Transgenic Mice. Introduction. Generation of Transgenic Mice. Transgenic Mice: A Unique Tool for the Study of Mammalian Biology.

Transcription

1 Transgenic Mice Charles Babinet, Institut Pasteur, Paris, France Transgenic mice carry exogenous genetic material introduced by the experimenter. Homologous recombination is used to introduce programmed modifications of the mouse genome. Introduction Introduction Advanced article Article contents Generation of Transgenic Mice Transgenic Mice: A Unique Tool for the Study of Mammalian Biology Conclusion doi: /npg.els Over the last few decades of the twentieth century, the mouse became the animal model of choice for the study of the various aspects of mammalian development, physiology and physiopathology. Apart from being the easiest and cheapest laboratory mammal to maintain, its genetic map is very well known, and many inbred strains (the genetic background of which is defined and identical for all the individuals) as well as mutant strains are available. Furthermore, sequencing of the whole murine genome is almost complete, giving access in principle to all the genes present in the genome. It has been possible since the early 1980s to introduce experimentally new genetic information in the mouse germ line, giving rise to transgenic mice. Finally, and this is unique to the mouse among mammals, the methods for creating transgenic mice have been refined in such a way that it has become possible to create mice bearing a whole range of programmed genetic modifications, including null mutations as well as other types such as not only point mutations, but also alterations at the chromosome level, for example large deletions or translocations. Taken as a whole, the transgenic approach has revolutionized the study of all aspects of mammalian genetics and biology. Generation of Transgenic Mice Transgenic mice by DNA microinjection into the pronucleus of the zygote The first route to generate transgenic mice consists in directly injecting a cloned deoxyribonucleic acid (DNA) of choice (the transgene) into one pronucleus of a fertilized egg. This procedure (Figure 1) gives rise, after reimplantation into a foster mother, to mice in which the transgene has integrated randomly in the mouse genome, generally as tandem head-to-tail arrays of variable length. Thus neither the number of copies integrated nor the site of integration is controlled. However, this route of transgenesis is instrumental in the study of gene regulation in vivo; furthermore, it offers a means of targeting expression of a given gene product into a chosen cell or tissue type, thereby opening the way for the study of its function in physiological or pathological situations. Transgenic mice by the use of embryonic stem cells Transgenic mice may be obtained by a second route, using embryonic stem (ES) cells (Figure 2). These cells, which are derived directly from the culture of blastocysts, retain the remarkable ability to colonize a host embryo, including its germ line; thus previous introduction of exogenous DNA into the cultured ES cells allows one to generate transgenic mice via the production of germ-line chimeras. However, the most important virtue of the use of ES cells to make transgenic mice, in contrast to the transgene pronuclear injection, is that desirable and low-frequency genetic alterations may be selected and verified in the ES clones maintained in culture and then reintroduced in the animal. Thus, for any mutation introduced in ES cells in vitro, the corresponding mutated mouse may be obtained and the phenotypic effects of the mutation studied in detail in the context of the living embryo or animal. Such a scenario has been extremely fruitful for the study of gene function in mammals (Capecchi, 1989). Transgenic Mice: A Unique Tool for the Study of Mammalian Biology Pronuclear microinjection The normal development of complex organisms such as the mouse implies the tightly regulated expression, both spatially and temporally, of genes or groups of genes. Thus, understanding the mechanisms that control gene expression in the context of the developing embryo or animal is a key issue. Transgenic mice ENCYCLOPEDIA OF LIFE SCIENCES & 2005, John Wiley & Sons, Ltd. 1

