WiscDsLox485 ATG < > //----- E1 E2 E3 E4 E bp. Col-0 arr7 ARR7 ACTIN7. s of mrna/ng total RNA (x10 3 ) ARR7.
|
|
|
- Gyles Williamson
- 6 years ago
- Views:
Transcription
1 A WiscDsLox8 ATG < > > //----- E E E E E UTR +9 UTR +0 > 00bp B S D ol-0 arr7 ol-0 arr7 ARR7 ATIN7 D s of mrna/ng total RNA opie 0. ol-0 (x0 ) arr7 ARR7 Supplemental Fig.. Genotyping and RT-PR analysis of arr7 Arabidopsis mutants compared with the wild-type. A, Location of Ds transposon insertion of ARR7 in Arabidopsis. Ds insertion is indicated by triangle. ARR7 is composed of five exons (E) and four introns indicated by a grey line. Untranslated region (UTR) is indicated by thick solid line. Thin solid arrows and thick solid arrows indicate the locations of the primers for the PR of genomic ARR7 DNA. Dotted arrows indicate the locations of the primers for RT-PR of the ARR7 mrna. Numbers indicate the position of the first nucleotide of the primer relative to the AUG initiation codon. arr7: WiscDsLox8-88B ( B, PR analysis of Ds transposon insertion mutants. Genomic DNA isolated was subjected to PR with primers indicated in thick or thin arrows. S or D, PR products amplified by specific primers (S, thin arrows) or Ds transposon primers (D, thick arrows). WT, wild-type ol-0., RT-PR analysis of Ds transposon insertion mutants. Total RNA isolated from 7-day-old light-grown seedlings was subjected to RT-PR with the primers indicated in dotted arrows. The ATIN7 mrna was utilized as a loading control. D, Real-time RT-PR analysis of the ARR7 mrna levels in Ds transposon insertion mutants compared with the wild-type. opies of the transcripts from 7-day-old light-grown seedlings were plotted per ng total RNA after normalization to ATIN7 RNA. Multiplication of the number in the brackets inside the graph by the number in the y-axis generates copy numbers of the corresponding transcripts. Mean values and standard errors from biological i l triplicate experiments were plotted. Numbers on top of the bars idi indicate relative expression levels.
2 7 (x0 ) ARR7 0 / / / 8 (h) opies of mrna/ng tota al RNA RD9A (x0 ) 0 / / / 8 (h) RD9B (x0 ) 0 / / / 8 (h) Supplemental Fig.. Quantitative analysis of ARR7 expression in response to high salinity. Eleven-day-old seedlings were incubated with 00 mm Nal in darkness for varying periods of time (h),analyzed, and shown as described inthe Fig. legend.
3 B A D E F G Supplemental Fig.. Tissue expression pattern of Pro ARR7 :GUS transgenics. A-G, Tissue expression pattern of Pro ARR7 :GUS in flower (A), shoot meristem (B), root meristem (), rosette leaf (D and E), silique (F), and root (G).
4 /ng total RNA opies of mrna/ 0 8 (x0 ) BF (-BA) BF (+BA) ARR7 (-BA) ARR7 (+BA) 0 / / / 8 (h) Supplemental Fig.. Quantitative analysis of BF expression in response to cytokinin. Elevenday-old seedlings were incubated with cytokinin BA for varying periods of time (h), analyzed, and shown as described in the Fig. legend. ARR7 expression was monitored to verify the cytokinin response.
5 A opie es of mrna/ng total RNA AHK (x0 ) 0 / / / 8 (h) B opies of mrna/n ng total RNA 8 AHK (x0 ) 0 / / / 8 (h) opie es of mrna/ng total RNA AHK (x0 ) 0 / / / 8 (h) Supplemental Fig.. Analysis of AHK, AHK, andahk expression in response to cold. Elevenday-old wild-type (ol-0) seedlings were incubated at ºfor varying periods of time (h). Total RNA isolated from each treatment was subjected to quantitative real-time RT-PR with the primers for AHK (A), AHK (B), and AHK (). ATIN7 was utilized as a loading control. opies of the transcripts from cold-treated plants treated with cold were plotted per ng of total RNA after normalization to ATIN7 RNA. The transcripts levels were determined as described in the Fig. legend.
