplementary Figure 3. Effect of CCBL knockdown on the proliferation of ESCC cells. (A) cells. (B) KYSE5 cells. Left, qrt-pcr analysis for the silencing of CCBL. Right, MTT assays. Mean ± s.d. are shown, n = 3.
14 Relative expression of LINC KYSE5 KYSE45 KYSE5 KYSE8 KYSE3 TE5 Supplementary Figure 4. qrt-pcr analysis for the expression levels of LINC53 in ESCC cell lines.. Mean ± s.d. are shown, n = 3.
15 Migrated cells Invasive cells Relative expression of LINC53 OD value Colony number TE5 A B C Day TE5 sirna Day Day 3 Day TE5 sirna sirna D TE5 8 E TE5 8 6 sirna 6 4 sirna 4 Supplementary Figure 5. LINC53 is required for the growth, migration and invasion of ESCC cells. (A) qrt-pcr analysis validating the silencing of LINC53 in TE5 cells. EV, empty vector. (B) MTT and (C) colony formation assays in TE5 cells upon LINC53 knockdown. (D) Transwell migration assays and (E) Transwell Matrigel invasion assays were performed to determine the effect of LINC53 on the migration and invasiveness of TE5 cells. Mean ± s.d. are shown, n = 3. n.s., not significant., P.5.
16 KYSE5 Relative expression of LINC53 OD value Migrated cells Invasive cells Relative expression of LINC53 OD value Migrated cells Invasive cells A B C D Control GapmeR GapmeR4 Control 6 Control 4 8 GapmeR 7 6 GapmeR GapmeR4 GapmeR4 Day 4 Day 3 Day Day Day Control GapmeR GapmeR4 Day Day 3 Day 4 Control GapmeR GapmeR Control GapmeR GapmeR Supplementary Figure 6. LINC53 is required for the growth, migration and invasiveness of ESCC cells. A, qrt-pcr analysis for the GapmeR-mediated silencing ( and KYSE5 cells) of LINC53. B, MTT assays in ESCC cells upon LINC53 knockdown or overexpression. C and D, Transwell migration assays (C) and Transwell Matrigel invasion assays (D) were performed upon silencing of LINC53. Mean ± s.d. are shown, n = 3.
17 Migrated cells Migrated cells Relative expression of LINC53 OD value OD value A KYSE5 B C.6.4. shlinc53 shlinc53/ev shlinc53/linc shlinc53 shlinc53/ev shlinc53/linc shlinc53 shlinc53/ev shlinc53/linc KYSE5 Day Day Day 3 Day 4 Day Day Day 3 Day 4 shlinc53/ EV KYSE 5 shlinc53 shlinc53/ LINC53 D shlinc53/ EV shlinc53 shlinc53/ LINC53 E Supplementary Figure 7. Re-expression of LINC53 rescued decreased cell growth and migration mediated by LINC53 knockdown. KYSE5 and cells were infected by shrna plasmid against LINC53 (shlinc53) and control shrna (), and stable knockdown cells was selected. This was followed by transfection of over-expression plasmid of LINC53 into the knockdown cells. A, qpcr analysis for the silencing and re-expression of LINC53. B and C, MTT assays. D and E, Transwell migration assays.
18 Input Negative LINC53 Input Negative LINC53 Pull down Pull down ζ σ Supplementary Figure 8. Western blotting analysis of proteins following pull-down of LINC53 or negative RNA control.
19 Supplementary Figure 9. or KYSE5 cells were transfected with either control sirna () or LINC53 sirna (silinc53). Cell lysates were analyzed by Western blotting for the expressions of the important molecules of ERK/MAPK and PI3K/Akt pathways. Signal intensity for the levels of phosphoproteins was quantified by densitometric scanning and normalized by the total amounts of each protein.
20 IGF (5 ng/ml) silinc53 Min p-akt KYSE5 IGF (5 ng/ml) silinc Akt p-erk/ ERK p-p7s6k p7s6k p-mtor mtor GAPDH Supplementary Figure. LINC53 activates ERK/MAPK and PI3K/Akt pathways. or KYSE5 cells transfected with either control sirna () or LINC53 sirna (silinc53) were cultured in medium with EGF for different duration. Cell lysates were analyzed by Western blotting (GAPDH was served as loading control).
21 IgG silinc53 silinc53 IgG silinc53 silinc53 IgG silinc53 silinc53 IgG silinc53 silinc53 A EGF ( ) EGF ( ng/ml, 3h) IP: ERK Input (%) IP: ERK ERK DUSP-6 Ratio to ERK GAPDH B MG3 ( ) MG3 (μm, 6h) IP: EBP- Input (%) IP: EBP- Input (%) EBP- PI3K p85 Ratio to EBP GAPDH Supplementary Figure. Immunoprecipitation assay was performed with cell extracts from cells transfected with LINC53 sirna by using antibodies against ERK, EBP- or normal IgG. Immunoprecipitates (IP) or cell lysates (Input) were analyzed by Western blotting.