2 (1) (2) Reimplantation (3) Normal mouse F 0 transgenic (4) (5) F 1 heterozygous transgenics (6) (7) F 2 heterozygous transgenics Transgenic line Figure 1 Generation of transgenic mice by DNA microinjection into the pronucleus of the zygote. A DNA solution is injected (1) into the pronucleus of a zygote. Injected eggs are then reimplanted into a foster mother (2, 3). In a proportion of cases, the injected DNA integrates into the chromosomes of the zygote. The integrated exogenous DNA (the transgene) is transmitted through cell division to all the cells of the mouse born from the injected zygote, giving rise to a transgenic mouse. The presence of the transgene in the host DNA is monitored by Southern blot, using a radioactive probe that specifically recognizes the injected DNA (4, 6). Crossing of transgenic founders (F 0 ) with a nontransgenic mouse will give rise to F 1 progeny, half of which are heterozygous for the transgene (5, 6). F 1 intercrosses (7) allow the experimenter to obtain mice homozygous for the transgene, therefore generating a line of transgenic mice. generated by pronuclear microinjection offer a unique opportunity to address this question. Indeed, transgene expression can be monitored in any type of cell, at any time of embryonic and postnatal development. Thus, different versions of a given gene may be used to generate transgenic mice, thereby allowing one to map the functional regions of this gene necessary for its correct regulation. This approach was applied for the first time to elastase gene expression in the cells of the exocrine pancreas, and it was shown that a 134-bplong sequence was necessary and sufficient for proper temporal and spatial regulation of the gene (Hammer et al., 1987). Since then, such a strategy has been applied successfully to many other genes (reviewed by Macdonald and Swift, 1998). Despite these achievements, it should be noted that analyses of transgene regulation may be obscured by the random character of the integration site; thus the genomic sequences flanking the transgene may result in its enhanced, repressed or even inappropriate expression. This is referred to as a position effect (Wilson et al., 1990). Finally, it is generally observed that transgene expression is not proportional to copy number. These observations point to the necessity of analyzing several independent transgenic lines to draw conclusions about the in vivo regulation regions of any gene (Macdonald and Swift, 1998). Interestingly, specific DNA sequences called locus control regions (LCRs) have been identified in the vicinity of some genes that render transgene expression proportional to the number of copies and independent of the insertion site (Grosveld, 1999). Finally, it should be noted that it is possible to buffer the position effect by using large transgenes such as yeast or bacterial artificial chromosomes (YACs and BACs) which encompass from 100 kb up to 2 Mb (reviewed by Giraldo and Montoliu, 2001). Having defined the regulatory sequences that control specific gene expression, it is then possible to fuse them to the coding sequences of any gene of interest, resulting in a hybrid transgene. Depending on the regulatory sequences used and the coding 2

3 DNA transfer (retroviruses, transgene, targeting vector,...) Selection and isolation of a clone with the desired genetic modification ES cells Genetically modified ES cells Normal mouse Chimeric mice Brown-gray hair: ES Black hair: host embryo Microinjection into blastocyst Analysis of the phenotype induced by the genetic modification in chimeric, heterozygous or homozygous mice Mouse bearing a genetic modification Figure 2 Different stages in the creation of genetically modified mice using embryonic stem (ES) cells. sequence fused to it, enhanced or ectopic expression of either the normal gene or a modified one can be obtained in transgenic mice. Such a strategy is extremely versatile (Figure 3) and has been widely used, for example to address the biological function of a given protein. It may also allow the creation of murine models of human diseases, for example, the role of oncogenes in malignant transformation. Knockout and knockin The availability of ES cells and the design of methods using homologous recombination (HR) to alter a given gene has allowed scientists to extend considerably the use and interest of transgenesis in the mouse. Indeed, it has become possible to create mice with a mutation specifically in a given gene: the phenotypic analysis of the mutant embryo or mouse will then give insight into the function of this gene. The general scenario of targeted mutagenesis by HR in ES cells (outlined in Figure 2) was first used either to introduce or to correct null mutations in the Hprt gene; indeed, in this particular case, the mutated or corrected ES cells could be directly selected by the use of appropriate drugs. HR between an incoming DNA and the homologous sequence in the genome is a rare event, as compared with random insertion. Thus, appropriate targeting vectors and methods of selection were devised to achieve and select HR events and produce ES cells with an altered gene. The most frequently produced alteration is gene disruption, commonly called knockout (KO; Figure 4a). Once the mutated ES clones have been generated, mice bearing the mutation can be obtained via the generation of chimeras (Figure 2). The ability to generate knockout mice has been widely used and more than 1000 genes have been disrupted by HR in ES cells and the corresponding mutated mice generated, illuminating the function of genes in embryonic development as well as in the various (muscular, hematopoietic, nervous, immunological, etc.) biological systems of the mouse. A very interesting extension of the KO approach, the knockin, consists of introducing in the targeting vector the coding sequences of a gene of interest in-frame with those of the endogenous gene. After HR, the modified gene will express the gene of interest, precisely under the control of the promoter and regulatory sequences of the targeted gene, thus avoiding the position effect encountered in transgenesis by pronuclear microinjection (Figure 4b). The gene of interest may be, for example, a reporter gene, coding for proteins such as E. coli beta galactosidase or green fluorescent protein, whose activity is easily visualized and therefore enables determination of the pattern 3