6 A ol-0 B LhGR-N(c-S) DEX pv-ipt/lhgr-n(ipt-) p (p D pv-ipt/lhgr-n(ipt-) p (p DEX d -d Supplemental Fig.. Phenotype and GUS expression of pv-ipt/lhgr-n transgenic plants. A, ol-0 wild-type plants treated with or without DEX. Plants were grown for days without or with 0 µm DEX. B, LhGR-N transgenic plants treated with or without DEX. Transgenic plants that contain activator construct expressing LhGR from the amv S promoter (9) were grown for days without or with 0 µm DEX. c-s idi indicates the line number of transgenic plants. GR idi indicates ligand binding domain of a rat glucocorticoid receptor at the amino terminus. Details on the constructs have been described previously (9)., pv-ipt/lhgr-n transgenic plants treated with or without DEX. Transgenic plants that contain activator construct expressing LhGR and construct harboring IPT encoding isopentenyl transferase enzyme and GUS under six copies of ideal lac operator (9) were grown for days without or with 0 µm DEX. The treatment of DEX can lead to activation of IPT for cytokinin biosynthesis and GUS. ipt- indicates the line number of transgenic plants. D, GUS staining of pv-ipt/lhgr-n transgenic plants treated with or without DEX. pv-ipt/lhgr-n transgenic plants were grown for 0 days and then treated without or with DEX for days or days, followed by GUS staining.
7 pv-ipt/lhgr-n(ipt-) DEX - + -d -d -d Supplemental Fig. 7. The pv-ipt/lhgr-n transgenic plants treated with DEX. The transgenic plants were grown in the light on sterile filter paper in MS plate for 0 days and transferred to MS plate with or without 0 μm DEX. Plants were then incubated for additional,, or days in the light. Pictures were taken before cold treatment at º.
8 A opies of mrna A/ng total RNA 0 AHK (x0 ) B Pro S :ARR7 mrna/ng total RNA opies of 7 0 AHK (x0 ) Pro S :ARR7 Supplemental Fig. 8. Analysis of AHK and AHK expression in arr,, or 7 mutants and Pro S :ARR7. Total RNA isolated from eleven-day-old wild-type (ol-0) seedlings were subjected to quantitative real-time RT-PR with the primers for AHK (A) andahk (B). ATIN7 was utilized as a loading control. opies of the transcripts from cold-treated plants treated with cold were plotted per ng of total RNA after normalization to ATIN7 RNA. The transcripts levels were determined as described in the Fig. legend.
Supplemental Data. Lee et al. Plant Cell. (2010) /tpc Supplemental Figure 1. Protein and Gene Structures of DWA1 and DWA2.
Supplemental Figure 1. Protein and Gene Structures of DWA1 and DWA2. (A) Protein structures of DWA1 and DWA2. WD40 region was determined based on the NCBI conserved domain databases (B, C) Schematic representation
Construction of plant complementation vector and generation of transgenic plants
MATERIAL S AND METHODS Plant materials and growth conditions Arabidopsis ecotype Columbia (Col0) was used for this study. SALK_072009, SALK_076309, and SALK_027645 were obtained from the Arabidopsis Biological
A subclass of HSP70s regulate development and abiotic stress responses in Arabidopsis thaliana
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 Journal of Plant Research A subclass of HSP70s regulate development and abiotic stress responses in Arabidopsis thaliana Linna Leng 1 Qianqian Liang
Supplemental Data. Steiner et al. Plant Cell. (2012) /tpc
Supplemental Figure 1. SPY does not interact with free GST. Invitro pull-down assay using E. coli-expressed MBP-SPY and GST, GST-TCP14 and GST-TCP15. MBP-SPY was used as bait and incubated with equal amount
Supplemental Data. Wu et al. (2). Plant Cell..5/tpc RGLG Hormonal treatment H2O B RGLG µm ABA µm ACC µm GA Time (hours) µm µm MJ µm IA
Supplemental Data. Wu et al. (2). Plant Cell..5/tpc..4. A B Supplemental Figure. Immunoblot analysis verifies the expression of the AD-PP2C and BD-RGLG proteins in the Y2H assay. Total proteins were extracted
Supplementary Figure 1 qrt-pcr expression analysis of NLP8 with and without KNO 3 during germination.
