Supplementary Figure Legends. Supplementary Figure 1. Positioning of nucleosomes by different RSSs.
|
|
- Egbert Fleming
- 6 years ago
- Views:
Transcription
1 Supplementary Figure Legends Supplementary Figure 1. Positioning of nucleosomes by different RSSs. A. Mapping of nucleosomes in the '' and 'END' positions on fragments carrying different RSSs. The RSSs with the nonamer sequences indicated were cloned in an equivalent position to the RSS in MAB5. Restriction enzyme digestions of the bp fragments obtained following micrococcal nuclease digestion of the reconstituted nucleosomes are shown. B. Schematic diagram of the nucleosome positions mapped in A. All RSSs with a consensus nonamer sequence (i.e. all except TCRγ5), cause nucleosome positioning over the RSS in the '' position and at the left end in the 'END' position. In the '' position, a fraction of nucleosomes remain in one of the favoured positions mapped in the absence of an RSS on MAB4. We suggest the extent of repositioning of the nucleosome over the RSS depends on the relative strength of adjacent positioning sequences. The non-rss positioning sequence in MAB4 appears to be relatively strong: in vitro some nucleosomes stay in the alternate position whereas in vivo the Vκ21c RSS is fully protected (Figure 5C). Supplementary Figure 2. Accessibility of the Jκ1 RSS in 103-BCL/2 cells. The pre-b cell line, 103-BCL/2 was grown at either the permissive temperature ( o C) or non-permissive temperature (39 o C) for 12 hours to induce recombination. Nuclei were prepared, digested with ScaI for 1 hour at 37 o C and 1
2 cutting at the RSS and adjacent neutral site was analysed as described. Only a very modest increase in accessibility at the RSS compared to the neutral site was observed under conditions where the cells were undergoing recombination. Supplementary Figure 3. Substitution of the nonamer from cryptic RSSs results in loss of nucleosome positioning over the RSS. Restriction enzyme digestions of the bp fragments obtained following micrococcal nuclease digestion of the MAB12-1, -2 and -3 nucleosome complexes shown in Figure 6A. Considerably more positions are detected than when the consensus RSS is present. Moreover, the smear on the native gel suggests that yet further nucleosome positions exist. Supplementary Figure 4. Time course of RSS accessibility and RAG induction following transfection of NIH3T3 cells. A. Maximal protection of the 23-RSS ScaI site from restriction enzyme cutting is achieved by 32 hours after transfection. Nuclei were prepared from cells harvested at the times indicated after transfection and were digested with an excess of ScaI. The extent of ScaI cutting was then determined by Southern blotting as described in Figure 5B. B. Induction of RAG1 expression. NIH3T3 cells were transfected with an auto-regulatory tetracycline-controlled transactivator (ptet-ttak; Shockett et al., 1995) and RAG1 under the control of a tetracycline-inducible promoter. 2
3 Tetracycline was withdrawn from the medium 36 hours after transfection and induction of RAG1 expression was measured via western blotting using anti- RAG1 antibodies (PharMingen). An arrow indicates the time of tetracycline withdrawal. 3
4 END END END END END END A Vκ1 (ACAAAAACC) Vκcy9 (ACATAAACC) Vκdv36 (ACAAAAACC) Vκ21c (ACAAAAACC) Vκ24 (ACAAAAACC) TCRγ5 (ACTGAAGAG) Supplementary Figure 1A
5 B : Vκ1 Vκcy9 Vκdv36 Vκ21c Vκ24 : TCRγ5 + END: Vκ1 Vκcy9 Vκdv36 Vκ21c Vκ24 END: TCRγ5 Supplementary Figure 1B
6 103-BCL/2 23RSS (Jκ1) non-rss kb 2.0 M 39 kb M parental cleaved % accessibility Supplementary Figure 2
7 MAB12-1 MAB12-2 MAB12-3 Supplementary Figure 3