4 Regulatory sequences A Regulatory sequences B Coding sequences A Coding sequences B HYBRID TRANSGENE Regulatory sequences A Coding sequences B Identification of regulatory sequences with a reporter gene 1 Immortalization 4 Production of proteins of biological or medical interest 5 Functional studies and physiopathological models 2 Toxigenetics: cell ablation 3 Figure 3 Hybrid transgenes and their use. A hybrid transgene is made of the regulatory sequences of a gene A bound to the coding sequences of a gene B. In a mouse carrying such a transgene, a gene of interest may be expressed in the cells or tissues where gene A is normally expressed. The gene of interest could code for: (1) A reporter gene (e.g. b-galactosidase or green fluorescent protein). This will help in determining precisely the pattern of expression of gene A. (2) Any protein. The phenotypic consequences of the ectopic expression of this protein will give insight into its function. This approach may also allow study of the function of gene products in various pathological situations, for example the role of oncogenes in malignancy. (3) A toxin, which will result in the ablation of a given type of cells and could illuminate the physiological function of the ablated cells. (4) An immortalizing oncogene, in which case cells expressing the transgene in the mouse may serve to derive cell lines in culture, from cell types that otherwise could not be maintained in vitro. (5) A protein of biological or medical interest. The hybrid transgene is constructed in such a way that the protein of interest will be synthesized in a tissue from which it could be extracted and purified, for example resulting in the extraction of milk or blood. Owing to its small size, the mouse serves only as a model system for bigger animals, for example farm animals. of a given gene even at the cellular level. Another interesting use of knockin deals with genes that have several homologs in the mouse genome but have overlapping or different patterns of expression and the disruption of which generates different phenotypes. Knocking in a complementary DNA (cdna) of a given homolog into another homolog will make it possible to determine if the proteins encoded by the two genes can replace each other and therefore have a similar biological function. Gene targeting: subtle mutations and chromosomal rearrangements While gene disruption is a valuable tool to address gene function, more subtle alterations are needed to refine the genetic analysis and also to create models of human genetic disease, which are frequently caused by subtle mutations resulting in the synthesis of an abnormal protein. However, in this case the presence of the selection cassette in the mutated allele may interfere with the normal regulation and expression of the targeted gene. Methods have therefore been devised to generate a mutated allele devoid of foreign sequences (see Figure 5). One method relies on a hypoxanthine phosphoribosyl transferase (HPRT)-based selection system (Figure 5a, 5b) and has allowed, for example, the generation of mice bearing various point mutations in the prion protein Prnp gene (Barron et al., 2001). The other method (Figure 5b) takes advantage of the properties of an enzyme, the Cre recombinase, isolated from the bacteriophage P1 (Figure 6a, 6b). The end result is a modified allele carrying the mutation and one loxp site as the only foreign sequence (e.g. the generation of a point mutation in the fibroblast growth factor receptor 3; Wang et al., 1999). Use of the Cre loxp system has been extended, in combination with gene targeting, to the generation of chromosomal rearrangements (large deletions, inversions, duplications and translocations; Figure 6c, 6d). Chromosomal abnormalities are frequently involved in human fetal loss and in various types of tumors. 4