Supplementary Figure 1 qrt-pcr expression analysis of NLP8 with and without KNO 3 during germination. Seeds of Col-0 were harvested from plants grown at 16 C, stored for 2 months, imbibed for indicated
SUPPLEMENTARY INFORMATION
Local auxin metabolism regulates environment-induced hypocotyl elongation Zuyu Zheng 1,2, Yongxia Guo 3, Ondřej Novák 4,5, William Chen 2, Karin Ljung 4, Joseph P. Noel 1,3, *, and Joanne Chory 1,2, *
MODULE 1: INTRODUCTION TO THE GENOME BROWSER: WHAT IS A GENE?
MODULE 1: INTRODUCTION TO THE GENOME BROWSER: WHAT IS A GENE? Lesson Plan: Title Introduction to the Genome Browser: what is a gene? JOYCE STAMM Objectives Demonstrate basic skills in using the UCSC Genome
Supplemental Data. mir156-regulated SPL Transcription. Factors Define an Endogenous Flowering. Pathway in Arabidopsis thaliana
Cell, Volume 138 Supplemental Data mir156-regulated SPL Transcription Factors Define an Endogenous Flowering Pathway in Arabidopsis thaliana Jia-Wei Wang, Benjamin Czech, and Detlef Weigel Table S1. Interaction
Jung-Nam Cho, Jee-Youn Ryu, Young-Min Jeong, Jihye Park, Ji-Joon Song, Richard M. Amasino, Bosl Noh, and Yoo-Sun Noh
Developmental Cell, Volume 22 Supplemental Information Control of Seed Germination by Light-Induced Histone Arginine Demethylation Activity Jung-Nam Cho, Jee-Youn Ryu, Young-Min Jeong, Jihye Park, Ji-Joon
Student Learning Outcomes (SLOS)
Student Learning Outcomes (SLOS) KNOWLEDGE AND LEARNING SKILLS USE OF KNOWLEDGE AND LEARNING SKILLS - how to use Annhyb to save and manage sequences - how to use BLAST to compare sequences - how to get
Supplemental Data Supplemental Figure 1.
Supplemental Data Supplemental Figure 1. Silique arrangement in the wild-type, jhs, and complemented lines. Wild-type (WT) (A), the jhs1 mutant (B,C), and the jhs1 mutant complemented with JHS1 (Com) (D)
PrimePCR Assay Validation Report
Gene Information Gene Name transforming growth factor, beta 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID TGFB1 Human This gene encodes a member of the
PrimePCR Assay Validation Report
Gene Information Gene Name SRY (sex determining region Y)-box 6 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID SOX6 Human This gene encodes a member of the
Supplemental Information
Supplemental Information Itemized List Materials and Methods, Related to Supplemental Figures S5A-C and S6. Supplemental Figure S1, Related to Figures 1 and 2. Supplemental Figure S2, Related to Figure
MIT Department of Biology 7.013: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr.
MIT Department of Biology 7.01: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr. Claudette Gardel iv) Would Xba I be useful for cloning? Why or why not?
Lecture 3 Mutagens and Mutagenesis. 1. Mutagens A. Physical and Chemical mutagens B. Transposons and retrotransposons C. T-DNA
Lecture 3 Mutagens and Mutagenesis 1. Mutagens A. Physical and Chemical mutagens B. Transposons and retrotransposons C. T-DNA 2. Mutagenesis A. Screen B. Selection C. Lethal mutations Read: 508-514 Figs:
PrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin)
PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein
PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein This is also known as: The central dogma of molecular biology Protein Proteins are made
Alternative Cleavage and Polyadenylation of RNA
Developmental Cell 18 Supplemental Information The Spen Family Protein FPA Controls Alternative Cleavage and Polyadenylation of RNA Csaba Hornyik, Lionel C. Terzi, and Gordon G. Simpson Figure S1, related
Supplementary Methods
Supplementary Methods Reverse transcribed Quantitative PCR. Total RNA was isolated from bone marrow derived macrophages using RNeasy Mini Kit (Qiagen), DNase-treated (Promega RQ1), and reverse transcribed
PrimePCR Assay Validation Report
Gene Information Gene Name collagen, type IV, alpha 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID COL4A1 Human This gene encodes the major type IV alpha
Problem Set 8. Answer Key