8 A B pmab1-23rss RAG1 expression time of transfection kb 32 h 36 h 40 h 64 h time of transfection 32 h 36 h 40 h 64 h kd parental cleaved % accessibility Supplementary Figure 4
Lecture 3. Used anti B cell marker antibodies to deplete in mice
Lecture 3 V-Gene Rearrangement and Expression Used anti B cell marker antibodies to deplete in mice Rat anti mouse CD19, anti mouse B220, and anti mouse CD22. Mice were then injected with a secondary antibody
More informationAntibody Structure. Antibodies
Antibodies Secreted by B lymphocytes Great diversity and specificity: >10 9 different antibodies; can distinguish between very similar molecules Tag particles for clearance/destruction Protect against
More informationAntibody Structure supports Function
Antibodies Secreted by B lymphocytes Great diversity and specificity: >10 9 different antibodies; can distinguish between very similar molecules Tag particles for clearance/destruction Protect against
More informationSUPPLEMENTAL MATERIALS
SUPPLEMENL MERILS Eh-seq: RISPR epitope tagging hip-seq of DN-binding proteins Daniel Savic, E. hristopher Partridge, Kimberly M. Newberry, Sophia. Smith, Sarah K. Meadows, rian S. Roberts, Mark Mackiewicz,
More informationChapter 3. Enzyme manipulation of DNA and RNA
Chapter 3 Enzyme manipulation of DNA and RNA To measure incorporation of radioactivity (to see if the probe is good or not for hybridization) Acid precipitation method: - Add sonicated salmon sperm DNA
More informationSupplementary Information
Supplementary Information Deletion of the B-B and C-C regions of inverted terminal repeats reduces raav productivity but increases transgene expression Qingzhang Zhou 1, Wenhong Tian 2, Chunguo Liu 3,
More informationEnzymatic assembly of DNA molecules up to several hundred kilobases
nature methods Enzymatic assembly of DNA molecules up to several hundred kilobases Daniel G Gibson, Lei Young, Ray-Yuan Chuang, J Craig Venter, Clyde A Hutchison III & Hamilton O Smith Supplementary figures
More informationImmunological Techniques
Midterm Extra Office Hours Take Regular Office Hours: Tuesdays 11-12 Extra office hours: Wed, Feb 7 12-1pm Thurs, Feb 8 11am-12 Fri, Feb 9 2-4pm I WILL NOT BE HOLDING OFFICE HOURS ON TUESDAY Feb 13!! Dina,
More informationThe Role of Topoisomerase II in the Excision of DNA Loop Domains
THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 277, No. 24, Issue of June 14, pp. 21458 21467, 2002 2002 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A. The Role of Topoisomerase
More informationSupplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1: Vector maps of TRMPV and TRMPVIR variants. Many derivatives of TRMPV have been generated and tested. Unless otherwise noted, experiments in this paper use
More informationManipulation of Purified DNA
Manipulation of Purified DNA To produce the recombinant DNA molecule, the vector, as well as the DNA to be cloned, must be cut at specific points and then joined together in a controlled manner by DNA
More informationR1 12 kb R1 4 kb R1. R1 10 kb R1 2 kb R1 4 kb R1
Bcor101 Sample questions Midterm 3 1. The maps of the sites for restriction enzyme EcoR1 (R1) in the wild type and mutated cystic fibrosis genes are shown below: Wild Type R1 12 kb R1 4 kb R1 _ _ CF probe
More informationIMMUNOGLOBULIN GENES UNDERGO TWO DNA REARRANGEMENTS
A Prototype Ig Gene: Murine Kappa About 10 0 V κ gene segments 4 J Gene Segment s 1 C κ Gene Segmen t Multiple V gene segments, distant from J and C A few J gene segments One C gene segment GERMLINE Ig
More informationSynthetic Biology. Sustainable Energy. Therapeutics Industrial Enzymes. Agriculture. Accelerating Discoveries, Expanding Possibilities. Design.