5 Selection cassette DT-A Targeting vector Gene of interest (reporter gene, immortalizing gene, paralog, mutated cdna,...) Selection cassette Endogenous allele Modified allele (a) (b) Figure 4 General principle of homologous recombination (HR): (a) Knockout. The targeting vector includes a selection cassette inserted in an exon (exon 2; black rectangles: coding region; white rectangles: noncoding regions) and surrounded by regions of homology with the target gene. In addition, a cassette may be added at one end of the targeting vector, in order to counterselect the cells in which the integration occurs outside of the targeted gene; a cassette expressing the A subunit of the diphtheria toxin (DT-A) is shown. Upon random integration, the DT-A-expressing cassette is retained and the cell is killed by the toxin. In contrast, upon HR, it is excised and therefore the cell survives. Recombination with the endogenous gene occurs within the homologous sequences and results in the creation of a null allele in which disruption of the gene is induced by insertion of the selection cassette into an exon. (b) Knockin: Besides invalidation of the target gene, a gene of interest is introduced in the locus. Following homologous recombination, the gene of interest is placed under the control of the promoter and regulatory sequences of the target gene, and is therefore expressed in place of the target gene. cdna: complementary deoxyribonucleic acid (DNA); : termination codon. hprt Point mutation floxed selection cassette (a) hprt Selection for the integration of hprt minigene (c) hprt (b) Point mutation Secondary targeting vector Selection for the loss of hprt minigene Mutated allele without selection cassette (d) Cre Figure 5 Subtle mutations. The persistence in a modified allele of a selection cassette with its own promoter and regulatory sequences may affect the target locus and surrounding loci. Creation of subtle mutations (point mutations, small deletions and insertions, etc.) therefore requires elimination of the selection cassette. The two strategies that may be used to create this type of modification are shown. Left: the double replacement strategy. This approach requires the use of embryonic stem cells (ES) bearing a null mutation in the endogenous hprt gene. The first step (a) consists of introducing a cassette expressing the hprt gene in the target gene. The recombinant cells (hprtþ) are selected in the presence of hypoxanthine, aminopterin, thymidine (HAT). Homologous recombinants are identified using Southern blot. In the second step (b), targeted ES cells are transfected with a replacement vector presenting a subtle mutation (asterisk) and devoid of a selection cassette. The homologous recombination event results in the loss of the hprt expression cassette. Targeted cells therefore revert to an hprt phenotype, an event selected in the presence of 6-thioguanine (6-TG) (in principle, all the hprt clones could result only from HR). The use of other replacement vectors carrying different modifications permits the rapid creation of several alleles for the same target gene. Right: Use of the Cre loxp system (see Figure 6). In the first step (c), the target gene is modified by a target vector with a subtle mutation and a floxed selection cassette, that is, surrounded by two loxp sites in the same orientation. Then (d) the transient expression of Cre recombinase in the recombinant cells induces deletion of the selection cassette. Apart from the desired subtle modification, only one loxp site of 34 bp persists in the final modified allele. The position of this loxp site is chosen such that it does not interfere with the expression of the target gene (generally in an intron). 5

6 loxp loxp Cre (a) ATAACTTCGTATATCTATACGAAGTTAT TATTGAAGCATATTACATACGATCTTCAATA (b) loxp IoxP sites in the same orientation IoxP sites in opposite orientation One IoxP sites in situ One loxp site carried by a plasmid IoxP sites on two homologous chromosomes Chr4 Gene Y IoxP sites on two different chromosomes Chr1 hp + Chr4 Chr19 rt Cre Cre Cre Cre Cre + + Gene Y Gene Y t (1;19) t (19;1) hp rt (c) Deletion Inversion Insertion Deletion/Duplication Translocation Recombination in cis (d) Recombination in trans Figure 6 The Cre loxp system and its applications. (a) The loxp site (triangle) is a sequence of 34 bp composed of palindromic sequences of 13 bp separated by a sequence of 8 bp. Cre recombinase specifically recognizes this sequence, provokes the cleavage in DNA (vertical arrows) and (b) induces the recombination of DNA between the two loxp sites. This reaction is reversible. Several types of recombination events can be produced depending on whether the two loxp sites are carried by the same DNA molecule (recombination in cis) or by two different DNA molecules (recombination in trans) and depending on the respective orientation of the two loxp sites (the orientation of a loxp is given by the nonpalindromic 8-bp sequence). (c) Recombination in cis. If the two loxp sites have the same orientation, the DNA region situated between these sites is deleted during recombination. This type of configuration is used to create mutations devoid of the selection cassette (see Figure 5), deletions and conditional mutations (see Figure 7). If the orientation of the two loxp sites is opposed, recombination