MCB 102 University of California, Berkeley August 11, 2009 Isabelle Philipp Online Document Problem Set 8 Answer Key 1. The Genetic Code (a) Are all amino acids encoded by the same number of codons? no
Activation of a Floral Homeotic Gene in Arabidopsis
Activation of a Floral Homeotic Gene in Arabidopsis By Maximiliam A. Busch, Kirsten Bomblies, and Detlef Weigel Presentation by Lis Garrett and Andrea Stevenson http://ucsdnews.ucsd.edu/archive/graphics/images/image5.jpg
TIGR THE INSTITUTE FOR GENOMIC RESEARCH
Introduction to Genome Annotation: Overview of What You Will Learn This Week C. Robin Buell May 21, 2007 Types of Annotation Structural Annotation: Defining genes, boundaries, sequence motifs e.g. ORF,
MCDB 1041 Class 21 Splicing and Gene Expression
MCDB 1041 Class 21 Splicing and Gene Expression Learning Goals Describe the role of introns and exons Interpret the possible outcomes of alternative splicing Relate the generation of protein from DNA to
GTTCGGGTTCC TTTTGAGCAG
Supplementary Figures Splice variants of the SIP1 transcripts play a role in nodule organogenesis in Lotus japonicus. Wang C, Zhu H, Jin L, Chen T, Wang L, Kang H, Hong Z, Zhang Z. 5 UTR CDS 3 UTR TCTCAACCATCCTTTGTCTGCTTCCGCCGCATGGGTGAGGTCATTTTGTCTAGATGACGTGCAATTTACAATGA
7.014 Quiz II Handout
7.014 Quiz II Handout Quiz II: Wednesday, March 17 12:05-12:55 54-100 **This will be a closed book exam** Quiz Review Session: Friday, March 12 7:00-9:00 pm room 54-100 Open Tutoring Session: Tuesday,
Problem Set 4
7.016- Problem Set 4 Question 1 Arginine biosynthesis is an example of multi-step biochemical pathway where each step is catalyzed by a specific enzyme (E1, E2 and E3) as is outlined below. E1 E2 E3 A
sides of the aleurone (Al) but it is excluded from the basal endosperm transfer layer
Supplemental Data. Gómez et al. (2009). The maize transcription factor MRP-1 (Myb-Related-Protein-1) is a key regulator of the differentiation of transfer cells. Supplemental Figure 1. Expression analyses
Supporting Information
Supporting Information Yuan et al. 10.1073/pnas.0906869106 Fig. S1. Heat map showing that Populus ICS is coregulated with orthologs of Arabidopsis genes involved in PhQ biosynthesis and PSI function, but
Figure S1. Characterization of the irx9l-1 mutant. (A) Diagram of the Arabidopsis IRX9L gene drawn based on information from TAIR (the Arabidopsis
1 2 3 4 5 6 7 8 9 10 11 12 Figure S1. Characterization of the irx9l-1 mutant. (A) Diagram of the Arabidopsis IRX9L gene drawn based on information from TAIR (the Arabidopsis Information Research). Exons
BIO 311C Spring Lecture 36 Wednesday 28 Apr.
BIO 311C Spring 2010 1 Lecture 36 Wednesday 28 Apr. Synthesis of a Polypeptide Chain 5 direction of ribosome movement along the mrna 3 ribosome mrna NH 2 polypeptide chain direction of mrna movement through
Understanding Genes & Mutations. John A Phillips III May 16, 2005
Understanding Genes & Mutations John A Phillips III May 16, 2005 Learning Objectives Understand gene structure Become familiar with genetic & mutation databases Be able to find information on genetic variation
Biotechnology Explorer
Biotechnology Explorer C. elegans Behavior Kit Bioinformatics Supplement explorer.bio-rad.com Catalog #166-5120EDU This kit contains temperature-sensitive reagents. Open immediately and see individual
Protein Synthesis & Gene Expression
DNA provides the instructions for how to build proteins Each gene dictates how to build a single protein in prokaryotes The sequence of nucleotides (AGCT) in DNA dictates the order of amino acids that
Chemical hijacking of auxin signaling with an engineered auxin-tir1
1 SUPPLEMENTARY INFORMATION Chemical hijacking of auxin signaling with an engineered auxin-tir1 pair Naoyuki Uchida 1,2*, Koji Takahashi 2*, Rie Iwasaki 1, Ryotaro Yamada 2, Masahiko Yoshimura 2, Takaho
Activation of a Floral Homeotic Gene in Arabidopsis
Activation of a Floral Homeotic Gene in Arabidopsis Busch, M.A., Bomblies, K., Weigel, D. kuleuven-kortrijk.be Simon Olthof Louie Christodoulidis 1 In Arabidopsis flowers, appearance is based, in part,
Section 10.3 Outline 10.3 How Is the Base Sequence of a Messenger RNA Molecule Translated into Protein?