Synthetic Biology Accelerating Discoveries, Expanding Possibilities Sustainable Energy Therapeutics Industrial Enzymes Agriculture Design Build Generate Solutions to Advance Synthetic Biology Research
More informationT and B cell gene rearrangement October 17, Ram Savan
T and B cell gene rearrangement October 17, 2016 Ram Savan savanram@uw.edu 441 Lecture #9 Slide 1 of 28 Three lectures on antigen receptors Part 1 (Last Friday): Structural features of the BCR and TCR
More informationSupplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate
Supplementary Figure Legends Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate BC041951 in gastric cancer. (A) The flow chart for selected candidate lncrnas in 660 up-regulated
More informationA tool kit for rapid cloning and expression of. recombinant antibodies
A tool kit for rapid cloning and expression of recombinant antibodies Tihomir S Dodev 1,4, Panagiotis Karagiannis 1,2, Amy E Gilbert 1,2, Debra H Josephs 1,2,3, Holly Bowen 1,4, Louisa K James 4, Heather
More informationConcepts: What are RFLPs and how do they act like genetic marker loci?
Restriction Fragment Length Polymorphisms (RFLPs) -1 Readings: Griffiths et al: 7th Edition: Ch. 12 pp. 384-386; Ch.13 pp404-407 8th Edition: pp. 364-366 Assigned Problems: 8th Ch. 11: 32, 34, 38-39 7th
More informationTransfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX
Transfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX INTRODUCTION The CRISPR/Cas genome editing system consists of a single guide RNA
More informationXactEdit Cas9 Nuclease with NLS User Manual
XactEdit Cas9 Nuclease with NLS User Manual An RNA-guided recombinant endonuclease for efficient targeted DNA cleavage Catalog Numbers CE1000-50K, CE1000-50, CE1000-250, CE1001-250, CE1001-1000 Table of
More informationEvidence of a critical architectural function for the RAG proteins in end processing, protection, and joining in V(D)J recombination
Evidence of a critical architectural function for the RAG proteins in end processing, protection, and joining in V(D)J recombination Chia-Lun Tsai, 1 Anna H. Drejer, 2 and David G. Schatz 3,4 1 Department
More information2. Outline the levels of DNA packing in the eukaryotic nucleus below next to the diagram provided.
AP Biology Reading Packet 6- Molecular Genetics Part 2 Name Chapter 19: Eukaryotic Genomes 1. Define the following terms: a. Euchromatin b. Heterochromatin c. Nucleosome 2. Outline the levels of DNA packing
More informationDown-regulation of TDT transcription in CD4 + CD8 + thymocytes by Ikaros proteins in direct competition with an Ets activator
Down-regulation of TDT transcription in CD4 + CD8 + thymocytes by Ikaros proteins in direct competition with an Ets activator Le A. Trinh, 1,3 Roger Ferrini, 1,3 Bradley S. Cobb, 1,3 Amy S. Weinmann, 1
More informationFigure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab.
/ 36B4 mrna ratio Figure S1 * 2. 1.6 1.2.8 *.4 control TNFα BRL49653 Figure S2 Su bw AT p iw Anti- (COOH-terminal peptide) Ab Blot : Anti-GST-(45-127) Ab β-actin Figure S3 HB2 HW AT BA T Figure S4 A TAG
More informationCell type-specific delivery of sirnas with aptamer-sirna chimeras
Cell type-specific delivery of sirnas with aptamer-sirna chimeras Sullenger, B. A. et al Duke Center for Translational Research, Duke University Nature Biotechnology, 2006, 24, 1005 Julia Vargas November
More informationSupplementary Fig. 1. Characteristics of transcription elongation by YonO. a. YonO forms a saltstable EC. Immobilized ECs were washed with
Supplementary Fig. 1. Characteristics of transcription elongation by YonO. a. YonO forms a saltstable EC. Immobilized ECs were washed with transcription buffer with or without a high salt concentration
More informationMolecular Cell Biology - Problem Drill 11: Recombinant DNA
Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna
More informationGFP CCD2 GFP IP:GFP
D1 D2 1 75 95 148 178 492 GFP CCD1 CCD2 CCD2 GFP D1 D2 GFP D1 D2 Beclin 1 IB:GFP IP:GFP Supplementary Figure 1: Mapping domains required for binding to HEK293T cells are transfected with EGFP-tagged mutant
More informationThe preparation of native chromatin from cultured human cells.