leads to the inversion of the region comprised between the two sites. (d) Recombination in trans. If one loxp site is integrated in the genome and the other is carried by a circular plasmid, there may be an insertion of sequences carried by the plasmid in the integrated loxp site. However, since the insertion is a rare event compared with deletion (i.e. the reverse reaction), this type of event requires the use of mutant loxp sites. When the loxp sites are both integrated in the genome, recombination in trans induces chromosomal rearrangements: deletions, duplications or translocations. Such recombination events are rare and have to be selected to be revealed. To do so, one can use truncated and nonfunctional hp-loxp and loxp-rt selection cassettes. After recombination between the loxp sites, and only in this case, a functional hp-loxp-rt cassette (the remaining loxp site is situated in an intron) is reconstituted, thus allowing selection of the chromosomal rearrangement desired (see legend to Figure 5). Furthermore, the relative orientation of loxp sites compared with the centromeric telomeric axis of the chromosomes is important. Indeed, in the case of wrong relative orientation, recombination will result in the formation of acentric or dicentric chromosomes, which, in view of their great instability, will be eliminated and induce cell death. Creating those types of chromosomal rearrangements in the mouse is therefore a very valuable tool to dissect the molecular mechanisms underlying the defects they induce. Furthermore, large deletions could generate segmental haploidy in the diploid mouse genome, facilitating the detection of recessive mutations in the deleted regions (reviewed by Yu and Bradley, 2001). The Cre loxp system and conditional mutagenesis As emphasized in the previous section, the generation of KO mice is extremely important in the study of gene function. However, this approach has some limitations: first, a mutation that induces lethality at a given stage of development precludes the study of gene function later in development; second, when a gene has a complex pattern of expression, namely in several cell types or tissues, analysis of its function, based on the effects of a mutation present in all the cells of the organism, might become extremely difficult. To overcome these problems, strategies have been developed that are based on the Cre loxp system (Figure 7; reviewed by Sauer, 1998). Two requirements need to be fulfilled for conditional targeting with the Cre loxp system: (a) a floxed allele must be created in such a way that two loxp sites flank an essential region of the gene, without altering its normal activity; (b) targeting of Cre expression must be tightly controlled: to 6

7 Step neo A B cre Step neo Floxed allele P neuron Cre 1/3 1/2 3 neo Type I : deleted allele Type III 1 2/3 Deleted allele Neurons A/B Floxed allele Other cell types (a) Type II : floxed allele (b) Figure 7 Conditional gene targeting. (a) Creation of a floxed allele for conditional gene targeting. Step 1: the targeting construct contains three lox P sites in the same orientation, sites 1 and 2 flanking an essential region of the target gene (here an exon), and sites 2 and 3 flanking the neo selection cassette. Step 2: transient expression of the Cre recombinase in the targeted cell results in three types of alleles: (1) type I contains the deletion, the phenotype of which can be assessed in vivo after transferring the mutation back into the animal; (2) type II corresponds to the floxed allele. In vivo deletion can be obtained by crossing mice carrying this allele with Cre-expressing transgenic mice; shown is a scenario that results in the disruption of the floxed gene, specifically in neurons; (3) the third allele can also be recovered but usually has no applications. (b) Conditional gene targeting is obtained by crossing two transgenic mice. The first one (mouse A) carries two floxed alleles of a given gene (type II, see (a)) and exhibits no phenotype (only one allele is shown). The second one (mouse B) is a transgenic mouse for a hybrid transgene corresponding to the Cre recombinase coding sequence under the control of the cis-acting regulatory elements of a tissue-specific promoter (here a neuron-specific gene, P neuron ). In the progeny, only neurons express the Cre recombinase and consequently harbor deleted (type I, see (a)) allele; all other cells retain the active floxed allele. Consequences of the absence of the target gene in neurons can therefore be assessed. Function of the target gene in other cell types could be addressed by crossing the first mouse with another transgenic mouse expressing the Cre under the control of an appropriate promoter. that end, either transgenic mice by pronuclear microinjection or, better, knockin mice may be used. This scenario allows spatial control of the occurrence of a mutation and therefore insight into the function of a gene in a particular