Section 10.3 Outline 10.3 How Is the Base Sequence of a Messenger RNA Molecule Translated into Protein? Messenger RNA Carries Information for Protein Synthesis from the DNA to Ribosomes Ribosomes Consist
Unit 6: Molecular Genetics & DNA Technology Guided Reading Questions (100 pts total)
Name: AP Biology Biology, Campbell and Reece, 7th Edition Adapted from chapter reading guides originally created by Lynn Miriello Chapter 16 The Molecular Basis of Inheritance Unit 6: Molecular Genetics
Solutions to Quiz II
MIT Department of Biology 7.014 Introductory Biology, Spring 2005 Solutions to 7.014 Quiz II Class Average = 79 Median = 82 Grade Range % A 90-100 27 B 75-89 37 C 59 74 25 D 41 58 7 F 0 40 2 Question 1
Trasposable elements: Uses of P elements Problem set B at the end
Trasposable elements: Uses of P elements Problem set B at the end P-elements have revolutionized the way Drosophila geneticists conduct their research. Here, we will discuss just a few of the approaches
Lecture for Wednesday. Dr. Prince BIOL 1408
Lecture for Wednesday Dr. Prince BIOL 1408 THE FLOW OF GENETIC INFORMATION FROM DNA TO RNA TO PROTEIN Copyright 2009 Pearson Education, Inc. Genes are expressed as proteins A gene is a segment of DNA that
Supplementary information, Figure S1
Supplementary information, Figure S1 (A) Schematic diagram of the sgrna and hspcas9 expression cassettes in a single binary vector designed for Agrobacterium-mediated stable transformation of Arabidopsis
Supplemental Data. Aung et al. (2011). Plant Cell /tpc
35S pro:pmd1-yfp 10 µm Supplemental Figure 1. -terminal YFP fusion of PMD1 (PMD1-YFP, in green) is localized to the cytosol. grobacterium cells harboring 35S pro :PMD1-YFP were infiltrated into tobacco
CRISPR/Cas9 Genome Editing: Transfection Methods
CRISPR/ Genome Editing: Transfection Methods For over 20 years Mirus Bio has developed and manufactured high performance transfection products and technologies. That expertise is now being applied to the
Microbial Genetics. Chapter 8
Microbial Genetics Chapter 8 Structure and Function of Genetic Material Genome A cell s genetic information Chromosome Structures containing DNA that physically carry hereditary information Gene Segments
Supplementary Figure 1. BES1 specifically inhibits ABA responses in early seedling
Supplementary Figure 1. BES1 specifically inhibits ABA responses in early seedling development. a. Exogenous BR application overcomes the hypersensitivity of bzr1-1d seedlings to ABA. Seed germination
Reading Lecture 8: Lecture 9: Lecture 8. DNA Libraries. Definition Types Construction
Lecture 8 Reading Lecture 8: 96-110 Lecture 9: 111-120 DNA Libraries Definition Types Construction 142 DNA Libraries A DNA library is a collection of clones of genomic fragments or cdnas from a certain
2. In Figure 10-4, why is edna made only from mrna and not also from trnas and ribosomal RNAs?
2. In Figure 10-4, why is edna made only from mrna and not also from trnas and ribosomal RNAs? Answer: edna is made from mrna and not from trnas or rrnas because polyt primers are used to prime the first
Confirming the Phenotypes of E. coli Strains
Confirming the Phenotypes of E. coli Strains INTRODUCTION Before undertaking any experiments, we need to confirm that the phenotypes of the E. coli strains we intend to use in the planned experiments correspond
You use the UCSC Genome Browser (www.genome.ucsc.edu) to assess the exonintron structure of each gene. You use four tracks to show each gene:
CRISPR-Cas9 genome editing Part 1: You would like to rapidly generate two different knockout mice using CRISPR-Cas9. The genes to be knocked out are Pcsk9 and Apoc3, both involved in lipid metabolism.