Native chromatin immunoprecipitation protocol The preparation of native chromatin from cultured human cells. All solutions need to be ice cold. Sucrose containing solutions must be made up fresh on the
More informationLecture Four. Molecular Approaches I: Nucleic Acids
Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single
More informationBS 50 Genetics and Genomics Week of Nov 29
BS 50 Genetics and Genomics Week of Nov 29 Additional Practice Problems for Section Problem 1. A linear piece of DNA is digested with restriction enzymes EcoRI and HinDIII, and the products are separated
More informationSupplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling
Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Glendining KA 1, Markie D 2, Gardner RJM 4, Franz EA 3, Robertson SP 4, Jasoni CL 1 Supplementary
More informationGene Cloning & DNA Analysis
CSS451 CSS/HRT 451 Gene Cloning & DNA Analysis Chapter 4-5 T-DNA LB auxin cytokin opine Oncogenic genes RB vir genes ori opine catabolism Guo-qing Song Part 1 Basic principles Gene Cloning & DNA Analysis
More informationalignment in vitro and in transgenic mice (gene expression/chromatin/histones)
Proc. Natl. Acad. Sci. USA Vol. 92, pp. 7724-7728, August 1995 Genetics Rat growth hormone gene introns stimulate nucleosome alignment in vitro and in transgenic mice (gene expression/chromatin/histones)
More informationViral RNAi suppressor reversibly binds sirna to. outcompete Dicer and RISC via multiple-turnover
Supplementary Data Viral RNAi suppressor reversibly binds sirna to outcompete Dicer and RISC via multiple-turnover Renata A. Rawlings 1,2, Vishalakshi Krishnan 2 and Nils G. Walter 2 * 1 Biophysics and
More informationLECTURE: 22 IMMUNOGLOBULIN DIVERSITIES LEARNING OBJECTIVES: The student should be able to:
LECTURE: 22 Title IMMUNOGLOBULIN DIVERSITIES LEARNING OBJECTIVES: The student should be able to: Identify the chromosome that contains the gene segments that encode the surface immunoglobulin heavy chain
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature09937 a Name Position Primersets 1a 1b 2 3 4 b2 Phenotype Genotype b Primerset 1a D T C R I E 10000 8000 6000 5000 4000 3000 2500 2000 1500 1000 800 Donor (D)
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Legends for Supplementary Tables. Supplementary Table 1. An excel file containing primary screen data. Worksheet 1, Normalized quantification data from a duplicated screen: valid
More informationGolden Gate TALEN assembly
Golden Gate TALEN assembly This is an expanded and slightly modified TAL assembly protocol published in the original form in Cermak, et al., 2011 (http://dx.doi.org/10.1093/nar/gkr218) Modifications to
More informationTrueORF TM cdna Clones and PrecisionShuttle TM Vector System
TrueORF TM cdna Clones and PrecisionShuttle TM Vector System Application Guide Table of Contents Package Contents and Storage Conditions... 2 Related, Optional Reagents... 2 Related Products... 2 Available
More informationFigure S1. gfp tola and pal mcherry can complement deletion mutants of tola and pal respectively. (A)When strain LS4522 was grown in the presence of
Figure S1. gfp tola and pal mcherry can complement deletion mutants of tola and pal respectively. (A)When strain LS4522 was grown in the presence of xylose, inducing expression of gfp-tola, localization
More informationConstruction of plant complementation vector and generation of transgenic plants