22 Migrated cells Migrated cells OD value OD value A.5 sidusp-6 siebp- B.5 KYSE5 sidusp-6 siebp Day Day Day 3 Day 4 Day Day Day 3 Day 4 C D KYSE sidusp-6 siebp- sidusp-6 siebp- Supplementary Figure. Effect of DUSP-6 or EBP- on the growth and migration of ESCC cells. (A and B) Growth curves of cells transfected with control sirna (), DUSP-6 sirna (sidusp-6) or EBP- sirna (siebp-). (C and D) Migration assays. Mean ± s.d. are shown, n = 3., P.5.
23 Relative fold change Relative fold change shlinc53- shlinc53- shlinc53- Tumor Volumes (mm 3 ) Tumor weight (g) A KYSE5 shlinc53- B KYSE5 P =. P =.4 Time (Days) shlinc53- C KYSE5 Mice # # #3 D p-akt Akt p-erk/.5.5 p-akt shlinc p-erk/ shlinc53- ERK/.5. GAPDH Mice # # #3 Mice # # #3 Supplementary Figure 3. KYSE5 cells with stable depletion of LINC53 (shlinc53-) were injected subcutaneously into nude mice ( in each group). Tumor volumes (A) and weights (B) were determined. Data are means ± s.d.. (C, D) Activation of PI3K/Akt and ERK/MAPK pathways in paired ESCC xenografts was determined by Western blotting (C). Signal intensity for the levels of p-akt and p-erk/ was quantified by densitometric scanning and normalized by the total amounts of each protein (D).
24 Cell viability index (relative to control) Cell viability index (relative to control) Cell viability index (relative to control) Cell viability index (relative to control).%.% KYSE5 silinc53.%.% silinc53 8.% 8.% 6.% 6.% 4.% 4.%.%.%.% MK6 (μm).% MK6 (μm).%.% KYSE5 silinc53.%.% silinc53 8.% 8.% 6.% 6.% 4.% 4.%.%.%.% U6 (μm).% U6 (μm) Supplementary Figure 4. Colony formation assay was employed to determine the effect of Akt inhibitor (MK6) or MEK inhibitor (U6) on the LINC53 silencing ESCC cells. Indicated cells were treated with the inhibitors for days and OD value was measured.
25 Receptor Tyrosine Kinase Inhibit Activate MEK PI3K EBP- DUSP-6 ERK Akt mtor LINC53 LINC53 TP63 Super-enhancer LINC53 Growth and migration of ESCC cells Gene expression Supplementary Figure 5. Proposed working model of LINC53 in ESCC cells.
Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate
Supplementary Figure Legends Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate BC041951 in gastric cancer. (A) The flow chart for selected candidate lncrnas in 660 up-regulated
supplementary information
DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1.
Supplementary Figure 1. Characterization and high expression of Lnc-β-Catm in liver CSCs. (a) Heatmap of differently expressed lncrnas in Liver CSCs (CD13 + CD133 + ) and non-cscs (CD13 - CD133 - ) according
Supplementary Material. TRIB3 inhibits proliferation and promotes osteogenesis in hbmscs by regulating the. ERK1/2 signaling pathway
Supplementary Material TRIB3 inhibits proliferation and promotes osteogenesis in hbmscs by regulating the ERK1/2 signaling pathway Cui Zhang 1, Fan-Fan Hong 1, Cui-Cui Wang 1, Liang Li 1, Jian-Ling Chen
Supplementary Figure 1. (a) The qrt-pcr for lnc-2, lnc-6 and lnc-7 RNA level in DU145, 22Rv1, wild type HCT116 and HCT116 Dicer ex5 cells transfected
Supplementary Figure 1. (a) The qrt-pcr for lnc-2, lnc-6 and lnc-7 RNA level in DU145, 22Rv1, wild type HCT116 and HCT116 Dicer ex5 cells transfected with the sirna against lnc-2, lnc-6, lnc-7, and the
HCT116 SW48 Nutlin: p53
Figure S HCT6 SW8 Nutlin: - + - + p GAPDH Figure S. Nutlin- treatment induces p protein. HCT6 and SW8 cells were left untreated or treated for 8 hr with Nutlin- ( µm) to up-regulate p. Whole cell lysates
ASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG
Supplemental Materials and Methods Plasmids: the following plasmids were used in the supplementary data: pwzl-myc- Lats2 (Aylon et al, 2006), pretrosuper-vector and pretrosuper-shp53 (generous gift of
Supplemental Table 1 Gene Symbol FDR corrected p-value PLOD1 CSRP2 PFKP ADFP ADM C10orf10 GPI LOX PLEKHA2 WIPF1
Supplemental Table 1 Gene Symbol FDR corrected p-value PLOD1 4.52E-18 PDK1 6.77E-18 CSRP2 4.42E-17 PFKP 1.23E-14 MSH2 3.79E-13 NARF_A 5.56E-13 ADFP 5.56E-13 FAM13A1 1.56E-12 FAM29A_A 1.22E-11 CA9 1.54E-11
Supplementary Figure Legend
Supplementary Figure Legend Supplementary Figure S1. Effects of MMP-1 silencing on HEp3-hi/diss cell proliferation in 2D and 3D culture conditions. (A) Downregulation of MMP-1 expression in HEp3-hi/diss