Supplemental Information. Boundary Formation through a Direct. Threshold-Based Readout. of Mobile Small RNA Gradients
Developmental Cell, Volume 43 Supplemental Information Boundary Formation through a Direct Threshold-Based Readout of Mobile Small RNA Gradients Damianos S. Skopelitis, Anna H. Benkovics, Aman Y. Husbands,
PrimePCR Assay Validation Report
Gene Information Gene Name laminin, beta 3 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID LAMB3 Human The product encoded by this gene is a laminin that
BA, BSc, and MSc Degree Examinations
Examination Candidate Number: Desk Number: BA, BSc, and MSc Degree Examinations 2017-8 Department : BIOLOGY Title of Exam: Genetics Time Allowed: 1 hour and 30 minutes Marking Scheme: Total marks available
Gene mutation and DNA polymorphism
Gene mutation and DNA polymorphism Outline of this chapter Gene Mutation DNA Polymorphism Gene Mutation Definition Major Types Definition A gene mutation is a change in the nucleotide sequence that composes
Gene Regulation in Eukaryotes. Dr. Syahril Abdullah Medical Genetics Laboratory
Gene Regulation in Eukaryotes Dr. Syahril Abdullah Medical Genetics Laboratory syahril@medic.upm.edu.my Lecture Outline 1. The Genome 2. Overview of Gene Control 3. Cellular Differentiation in Higher Eukaryotes
Type-B ARABIDOPSIS RESPONSE REGULATORs Specify the. Shoot Stem Cell Niche by Dual Regulation of WUSCHEL
Plant Cell Advance Publication. Published on June 2, 2017, doi:10.1105/tpc.16.00640 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 RESEARCH ARTICLE
Using mutants to clone genes
Using mutants to clone genes Objectives 1. What is positional cloning? 2. What is insertional tagging? 3. How can one confirm that the gene cloned is the same one that is mutated to give the phenotype
Fig. A1 Characteristics of HepP and its homology to other proteins. Fig. A2 Amino acid sequence of the 78-kDa predicted protein encoded by zbdp
Additional file 1 This file contains: Fig. A1 Characteristics of HepP and its homology to other proteins Fig. A2 Amino acid sequence of the 78-kDa predicted protein encoded by zbdp Fig. A3 Nucleotide sequences
Chapter 12. DNA TRANSCRIPTION and TRANSLATION
Chapter 12 DNA TRANSCRIPTION and TRANSLATION 12-3 RNA and Protein Synthesis WARM UP What are proteins? Where do they come from? From DNA to RNA to Protein DNA in our cells carry the instructions for making
Supplemental Data. Polycomb Silencing of KNOX Genes Confines. Shoot Stem Cell Niches in Arabidopsis Current Biology, Volume 18
Supplemental Data Polycomb Silencing of KNOX Genes Confines Shoot Stem Cell Niches in Arabidopsis Lin Xu and Wen-Hui Shen - 1 - Figure S1. Phylogram of RING1, BMI1 and RAD18 homologues in several organisms
Supplementary Information. Supplementary Figure S1. Phenotypic comparison of the wild type and mutants.
Supplementary Information Supplementary Figure S1. Phenotypic comparison of the wild type and mutants. Supplementary Figure S2. Transverse sections of anthers. Supplementary Figure S3. DAPI staining and
10 MYB96. Relative expression. Epidermis. Stem
Supplemental Data. Seo et al. ()../tpc..88 Supplemental Figures Relative expression MYB96 8 6 Stem Epidermis Supplemental Figure. Expression of MYB96 in epidermal cells of stems Arabidopsis plants were
KEY CONCEPT DNA was identified as the genetic material through a series of experiments. Found live S with R bacteria and injected
Section 1: Identifying DNA as the Genetic Material KEY CONCEPT DNA was identified as the genetic material through a series of experiments. VOCABULARY bacteriophage MAIN IDEA: Griffith finds a transforming
Transcription Eukaryotic Cells
Transcription Eukaryotic Cells Packet #20 1 Introduction Transcription is the process in which genetic information, stored in a strand of DNA (gene), is copied into a strand of RNA. Protein-encoding genes
Human TNF qpcr primer pair
Shipping and Storage information Catalog No. Amount Reaction number of 25-μl volume Shipping and Storage Package tube 2 nmol 200 lyophilized powder 1 Information of the target gene and primers Species
Eukaryotic Gene Structure
Eukaryotic Gene Structure Terminology Genome entire genetic material of an individual Transcriptome set of transcribed sequences Proteome set of proteins encoded by the genome 2 Gene Basic physical and
MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question.