MATERIAL S AND METHODS Plant materials and growth conditions Arabidopsis ecotype Columbia (Col0) was used for this study. SALK_072009, SALK_076309, and SALK_027645 were obtained from the Arabidopsis Biological
More informationLearning Objectives :
Learning Objectives : Understand the basic differences between genomic and cdna libraries Understand how genomic libraries are constructed Understand the purpose for having overlapping DNA fragments in
More informationComputational Biology I LSM5191
Computational Biology I LSM5191 Lecture 5 Notes: Genetic manipulation & Molecular Biology techniques Broad Overview of: Enzymatic tools in Molecular Biology Gel electrophoresis Restriction mapping DNA
More informationSUMOstar Gene Fusion Technology
Gene Fusion Technology NEW METHODS FOR ENHANCING FUNCTIONAL PROTEIN EXPRESSION AND PURIFICATION IN INSECT CELLS White Paper June 2007 LifeSensors Inc. 271 Great Valley Parkway Malvern, PA 19355 www.lifesensors.com
More informationNucleic Acid Electrophoresis APPLICATION GUIDE
AGAROSE BUFFERS LADDERS EQUIPMENT Nucleic Acid Electrophoresis APPLICATION GUIDE Reagents: Agarose Thermo Scientific and Fisher Scientific products deliver an end-to-end solution that can meet your most
More informationSome types of Mutagenesis
Mutagenesis What Is a Mutation? Genetic information is encoded by the sequence of the nucleotide bases in DNA of the gene. The four nucleotides are: adenine (A), thymine (T), guanine (G), and cytosine
More informationReplication-coupled chromatin assembly is required for die repression of basal transcription in vivo
Replication-coupled chromatin assembly is required for die repression of basal transcription in vivo Genevieve Almouzni I and Alan P. Wolffe 2 Laboratory of Molecular Embryology, National Institute of
More informationRecombinant Antibody Production in Therapeutic Antibody Projects. Keshav Vasanthavada Senior Marketing Specialist, GenScript April 7, 2016
Recombinant Antibody Production in Therapeutic Antibody Projects Keshav Vasanthavada Senior Marketing Specialist, GenScript April 7, 2016 Presentation Outline 1 2 3 4 5 Introduction Recombinant Ab Production
More information- NaCr. + NaCr. α H3K4me2 α H3K4me3 α H3K9me3 α H3K27me3 α H3K36me3 H3 H2A-2B H4 H3 H2A-2B H4 H3 H2A-2B H4. α Kcr. (rabbit) α Kac.
+ NaCr NaCr + NaCr NaCr Peptides 10ng 50ng 250ng K α Pan (mouse) Pan (mouse) 10ng 50ng 250ng α Pan (rabbit) C 10ng 50ng 250ng α Pan (mouse) 0 1.25 2.5 5 10 20 40 (mm) NaCr 24h α Pan (rabbit) α K4me2 α
More informationMitochondria/Cytosol Fractionation Kit
Mitochondria/Cytosol Fractionation Kit Sufficient for analysis of 50 samples Cat. No. MIT1000 FOR RESEARCH USE ONLY Not for use in diagnostic procedures. USA & Canada Phone: +1(800) 437-7500 Fax: +1 (951)
More informationSupplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product.
Supplementary Information Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product. Total protein extracted from Kitaake wild type and rice plants carrying
More informationSupplementary Information
Journal : Nature Biotechnology Supplementary Information Targeted genome engineering in human cells with RNA-guided endonucleases Seung Woo Cho, Sojung Kim, Jong Min Kim, and Jin-Soo Kim* National Creative
More informationInterleukin-10 Inhibits Interleukin-12 p40 Gene Transcription by Targeting a Late Event in the Activation Pathway
MOLECULAR AND CELLULAR BIOLOGY, Mar. 2004, p. 2385 2396 Vol. 24, No. 6 0270-7306/04/$08.00 0 DOI: 10.1128/MCB.24.6.2385 2396.2004 Copyright 2004, American Society for Microbiology. All Rights Reserved.