ENCODE RBP Antibody Characterization Guidelines
ENCODE RBP Antibody Characterization Guidelines Approved on November 18, 2016 Background An integral part of the ENCODE Project is to characterize the antibodies used in the experiments. This document
Online Supplementary Information
Online Supplementary Information NLRP4 negatively regulates type I interferon signaling by targeting TBK1 for degradation via E3 ubiquitin ligase DTX4 Jun Cui 1,4,6,7, Yinyin Li 1,5,6,7, Liang Zhu 1, Dan
Supplemental Information. Mitophagy Controls the Activities. of Tumor Suppressor p53. to Regulate Hepatic Cancer Stem Cells
Molecular Cell, Volume 68 Supplemental Information Mitophagy Controls the Activities of Tumor Suppressor to Regulate Hepatic Cancer Stem Cells Kai Liu, Jiyoung Lee, Ja Yeon Kim, Linya Wang, Yongjun Tian,
Supporting Information
Supporting Information Chakrabarty et al. 10.1073/pnas.1018001108 SI Materials and Methods Cell Lines. All cell lines were purchased from the American Type Culture Collection. Media and FBS were purchased
Supplementary Figure 1. Characterization of EVs (a) Phase-contrast electron microscopy was used to visualize resuspended EV pellets.
Supplementary Figure 1. Characterization of EVs (a) Phase-contrast electron microscopy was used to visualize resuspended EV pellets. Scale bar represent 100 nm. The sizes of EVs from MDA-MB-231-D3H1 (D3H1),
Supplemental Information. The TRAIL-Induced Cancer Secretome. Promotes a Tumor-Supportive Immune. Microenvironment via CCR2
Molecular Cell, Volume 65 Supplemental Information The TRAIL-Induced Cancer Secretome Promotes a Tumor-Supportive Immune Microenvironment via CCR2 Torsten Hartwig, Antonella Montinaro, Silvia von Karstedt,
SureSilencing sirna Array Technology Overview
SureSilencing sirna Array Technology Overview Pathway-Focused sirna-based RNA Interference Topics to be Covered Who is SuperArray? Brief Introduction to RNA Interference Challenges Facing RNA Interference
Journal of Cell Science Supplementary Material
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 SUPPLEMENTARY FIGURE LEGENDS Figure S1: Eps8 is localized at focal adhesions and binds directly to FAK (A) Focal
Supplementary Information
Supplementary Information promotes cancer cell invasion and proliferation by receptor-mediated endocytosis-dependent and -independent mechanisms, respectively Kensaku Shojima, Akira Sato, Hideaki Hanaki,
Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna
Supplemental Materials and Methods Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna (Mission shrna, Sigma) against mouse MMP14 were transfected into HEK293 cells using FuGene6
Wnt16 smact merge VK/AB
A WT Wnt6 smact merge VK/A KO ctrl IgG WT KO Wnt6 smact DAPI SUPPLEMENTAL FIGURE I: Wnt6 expression in MGP-deficient aortae. Immunostaining for Wnt6 and smooth muscle actin (smact) in aortae from 7 day
Quantitative Real Time PCR USING SYBR GREEN
Quantitative Real Time PCR USING SYBR GREEN SYBR Green SYBR Green is a cyanine dye that binds to double stranded DNA. When it is bound to D.S. DNA it has a much greater fluorescence than when bound to
SUPPLEMENTARY INFORMATION
doi:.38/nature899 Supplementary Figure Suzuki et al. a c p7 -/- / WT ratio (+)/(-) p7 -/- / WT ratio Log X 3. Fold change by treatment ( (+)/(-)) Log X.5 3-3. -. b Fold change by treatment ( (+)/(-)) 8
Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling
Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Glendining KA 1, Markie D 2, Gardner RJM 4, Franz EA 3, Robertson SP 4, Jasoni CL 1 Supplementary
* ** ** * IB: p-p90rsk. p90rsk (Ser380) (arbitrary units) (Ser380) p90rsk. IB: p90rsk. Tubulin. IB: Tubulin. Ang II (200 nm) Ang II (200 nm)
I: p-p9rsk I: p9rsk I: C I: p-p9rsk I: p9rsk 5 (ka) 5 5 (min) Ang II ( nm) p-p9rsk (Ser8) p9rsk p-p9rsk (Ser8) p9rsk (h) Mannitol 5 mm -Glucose 5 mm p9rsk (Ser8) (arbitrary units) p-p9rsk (Ser8) (arbitrary
TOOLS sirna and mirna. User guide
TOOLS sirna and mirna User guide Introduction RNA interference (RNAi) is a powerful tool for suppression gene expression by causing the destruction of specific mrna molecules. Small Interfering RNAs (sirnas)
Nature Immunology: doi: /ni Supplementary Figure 1. Zranb1 gene targeting.