Ch 17 Practice Questions MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. 1) Garrod hypothesized that "inborn errors of metabolism" such as alkaptonuria
Zool 3200: Cell Biology Exam 2 2/20/15
Name: TRASK Zool 3200: Cell Biology Exam 2 2/20/15 Answer each of the following short and longer answer questions in the space provided; circle the BEST answer or answers for each multiple choice question
The Genetic Code and Transcription. Chapter 12 Honors Genetics Ms. Susan Chabot
The Genetic Code and Transcription Chapter 12 Honors Genetics Ms. Susan Chabot TRANSCRIPTION Copy SAME language DNA to RNA Nucleic Acid to Nucleic Acid TRANSLATION Copy DIFFERENT language RNA to Amino
Prokaryotic Transcription
Prokaryotic Transcription Transcription Basics DNA is the genetic material Nucleic acid Capable of self-replication and synthesis of RNA RNA is the middle man Nucleic acid Structure and base sequence are
Figure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab.
/ 36B4 mrna ratio Figure S1 * 2. 1.6 1.2.8 *.4 control TNFα BRL49653 Figure S2 Su bw AT p iw Anti- (COOH-terminal peptide) Ab Blot : Anti-GST-(45-127) Ab β-actin Figure S3 HB2 HW AT BA T Figure S4 A TAG
The OSU1/QUA2/TSD2-Encoded Putative Methyltransferase Is a Critical Modulator of Carbon and Nitrogen Nutrient Balance Response in Arabidopsis
The OSU1/QUA2/TSD2-Encoded Putative Methyltransferase Is a Critical Modulator of Carbon and Nitrogen Nutrient Balance Response in Arabidopsis Peng Gao 1., Zeyu Xin 1., Zhi-Liang Zheng 1,2 * 1 Department
Self-test Quiz for Chapter 12 (From DNA to Protein: Genotype to Phenotype)
Self-test Quiz for Chapter 12 (From DNA to Protein: Genotype to Phenotype) Question#1: One-Gene, One-Polypeptide The figure below shows the results of feeding trials with one auxotroph strain of Neurospora
M I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION
M I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION Chapter 7 Microbial Genetics Lecture prepared by Mindy Miller-Kittrell, University of Tennessee, Knoxville The Structure and Replication
Transcription in Eukaryotes
Transcription in Eukaryotes Biology I Hayder A Giha Transcription Transcription is a DNA-directed synthesis of RNA, which is the first step in gene expression. Gene expression, is transformation of the
ASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG
Supplemental Materials and Methods Plasmids: the following plasmids were used in the supplementary data: pwzl-myc- Lats2 (Aylon et al, 2006), pretrosuper-vector and pretrosuper-shp53 (generous gift of
Plant Cell, Tissue and Organ Culture
Supplementary materials for Plant Cell, Tissue and Organ Culture Article tile: Agrobacterium mediated Genetic Transformation of Miscanthus sinensis Authors: Ok-Jin Hwang 1, Mi-Ae Cho 1, Yun-Jeong Han 1,
Genes found in the genome include protein-coding genes and non-coding RNA genes. Which nucleotide is not normally found in non-coding RNA genes?
Midterm Q Genes found in the genome include protein-coding genes and non-coding RNA genes Which nucleotide is not normally found in non-coding RNA genes? G T 3 A 4 C 5 U 00% Midterm Q Which of the following
Multiple choice questions (numbers in brackets indicate the number of correct answers)
1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer
Candidate region (0.74 Mb) ATC TCT GGG ACT CAT GAG CAG GAG GCT AGC ATC TCT GGG ACT CAT TAG CAG GAG GCT AGC
A idm-3 idm-3 B Physical distance (Mb) 4.6 4.86.6 8.4 C Chr.3 Recom. Rate (%) ATG 3.9.9.9 9.74 Candidate region (.74 Mb) n=4 TAA D idm-3 G3T(E4) G4A(W988) WT idm-3 ATC TCT GGG ACT CAT GAG CAG GAG GCT AGC
Genomic region (ENCODE) Gene definitions
DNA From genes to proteins Bioinformatics Methods RNA PROMOTER ELEMENTS TRANSCRIPTION Iosif Vaisman mrna SPLICE SITES SPLICING Email: ivaisman@gmu.edu START CODON STOP CODON TRANSLATION PROTEIN From genes
Welcome to Genome 371!