More information#FD µl (for 200 rxns) Expiry Date: Description. 1 ml of 10X FastDigest Green Buffer. Store at -20 C
PRODUCT INFORMATION Thermo Scientific FastDigest SalI #FD0644 Lot: 5'...G T C G A C...3' 3'...C A G C T G...5' Supplied with: Store at -20 C 200 µl (for 200 rxns) Expiry Date: BSA included www.thermoscientific.com/onebio
More informationCut Smarter with NEB Restriction Enzymes
ut Smarter with EB Restriction Enzymes A Smarter Look Keep track of your enzyme data with our new, streamlined protocol cards. These collectible cards contain all the information you need for setting up
More informationAlternative Cleavage and Polyadenylation of RNA
Developmental Cell 18 Supplemental Information The Spen Family Protein FPA Controls Alternative Cleavage and Polyadenylation of RNA Csaba Hornyik, Lionel C. Terzi, and Gordon G. Simpson Figure S1, related
More informationCapillary Electrophoresis Compendial Applications
Capillary Electrophoresis Compendial Applications Anita Szajek, Ph.D. Principal Scientific Liaison, Biologics & Biotechnology 14 th Symposium on the Practical Applications for the Analysis of Proteins,
More informationLearning Objectives. Define RNA interference. Define basic terminology. Describe molecular mechanism. Define VSP and relevance
Learning Objectives Define RNA interference Define basic terminology Describe molecular mechanism Define VSP and relevance Describe role of RNAi in antigenic variation A Nobel Way to Regulate Gene Expression
More informationIsolation, culture, and transfection of primary mammary epithelial organoids
Supplementary Experimental Procedures Isolation, culture, and transfection of primary mammary epithelial organoids Primary mammary epithelial organoids were prepared from 8-week-old CD1 mice (Charles River)
More informationGenetic Engineering & Recombinant DNA
Genetic Engineering & Recombinant DNA Chapter 10 Copyright The McGraw-Hill Companies, Inc) Permission required for reproduction or display. Applications of Genetic Engineering Basic science vs. Applied
More informationInhibition of TATA-Binding Protein Function by SAGA Subunits Spt3 and Spt8 at Gcn4-Activated Promoters
MOLECULAR AND CELLULAR BIOLOGY, Jan. 2000, p. 634 647 Vol. 20, No. 2 0270-7306/00/$04.00 0 Copyright 2000, American Society for Microbiology. All Rights Reserved. Inhibition of TATA-Binding Protein Function
More informationName_BS50 Exam 3 Key (Fall 2005) Page 2 of 5
Name_BS50 Exam 3 Key (Fall 2005) Page 2 of 5 Question 1. (14 points) Several Hfr strains derived from the same F + strain were crossed separately to an F - strain, giving the results indicated in the table
More informationPurification of Lactate Dehydrogenase
Dominican University of California Dominican Scholar Scholarly & Creative Works Conference 2018 Scholarly and Creative Works Conference 2016 Apr 15th, 1:30 PM - 2:00 PM Purification of Lactate Dehydrogenase
More informationLecture 25 (11/15/17)
Lecture 25 (11/15/17) Reading: Ch9; 328-332 Ch25; 990-995, 1005-1012 Problems: Ch9 (study-guide: applying); 1,2 Ch9 (study-guide: facts); 7,8 Ch25 (text); 1-3,5-7,9,10,13-15 Ch25 (study-guide: applying);
More informationSupplementary Figures Montero et al._supplementary Figure 1
Montero et al_suppl. Info 1 Supplementary Figures Montero et al._supplementary Figure 1 Montero et al_suppl. Info 2 Supplementary Figure 1. Transcripts arising from the structurally conserved subtelomeres
More informationDirecte d Mutagenesis
Directe d Mutagenesis A Practical Approac h M. J. McPHERSON 1. Mutagenesis facilitated by the removal or introduction of unique restriction sites 1 P. Carte r 1. Introduction to site-directed mutagenesis
More informationChromatin assembly kit
Chromatin assembly kit Cat. No. C01030001 (20 rxns) Version 1 I 09.15 Contacts DIAGENODE HEADQUARTERS Diagenode s.a. BELGIUM EUROPE LIEGE SCIENCE PARK Rue Bois Saint-Jean, 3 4102 Seraing - Belgium Tel:
More informationRibosomal DNA Integrating raav-rdna Vectors Allow for Stable Transgene Expression
original article The American Society of Gene & Cell Therapy Ribosomal DNA Integrating raav-rdna Vectors Allow for Stable Transgene Expression Leszek Lisowski, Ashley Lau,2, Zhongya Wang 3, Yue Zhang,
More informationRegents Biology REVIEW 5: GENETICS
Period Date REVIEW 5: GENETICS 1. Chromosomes: a. Humans have chromosomes, or homologous pairs. Homologous: b. Chromosome pairs carry genes for the same traits. Most organisms have two copies of the gene
More informationPractice Test #3. Multiple Choice Identify the choice that best completes the statement or answers the question.