Supplementary Figure 1 Zranb1 gene targeting. (a) Schematic picture of Zranb1 gene targeting using an FRT-LoxP vector, showing the first 6 exons of Zranb1 gene (exons 7-9 are not shown). Targeted mice
Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table.
Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2239 Hepatocytes (Endoderm) Foreskin fibroblasts (Mesoderm) Melanocytes (Ectoderm) +Dox rtta TetO CMV O,S,M,K & N H1 hes H7 hes H9 hes H1 hes-derived EBs H7 hes-derived EBs H9 hes-derived
SANTA CRUZ BIOTECHNOLOGY, INC.
TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same
GFP CCD2 GFP IP:GFP
D1 D2 1 75 95 148 178 492 GFP CCD1 CCD2 CCD2 GFP D1 D2 GFP D1 D2 Beclin 1 IB:GFP IP:GFP Supplementary Figure 1: Mapping domains required for binding to HEK293T cells are transfected with EGFP-tagged mutant
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Dynamic Phosphorylation of HP1 Regulates Mitotic Progression in Human Cells Supplementary Figures Supplementary Figure 1. NDR1 interacts with HP1. (a) Immunoprecipitation using
TECHNICAL BULLETIN. Color. Fig.1. Cell-Based protein phosphorylation procedure
Cell-Based ELISA Sampler Kit for detecting phospho-erk1/2 (pthr 202 /ptyr 204 ), phospho-jnk (pthr 183 /ptyr 185 ), and phospho-p38 MAPK (pthr 180 /ptyr 182 ) in cultured cell lines adequate for 192 assays
Chemically defined conditions for human ipsc derivation and culture
Nature Methods Chemically defined conditions for human ipsc derivation and culture Guokai Chen, Daniel R Gulbranson, Zhonggang Hou, Jennifer M Bolin, Victor Ruotti, Mitchell D Probasco, Kimberly Smuga-Otto,
Khaled_Fig. S MITF TYROSINASE R²= MITF PDE4D R²= Variance from mean mrna expression
Khaled_Fig. S Variance from mean mrna expression.8 2 MITF.6 TYROSINASE.4 R²=.73.2.8.6.4.2.8.6.4.2.8.6.4.2 MALME3M SKMEL28 UACC257 MITF PDE4D R²=.63 4.5 5 MITF 3.5 4 PDE4B 2.5 3 R²=.2.5 2.5.8.6.4.2.8.6.4.2
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/3/6/ra27/dc Supplementary Materials for AAA+ Proteins and Coordinate PIKK Activity and Function in Nonsense-Mediated mrna Decay Natsuko Izumi, Akio Yamashita,*
Supplementary Information
Supplementary Information MLL histone methylases regulate expression of HDLR- in presence of estrogen and control plasma cholesterol in vivo Khairul I. Ansari 1, Sahba Kasiri 1, Imran Hussain 1, Samara
Gaussia Luciferase-a Novel Bioluminescent Reporter for Tracking Stem Cells Survival, Proliferation and Differentiation in Vivo
Gaussia Luciferase-a Novel Bioluminescent Reporter for Tracking Stem Cells Survival, Proliferation and Differentiation in Vivo Rampyari Raja Walia and Bakhos A. Tannous 1 2 1 Pluristem Innovations, 1453
Supplementary Figure 1. Lnc-β-Catm characterization. (A, B) LncBRM silenced
Supplementary Figure 1. Lnc-β-Catm characterization. (A, B) LncBRM silenced Hep3B (A) and Huh7 (B) cells were established using psicor lentivirus, followed by sphere formation assays. (C, D) LncBRM deleted
Thermo Scientific Dharmacon SMARTvector 2.0 Lentiviral shrna Particles
Thermo Scientific Dharmacon SMARTvector 2.0 Lentiviral shrna Particles Long-term gene silencing shrna-specific design algorithm High titer, purified particles Thermo Scientific Dharmacon SMARTvector shrna
sirna Transfection Into Primary Neurons Using Fuse-It-siRNA
sirna Transfection Into Primary Neurons Using Fuse-It-siRNA This Application Note describes a protocol for sirna transfection into sensitive, primary cortical neurons using Fuse-It-siRNA. This innovative
Supplementary Figure 1: MYCER protein expressed from the transgene can enhance
Relative luciferase activity Relative luciferase activity MYC is a critical target FBXW7 MYC Supplementary is a critical Figures target 1-7. FBXW7 Supplementary Material A E-box sequences 1 2 3 4 5 6 HSV-TK