Genome 371, 4 Jan 2010, Lecture 1 Welcome to Genome 371! If you are not registered - please don t take a seat! (class is full) - see Anne Paul (outside) to get on the wait list If you are registered and
Functional Genomics Research Stream. Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update
Functional Genomics Research Stream Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update Updates Alternate Lab Meeting Fridays 11:30-1:00 WEL 4.224 Welcome to attend either one Lab Log thanks
Transcriptional Regulation of Pro-apoptotic Protein Kinase C-delta: Implications for Oxidative Stress-induced Neuronal Cell Death
SUPPLEMENTAL DATA Transcriptional Regulation of Pro-apoptotic Protein Kinase C-delta: Implications for Oxidative Stress-induced Neuronal Cell Death Huajun Jin 1, Arthi Kanthasamy 1, Vellareddy Anantharam
BIOL 300 Foundations of Biology Summer 2017 Telleen Lecture Outline
BIOL 300 Foundations of Biology Summer 2017 Telleen Lecture Outline RNA, the Genetic Code, Proteins I. How RNA differs from DNA A. The sugar ribose replaces deoxyribose. The presence of the oxygen on the
Year III Pharm.D Dr. V. Chitra
Year III Pharm.D Dr. V. Chitra 1 Genome entire genetic material of an individual Transcriptome set of transcribed sequences Proteome set of proteins encoded by the genome 2 Only one strand of DNA serves
Basics of Recombinant DNA Technology Biochemistry 302. March 5, 2004 Bob Kelm
Basics of Recombinant DNA Technology Biochemistry 302 March 5, 2004 Bob Kelm Applications of recombinant DNA technology Mapping and identifying genes (DNA cloning) Propagating genes (DNA subcloning) Modifying
Enhancers mutations that make the original mutant phenotype more extreme. Suppressors mutations that make the original mutant phenotype less extreme
Interactomics and Proteomics 1. Interactomics The field of interactomics is concerned with interactions between genes or proteins. They can be genetic interactions, in which two genes are involved in the
Protein Synthesis Honors Biology
Protein Synthesis What do we know? Metabolism is controlled by enzymes enzymes are proteins DNA contains the genetic information to build proteins. DNA is only in the nucleus. Ribosomes are not. How then
SSA Signal Search Analysis II
SSA Signal Search Analysis II SSA other applications - translation In contrast to translation initiation in bacteria, translation initiation in eukaryotes is not guided by a Shine-Dalgarno like motif.
Regulation of enzyme synthesis
Regulation of enzyme synthesis The lac operon is an example of an inducible operon - it is normally off, but when a molecule called an inducer is present, the operon turns on. The trp operon is an example
Genomics and Gene Recognition Genes and Blue Genes
Genomics and Gene Recognition Genes and Blue Genes November 3, 2004 Eukaryotic Gene Structure eukaryotic genomes are considerably more complex than those of prokaryotes eukaryotic cells have organelles
Computational Biology I LSM5191 (2003/4)
Computational Biology I LSM5191 (2003/4) Aylwin Ng, D.Phil Lecture Notes: Transcriptome: Molecular Biology of Gene Expression I Flow of information: DNA to polypeptide DNA Start Exon1 Intron Exon2 Termination
RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,
Materials and methods Oligonucleotides and DNA constructs RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by Dharmacon Inc. (Lafayette, CO). The sequences were: 122-2 OMe, 5
Antisense RNA Insert Design for Plasmid Construction to Knockdown Target Gene Expression
Vol. 1:7-15 Antisense RNA Insert Design for Plasmid Construction to Knockdown Target Gene Expression Ji, Tom, Lu, Aneka, Wu, Kaylee Department of Microbiology and Immunology, University of British Columbia
MATH 5610, Computational Biology
MATH 5610, Computational Biology Lecture 2 Intro to Molecular Biology (cont) Stephen Billups University of Colorado at Denver MATH 5610, Computational Biology p.1/24 Announcements Error on syllabus Class
(a) Which enzyme(s) make 5' - 3' phosphodiester bonds? (c) Which enzyme(s) make single-strand breaks in DNA backbones?
EXAMPLE QUESTIONS AND ANSWERS 1. Topoisomerase does which one of the following? (a) Makes new DNA strands. (b) Unties knots in DNA molecules. (c) Joins the ends of double-stranded DNA molecules. (d) Is
Confocal immunofluorescence microscopy
Confocal immunofluorescence microscopy HL-6 and cells were cultured and cytospun onto glass slides. The cells were double immunofluorescence stained for Mt NPM1 and fibrillarin (nucleolar marker). Briefly,