Practice Test #3 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. An application of using DNA technology to help environmental scientists would be _. a.
More informationA 5 P degradation hot spot influences molecular farming of anticancerogenic nuclease TBN1 in tobacco cells
Plant Cell, Tissue and Organ Culture (PCTOC) A 5 P degradation hot spot influences molecular farming of anticancerogenic nuclease TBN1 in tobacco cells Anna Týcová a,b, Rajen J. J. Piernikarczyk c, Michael
More informationRat IGF-1 ELISA Kit (rigf-1-elisa)
Rat IGF-1 ELISA Kit (rigf-1-elisa) Cat. No. EK0377 96 Tests in 8 x 12 divisible strips Background Insulin-like growth factor 1 (IGF-1), also known as somatomedin C, is a polypeptide protein hormone similar
More informationThe GeneEditor TM in vitro Mutagenesis System: Site- Directed Mutagenesis Using Altered Beta-Lactamase Specificity
Promega Notes Magazine Number 62, 1997, p. 02 The GeneEditor TM in vitro Mutagenesis System: Site- Directed Mutagenesis Using Altered Beta-Lactamase Specificity By Christine Andrews and Scott Lesley Promega
More informationAntibodies and Antigens in the Blood Bank 9/7/2015 NAHLA BAKHAMIS 1
Antibodies and Antigens in the Blood Bank NAHLA BAKHAMIS 9/7/2015 NAHLA BAKHAMIS 1 Outline Antibodies structure, classes and functions Most important Abs in the blood bank effective roles of Abs Zeta potential
More informationGuide-it Indel Identification Kit User Manual
Clontech Laboratories, Inc. Guide-it Indel Identification Kit User Manual Cat. No. 631444 (120114) Clontech Laboratories, Inc. A Takara Bio Company 1290 Terra Bella Avenue, Mountain View, CA 94043, USA
More informationYeaStar Genomic DNA Kit Catalog No. D2002
Instructions YeaStar Genomic DNA Kit Catalog No. D2002 Table of Contents General Information...... 1 Package Contents Ordering Information General Description...... 2 Protocol I.......... 2 Protocol II.
More informationsupplementary information
DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /
More informationHigh Pure PCR Template Preparation Kit for preparation of 100 nucleic acid samples Cat. No
for preparation of 100 nucleic acid samples Cat. No. 1 796 88 Principle Cells are lysed during a short incubation with Proteinase K in the presence of a chaotropic salt (guanidine HCl), which immediately
More informationGenomes summary. Bacterial genome sizes
Genomes summary 1. >930 bacterial genomes sequenced. 2. Circular. Genes densely packed. 3. 2-10 Mbases, 470-7,000 genes 4. Genomes of >200 eukaryotes (45 higher ) sequenced. 5. Linear chromosomes 6. On
More informationImmunoglobulins Harry W Schroeder Jr MD PhD
Immunoglobulins Harry W Schroeder Jr MD PhD Division of Developmental and Clinical Immunology Departments of Medicine, Microbiology, and Genetics University of Alabama at Birmingham Immunoglobulin Has
More informationDNA Laddering Assay Kit
DNA Laddering Assay Kit Item No. 660990 Customer Service 800.364.9897 * Technical Support 888.526.5351 www.caymanchem.com TABLE OF CONTENTS GENERAL INFORMATION 3 Materials Supplied 3 Precautions 4 If You
More informationSupplementary Figure 1. RAD51 and RAD51 paralogs are enriched spontaneously onto
Supplementary Figure legends Supplementary Figure 1. and paralogs are enriched spontaneously onto the S-phase chromatin during DN replication. () Chromatin fractionation was carried out as described in
More information2054, Chap. 14, page 1
2054, Chap. 14, page 1 I. Recombinant DNA technology (Chapter 14) A. recombinant DNA technology = collection of methods used to perform genetic engineering 1. genetic engineering = deliberate modification
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature10163 Supplementary Table 1 Efficiency of vector construction. Process wells recovered efficiency (%) Recombineering* 480 461 96 Intermediate plasmids 461 381 83 Recombineering efficiency
More informationProtein Purification Products. Complete Solutions for All of Your Protein Purification Applications
Protein Purification Products Complete Solutions for All of Your Protein Purification Applications FLAG-Tagged Protein Products EXPRESS with the pcmv-dykddddk Vector Set Fuse your protein of interest to
More informationRNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,
Materials and methods Oligonucleotides and DNA constructs RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by Dharmacon Inc. (Lafayette, CO). The sequences were: 122-2 OMe, 5
More informationCENP-A, -B, and -C Chromatin Complex That Contains the I-Type -Satellite Array Constitutes the Prekinetochore in HeLa Cells
MOLECULAR AND CELLULAR BIOLOGY, Apr. 2002, p. 2229 2241 Vol. 22, No. 7 0270-7306/02/$04.00 0 DOI: 10.1128/MCB.22.7.000 2229 2241.2002 Copyright 2002, American Society for Microbiology. All Rights Reserved.