Tumor Growth Suppression Through the Activation of p21, a Cyclin-Dependent Kinase Inhibitor
Tumor Growth Suppression Through the Activation of p21, a Cyclin-Dependent Kinase Inhibitor Nicholas Love 11/28/01 A. What is p21? Introduction - p21 is a gene found on chromosome 6 at 6p21.2 - this gene
Real-time PCR. TaqMan Protein Assays. Unlock the power of real-time PCR for protein analysis
Real-time PCR TaqMan Protein Assays Unlock the power of real-time PCR for protein analysis I can use my real-time PCR instrument to quantitate protein? Do protein levels correlate with related mrna levels
Supplementary Figure 1: Expression of RNF8, HERC2 and NEURL4 in the cerebellum and knockdown of RNF8 by RNAi (a) Lysates of the cerebellum from rat
Supplementary Figure 1: Expression of RNF8, HERC2 and NEURL4 in the cerebellum and knockdown of RNF8 by RNAi (a) Lysates of the cerebellum from rat pups at P6, P14, P22, P30 and adult (A) rats were subjected
Supplementary Figure 1. RAD51 and RAD51 paralogs are enriched spontaneously onto
Supplementary Figure legends Supplementary Figure 1. and paralogs are enriched spontaneously onto the S-phase chromatin during DN replication. () Chromatin fractionation was carried out as described in
Bronchial epithelium and its associated tissues act as a
The Journal of Immunology A JNK-Independent Signaling Pathway Regulates TNF -Stimulated, c-jun-driven FRA-1 Protooncogene Transcription in Pulmonary Epithelial Cells 1 Pavan Adiseshaiah,* Dhananjaya V.
Junhong Han, Yu-ichi Tsukada, Eiji Hara, Naomi Kitamura, and Toshiaki Tanaka
THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 280, No. 36, Issue of September 9, pp. 31548 31556, 2005 2005 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A. Hepatocyte
Nature Structural and Molecular Biology: doi: /nsmb.2959
Supplementary Figure 1 EIciNAs were pulled down with an antibody to Pol II. (a) Western blot showing that pol II was efficiently pulled down with a pol II antibody in HeLa cell lysates. (b) The enrichment
Supplementary Figure legends
Supplementary Figure legends Supplementary Figure S1. Genome wide shrna screen. A, Screen schematic. The OpenBiosystems GIPZ lentiviral shrna library was divided into six pools, each encompassing 9600
Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or
Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or absence of the acetyltransferase CBP and acetylated TDP-43
Galina Gabriely, Ph.D. BWH/HMS
Galina Gabriely, Ph.D. BWH/HMS Email: ggabriely@rics.bwh.harvard.edu Outline: microrna overview microrna expression analysis microrna functional analysis microrna (mirna) Characteristics mirnas discovered
Int. J. Mol. Sci. 2016, 17, 1259; doi: /ijms
S1 of S5 Supplementary Materials: Fibroblast-Derived Extracellular Matrix Induces Chondrogenic Differentiation in Human Adipose-Derived Mesenchymal Stromal/Stem Cells in Vitro Kevin Dzobo, Taegyn Turnley,
Table S1. Primer sequences
Table S1. Primer sequences Primers for quantitative PCR Tgf 1 Forward Tgf 1 Reverse Tgf 2Forward Tgf 2Reverse Tgf 3 Forward Tgf 3 Reverse Tgf r1 Forward Tgf r1 Reverse Tgf r2 Forward Tgf r2 Reverse Thbs1
Nature Methods: doi: /nmeth Supplementary Figure 1. Validation of RaPID with EDEN15
Supplementary Figure 1 Validation of RaPID with EDEN15 (a) Full Western Blot of conventional biotinylated RNA pulldown with EDEN15 and scrambled control (n=3 biologically independent experiments, representative
REAL TIME PCR USING SYBR GREEN
REAL TIME PCR USING SYBR GREEN 1 THE PROBLEM NEED TO QUANTITATE DIFFERENCES IN mrna EXPRESSION SMALL AMOUNTS OF mrna LASER CAPTURE SMALL AMOUNTS OF TISSUE PRIMARY CELLS PRECIOUS REAGENTS 2 THE PROBLEM
Comparison of Commercial Transfection Reagents: Cell line optimized transfection kits for in vitro cancer research.