cell type or tissue. It has also proved to be instrumental in the creation of animal models of human disease. For example, transgenic mice were created in which disruption of the tumor suppressor gene Brca1 was specifically induced in the epithelial cells of the mammary gland, therefore furnishing a model for the study of BRCA1 (breast cancer 1, early onset) in breast cancer (Xu et al., 1999). This could not have been possible without the use of a conditional approach, since homozygous null mutations in this gene result in embryonic lethality. A further refinement of the floxed gene approach relies on the production of fusion protein containing Cre and the ligand-binding domain (LBD) of a steroid receptor. In such chimeric proteins, the activity of Cre becomes hormone-dependent. Therefore, recombination between loxp sites could be induced in cells expressing the chimeric Cre by injection of the appropriate ligand into mice carrying floxed alleles and a fusion transgene expressing the Cre LBD fusion protein. In this way, the occurrence of a mutation can be controlled, not only in a spatial but also in a temporal way (reviewed by Metzger and Feil, 1999). Conclusion There has been extraordinary development and refinement of the approaches allowing germ-line modification in the mouse. Indeed, almost any genetic alterations (null and point mutations, as well as chromosome rearrangements) may be introduced precisely and deliberately into the mouse genome. More recently, new approaches have been devised that allow control of the occurrence of a particular genome alteration, both spatially and temporally. No doubt the sophistication of the strategies of genomic engineering will increase in the next years, further establishing the mouse as a unique model for the study of mammalian development, physiology and physiopathology. See also Cre lox Inducible Gene Targeting Mouse Genetics as a Research Tool Mouse as a Model for Human Diseases References Barron RM, Thomson V, Jamieson E, et al. (2001) Changing a single amino acid in the N-terminus of murine PrP alters TSE 7

8 incubation time across three species barriers. EMBO Journal 20: Capecchi MR (1989) Altering the genome by homologous recombination. Science 244: Giraldo P and Montoliu L (2001) Size matters: use of YACs, BACs and PACs in transgenic animals. Transgenic Research 10: Grosveld F (1999) Activation by locus control regions? Current Opinion in Genetics and Development 9: Hammer RE, Swift GH, Ornitz DM, et al. (1987) The rat elastase I regulatory element is an enhancer that directs correct cells specificity and developmental onset of expression in transgenic mice. Molecular and Cellular Biology 7: Macdonald RJ and Swift GH (1998) Analysis of transcriptional regulatory regions in vivo. International Journal of Developmental Biology 42: Metzger D and Feil R (1999) Engineering the mouse genome by sitespecific recombination. Current Opinion in Biotechnology 10: Sauer B (1998) Inducible gene targeting in mice using the Cre/lox system. Methods 14: Wang Y, Spatz MK, Kannan K, et al. (1999) A mouse model for achondroplasia produced by targeting fibroblast growth factor receptor 3. Proceedings of the National Academy of Sciences of the United States of America 96: Wilson C, Bellen HJ and Gehring WJ (1990) Position effects on eukaryotic gene expression. Annual Review of Cell Biology 6: Xu X, Wagner R-U, Larson D, et al. (1999) Conditional mutation of Brca1 in mammary epithelial cells results in blunted ductal morphogenesis and tumor formation. Nature Genetics 22: Yu Y and Bradley A (2001) Engineering chromosomal rearrangements in mice. Nature Reviews. Genetics 2: Further Reading Cid-Arregui A and Garcia-Carranca A (1998) Microinjection and Transgenesis Strategies and Protocols. New York, NY: Springer-Verlag. Cohen-Tannoudji M and Babinet C (1998) Beyond Knock-out mice: new perspectives for the programmed modification of the mammalian genome. Human Molecular Reproduction 4: Houdebine L-M (1997) Transgenic Animals Generation and Use. Harwood Academic Publishers. Leighton PA, Mitchell KJ, Goodrich LV, et al. (2001) Defining brain wiring patterns and mechanisms through gene trapping in mice. Nature 410: Lewandoski M (2001) Conditional control of gene expression in the mouse. Nature Reviews Genetics 2: Robertson EJ (1987) Teratocarcinomas and Embryonic Stem Cells: A Practical Approach. Washington, DC: IRL Press. Rodriguez CI, Buchholz F, Galloway J, et al. (2000) High-efficiency deleter mice show that FLPe is an alternative to Cre-loxP. Nature Genetics 25: Special issue (1998) Stem cells and transgenesis. International Journal of Developmental Biology 42. Stanford WL, Cohn JB and Cordes SP (2001) Gene-trap mutagenesis: past, present and beyond. Nature Reviews. Genetics 2: Web Links Nagy Lab. Cre-expressing mice. Samuel Lenenfeld Research Institute, Mount Sinai TBASE (The Transgenic/Targeted Mutation Database). Knockout mice. The Jackson Laboratory 8