More informationEXPERIMENT NINE: SOUTHERN BLOT
EXPERIMENT NINE: SOUTHERN BLOT The objectives of this experiment are to: (1) restrict genomic DNA for Southern blot electrophoresis (2) electrophorese restricted gdna for Southern blotting (3) perform
More informationMolecular Biology: DNA sequencing
Molecular Biology: DNA sequencing Author: Prof Marinda Oosthuizen Licensed under a Creative Commons Attribution license. SEQUENCING OF LARGE TEMPLATES As we have seen, we can obtain up to 800 nucleotides
More informationNanoparticle orientation to control RNA loading and ligand display on extracellular vesicles for cancer regression
SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41565-017-0012-z In the format provided by the authors and unedited. Nanoparticle orientation to control RNA loading and ligand display on extracellular
More informationTaKaRa PCR Amplification Kit
Cat. # R011 For Research Use TaKaRa PCR Amplification Kit Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Storage... 4 IV. Materials Required but not Provided... 4 V. Principle...
More informationENCODE DCC Antibody Validation Document
ENCODE DCC Antibody Validation Document Date of Submission 09/12/12 Name: Trupti Kawli Email: trupti@stanford.edu Lab Snyder Antibody Name: SREBP1 (sc-8984) Target: SREBP1 Company/ Source: Santa Cruz Biotechnology
More informationGAGA Factor and the TFIID Complex Collaborate in Generating an Open Chromatin Structure at the Drosophila melanogaster hsp26 Promoter
MOLECULAR AND CELLULAR BIOLOGY, Sept. 2002, p. 6148 6157 Vol. 22, No. 17 0270-7306/02/$04.00 0 DOI: 10.1128/MCB.22.17.6148 6157.2002 Copyright 2002, American Society for Microbiology. All Rights Reserved.
More informationEcoR1 is a type IIP restriction endonuclease which cleaves the palindromic
Transfer of the Fungal cdna CIH-1 from the Plasmid Vector pbk CMV to the Plasmid Vector puc19 and sub- Cloning Mediated Recombinant puc19 Amplification INTRODUCTION Molecular cloning is a method used for
More informationBacterial DNA replication
Bacterial DNA replication Summary: What problems do these proteins solve? Tyr OH attacks PO4 and forms a covalent intermediate Structural changes in the protein open the gap by 20 Å! 1 Summary: What problems
More informationMolecular characterization, detection & quantitation of biological products Purin Charoensuksai, PhD
Molecular characterization, detection & quantitation of biological products Purin Charoensuksai, PhD Department of Biopharmacy, Faculty of Pharmacy, Silpakorn University Example of critical checkpoints
More informationIntroduction. Principle
Contents Introduction............................................................ 2 Principle.............................................................. 2 Storage and Stability.....................................................
More informationRecombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology.
PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R 8 Recombinant DNA Technology The Role of Recombinant DNA Technology in Biotechnology Biotechnology?
More informationPureSpin DNA Clean Up Kit
PureSpin DNA Clean Up Kit Micro Columns INSTRUCTION MANUAL KIT COMPONENTS For Research Use Only PureSpin DNA Clean Up Kit, Micro Columns w/out Caps (Kit Size) OD2080 (50 Preps.) OD2080-2 (200 Preps.) Storage
More information