Comparison of Commercial Transfection Reagents: Cell line optimized transfection kits for in vitro cancer research. by Altogen Labs, 11200 Manchaca Road, Suite 203 Austin TX 78748 USA Tel. (512) 433-6177
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Legends for Supplementary Tables. Supplementary Table 1. An excel file containing primary screen data. Worksheet 1, Normalized quantification data from a duplicated screen: valid
Supplemental Information. HEXIM1 and NEAT1 Long Non-coding RNA Form. a Multi-subunit Complex that Regulates. DNA-Mediated Innate Immune Response
Molecular Cell, Volume 67 Supplemental Information HEXIM1 and NEAT1 Long Non-coding RNA Form a Multi-subunit Complex that Regulates DNA-Mediated Innate Immune Response Mehdi Morchikh, Alexandra Cribier,
NTM486-04, NTM174-04,
Transfection of transformed human trabecular meshwork TM5, and primary human NTM210-05, NTM486-04, NTM174-04, and NTM153-00 cells with Metafectene Easy Adnan Dibas1A,C, Ming Jiang1A,C, Thomas Yorio1A,C.
Supplementary Information Design of small molecule-responsive micrornas based on structural requirements for Drosha processing
Supplementary Information Design of small molecule-responsive micrornas based on structural requirements for Drosha processing Chase L. Beisel, Yvonne Y. Chen, Stephanie J. Culler, Kevin G. Hoff, & Christina
Thyroid peroxidase gene expression is induced by lipopolysaccharide involving Nuclear Factor (NF)-κB p65 subunit phosphorylation
1 2 3 4 5 SUPPLEMENTAL DATA Thyroid peroxidase gene expression is induced by lipopolysaccharide involving Nuclear Factor (NF)-κB p65 subunit phosphorylation Magalí Nazar, Juan Pablo Nicola, María Laura
PrimePCR Assay Validation Report
Gene Information Gene Name transforming growth factor, beta 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID TGFB1 Human This gene encodes a member of the
Technical Review. Real time PCR
Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously
TAKING PROTEIN PHOSPHORYLATION MEASUREMENT ONE STEP FURTHER. Alpha SureFire Technology. AlphaLISA SureFire Ultra
TAKING PROTEIN PHOSPHORYLATION MEASUREMENT ONE STEP FURTHER Alpha SureFire Technology AlphaLISA SureFire Ultra IT S THE ASSAY THAT DEFINES NEXT GENERATION If you're developing biotherapeutics whether you're
Supplementary Figures
Supplementary Figures Supplementary Figure 1. Description of the observed lymphatic metastases in two different SIX1-induced MCF7 metastasis models (Nude and NOD/SCID). Supplementary Figure 2. MCF7-SIX1
A) B) Ladder. Supplementary Figure 1. Recombinant calpain 14 purification analysis. A) The general domain structure of classical
A) B) Ladder C) r4 r4 Nt- -Ct 78 kda Supplementary Figure 1. Recombinant calpain 14 purification analysis. A) The general domain structure of classical calpains is shown. The protease core consists of
IMMUNOPRECIPITATION (IP)
1 IMMUNOPRECIPITATION (IP) Overview and Technical Tips 2 CONTENTS 3 7 8 9 12 13 17 18 19 20 Introduction Factors Influencing IP General Protocol Modifications Of IP Protocols Troubleshooting Contact Us
Supplementary Figure 1: Derivation and characterization of RN ips cell lines. (a) RN ips cells maintain expression of pluripotency markers OCT4 and
Supplementary Figure 1: Derivation and characterization of RN ips cell lines. (a) RN ips cells maintain expression of pluripotency markers OCT4 and SSEA4 after 10 passages in mtesr 1 medium. (b) Schematic
Rat IGF-1 ELISA Kit (rigf-1-elisa)
Rat IGF-1 ELISA Kit (rigf-1-elisa) Cat. No. EK0377 96 Tests in 8 x 12 divisible strips Background Insulin-like growth factor 1 (IGF-1), also known as somatomedin C, is a polypeptide protein hormone similar
ChampionChIP Quick, High Throughput Chromatin Immunoprecipitation Assay System
ChampionChIP Quick, High Throughput Chromatin Immunoprecipitation Assay System Liyan Pang, Ph.D. Application Scientist 1 Topics to be Covered Introduction What is ChIP-qPCR? Challenges Facing Biological
sirna Overview and Technical Tips
1 sirna Overview and Technical Tips 2 CONTENTS 3 4 5 7 8 10 11 13 14 18 19 20 21 Introduction Applications How Does It Work? Handy Tips Troubleshooting Conclusions Further References Contact Us 3 INTRODUCTION
CRE/CREB Reporter Assay Kit camp/pka Cell Signaling Pathway Catalog #: 60611
Data Sheet CRE/CREB Reporter Assay Kit camp/pka Cell Signaling Pathway Catalog #: 60611 Background The main role of the camp response element, or CRE, is mediating the effects of Protein Kinase A (PKA)
Supporting Online Material for
www.sciencemag.org/cgi/content/full/1137999/dc1 Supporting Online Material for Disrupting the Pairing Between let-7 and Enhances Oncogenic Transformation Christine Mayr, Michael T. Hemann, David P. Bartel*
Hossain_Supplemental Figure 1
Hossain_Supplemental Figure 1 GFP-PACT GFP-PACT Motif I GFP-PACT Motif II A. MG132 (1µM) GFP Tubulin GFP-PACT Pericentrin GFP-PACT GFP-PACT Pericentrin Fig. S1. Expression and localization of Orc1 PACT
Figure S1. Mechanism of ON induced MM cell death.
Figure S1. Mechanism of ON123300 induced MM cell death. To elucidate whether ON123300 induced decrease of viability of MM cells was associated with induction of apoptosis, the number of apoptotic cells
Functional characterisation
Me Me Ac Ac Functional characterisation How can we know if measured changes in DNA methylation and function (phenotype) and linked, and in what way? DNMT Dianne Ford Professor of Molecular Nutritional
Supplementary Figures Montero et al._supplementary Figure 1
Montero et al_suppl. Info 1 Supplementary Figures Montero et al._supplementary Figure 1 Montero et al_suppl. Info 2 Supplementary Figure 1. Transcripts arising from the structurally conserved subtelomeres
Lecture #1. Introduction to microarray technology
Lecture #1 Introduction to microarray technology Outline General purpose Microarray assay concept Basic microarray experimental process cdna/two channel arrays Oligonucleotide arrays Exon arrays Comparing
Gene Expression Technology
Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene
Learning Objectives. Define RNA interference. Define basic terminology. Describe molecular mechanism. Define VSP and relevance
Learning Objectives Define RNA interference Define basic terminology Describe molecular mechanism Define VSP and relevance Describe role of RNAi in antigenic variation A Nobel Way to Regulate Gene Expression
Development of a Tissue Slice Culture Model for Prostate Cancer
Development of a Tissue Slice Culture Model for Prostate Cancer Hanneke van Zoggel, PhD Experimental Urology Erasmus MC ; JNI, Be 330 j.vanzoggel@erasmusmc.nl 3D workshop 23/24-09-2013 Create novel models
Isolation, culture, and transfection of primary mammary epithelial organoids
Supplementary Experimental Procedures Isolation, culture, and transfection of primary mammary epithelial organoids Primary mammary epithelial organoids were prepared from 8-week-old CD1 mice (Charles River)
a Award Number: W81XWH TITLE:
AD Award Number: W81XWH-04-1-0138 TITLE: Imaging Metastatic Prostate Cancer After Genetic Manipulation of Transcriptional Memory Regulators EZH2 and EED PRINCIPAL INVESTIGATOR: Lily Wu, M.D., Ph.D. CONTRACTING
TECHNICAL BULLETIN. Color. Fig.1. Cell-Based protein phosphorylation procedure
Cell-Based ELISA Kit for detecting phospho-stat3 (ptyr 705 ) in cultured cell lines adequate for 96 assays (1 96 well plate) Catalog Number RAB0444 Storage Temperature 20 C TECHNICAL BULLETIN Product Description
Yue Wang, Zhenyu Xu, Junfeng Jiang, Chen Xu, Jiuhong Kang, Lei Xiao, Minjuan Wu, Jun Xiong, Xiaocan Guo, and Houqi Liu
Developmental Cell, Volume 25 Supplemental Information Endogenous mirna Sponge lincrna-ror Regulates Oct4, Nanog, and Sox2 in Human Embryonic Stem Cell Self-Renewal Yue Wang, Zhenyu Xu, Junfeng Jiang,
PrimePCR Assay Validation Report
Gene Information Gene Name SRY (sex determining region Y)-box 6 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID SOX6 Human This gene encodes a member of the
Species predicted to react based on 100% sequence homology: Chicken, Bovine, Dog.
1 of 5 11/1/2013 10:25 PM Product Pathways - Jak/Stat Pathway Phospho-Stat3 (Tyr705) Antibody #9131 Have you tried your application using our XP monoclonal antibodies? Try products: 9145 PhosphoSitePlus
A Phosphatase Holoenzyme Comprised of Shoc2/Sur8 and the Catalytic Subunit of PP1 Functions as an M-Ras Effector to Modulate Raf Activity
Molecular Cell 22, 217 230, April 21, 2006 ª2006 Elsevier Inc. DOI 10.1016/j.molcel.2006.03.027 A Phosphatase Holoenzyme Comprised of Shoc2/Sur8 and the Catalytic Subunit of PP1 Functions as an M-Ras Effector
Supplementary Figure 1 Characterization of sirna-onv stability. (a) Fluorescence recovery curves of SQ-siRNA-ONV and SQ-ds-siRNA in 1 TAMg buffer
Supplementary Figure 1 Characterization of sirna-onv stability. (a) Fluorescence recovery curves of SQ-siRNA-ONV and SQ-ds-siRNA in 1 TAMg buffer containing 10% serum The data error bars indicate means
mir-24-mediated down-regulation of H2AX suppresses DNA repair
Supplemental Online Material mir-24-mediated down-regulation of H2AX suppresses DNA repair in terminally differentiated blood cells Ashish Lal 1,4, Yunfeng Pan 2,4, Francisco Navarro 1,4, Derek M. Dykxhoorn
The lineage-defining factors T-bet and Bcl-6 collaborate to regulate Th1 gene expression patterns
The lineage-defining factors T-bet and Bcl-6 collaborate to regulate Th1 gene expression patterns Kenneth J. Oestreich, 1 Albert C. Huang, 1,2 and Amy S. Weinmann 1,2 1 Department of Immunology and 2 Molecular
TransIT-TKO Transfection Reagent
Quick Reference Protocol, MSDS and Certificate of Analysis available at mirusbio.com/2150 INTRODUCTION TransIT-TKO is a broad spectrum sirna transfection reagent that enables high efficiency sirna delivery
3.1.4 DNA Microarray Technology
3.1.4 DNA Microarray Technology Scientists have discovered that one of the differences between healthy and cancer is which genes are turned on in each. Scientists can compare the gene expression patterns
Percent survival. Supplementary fig. S3 A.
Supplementary fig. S3 A. B. 100 Percent survival 80 60 40 20 Ml 0 0 100 C. Fig. S3 Comparison of leukaemia incidence rate in the triple targeted chimaeric mice and germline-transmission translocator mice
Initial genotyping of all new litters was performed by Transnetyx (Memphis,
SUPPLEMENTAL INFORMATION MURILLO ET AL. SUPPLEMENTAL EXPERIMENTAL PROCEDURES Mouse Genotyping Initial genotyping of all new litters was performed by Transnetyx (Memphis, USA). Assessment of LoxPpα recombination
Polyadenylation-Dependent Control of Long Noncoding RNA Expression by the Poly(A)-Binding Protein Nuclear 1
Polyadenylation-Dependent Control of Long Noncoding RNA Expression by the Poly(A)-Binding Protein Nuclear 1 Yves B. Beaulieu 1, Claudia L. Kleinman 2, Anne-Marie Landry-Voyer 1, Jacek Majewski 2, François
SUPPLEMENTARY INFORMATION
A diphtheria toxin resistance marker for in vitro and in vivo selection of stably transduced human cells Gabriele Picco, Consalvo Petti, Livio Trusolino, Andrea Bertotti and Enzo Medico SUPPLEMENTARY INFORMATION
Supporting Information
Supporting Information Ho et al. 1.173/pnas.81288816 SI Methods Sequences of shrna hairpins: Brg shrna #1: ccggcggctcaagaaggaagttgaactcgagttcaacttccttcttgacgnttttg (TRCN71383; Open Biosystems). Brg shrna
* This work was supported, in whole or in part, by National Institutes of Health Grants HL56850 and AG S EXPERIMENTAL PROCEDURES
THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 285, NO. 10, pp. 6937 6951, March 5, 2010 2010 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A. p66 shc Inhibits Insulin-like
FEBRUARY 12, 2010 VOLUME 285 NUMBER 7 JOURNAL OF BIOLOGICAL CHEMISTRY 4847
THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 285, NO. 7, pp. 4847 4858, February 12, 2010 2010 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A. The Tumor Suppressor