Supporting Information
|
|
|
- Erin Howard
- 6 years ago
- Views:
Transcription
1 Supporting Information Yuan et al /pnas Fig. S1. Heat map showing that Populus ICS is coregulated with orthologs of Arabidopsis genes involved in PhQ biosynthesis and PSI function, but not with phenylpropanoid pathway genes. Gene expression ratios (treatment over the respective control) were obtained from Affymetrix GeneChip analysis, and visualized using the HeatMapperPlus Tool ( heatmapper plus.cgi). MenA, 1,4-dihydroxy-2-naphthoate phytyltransferase; MenB, 1,4-dihydroxy-2-naphthoyl CoA synthase; APO2, accumulation of photosystem one 2; CM, chorismate synthase; PAL, phenylalanine ammonia-lyase; and C4H, cinnamate 4-hydroxylase (corresponding probe ID shown on the right). Data were extracted from the following GEO series: (1) Populus tremuloides (clone L4) cell culture response to 25 M methyl jasmonate (MJ) feeding (GenBank accession no. GSE16786); (2) and (3) Populus fremontii x angustifolia (clone RM5) leaf wounding responses: (2) leaves from leaf plastchron index (LPI) 2 and root tips were analyzed 90 h after wounding (accession no. GSE16785), whereas (3) LPI1 and LPI5 were used 1 week after wounding in a separate experiment (GenBank accession no. GSE16783); (4) and (5) Populus fremontii angustifolia response to nitrogen stress: LPI2 and LPI5 from clone 1979 (4) and clone 3200 (5) were analyzed 4 weeks after the start of the nitrogen stress treatment (GenBank accession nos. GSE14515 and GSE14893). Gray color indicates gene expression was below detection in both treatment and control samples. 1of10
2 Fig. S2. RT-PCR amplification of ICS from various Populus genotypes (lanes 1 5) and transgenic Arabidopsis lines (lanes 6 15). Lanes 1 3: three different P. fremontii angustifolia hybrid genotypes; lane 4: P. trichocarpa; lane 5: P. tremuloides; lanes 6 and 7: two independent transgenic Arabidopsis sid2 2 lines harboring the full-length PtiICS cdna; lanes 8 and 9: two independent transgenic Arabidopsis sid2 2 lines harboring PtiICS cdna without the predicted plastid-targeting presequence; lanes 10 13: independent transgenic Arabidopsis lines carrying the 6-kb genomic PtiICS gene under control of the CaMV 35S promoter in the sid2 2 mutant (10 and 11) or Col-0 background (12 and 13); lanes 14 and 15: two independent transgenic Arabidopsis sid2 2 lines harboring the 8-kb PtiICS gene in the sid2 2 mutant background. M1 and M2: molecular markers PhiX174-HaeIII and Lambda-HindIII, respectively. 2of10
3 Fig. S3. Alignment of representative Pupulus ICS 3 UTR sequences showing alternative polyadenylation patterns. Translational stop codon is shown in boldface. Clone N12 represents the predominant transcript type (6 of 9) among the sequenced clones. 3 of 10
4 Fig. S4. Additional Populus ICS splice variants not shown in Fig. 3. (A) Splice variants from Populus leaf RT-PCR with a single occurrence among the 184 sequenced clones. (B) Representative splice variants recovered from transgenic Arabidopsis expressing the 6-kb genomic PtiICS under control of the 35S promoter. Clones are arranged in order of abundance (frequencies in parentheses), with the normal ICS transcript shown at the top. A total of 64 RT-PCR clones were sequenced. Exons affected by alternative splicing are shown in gray. 4of10
5 Fig. S5. Colony PCR of AtICS1 and AtICS2 RT-PCR products cloned into the pcrii-topo vector. Of the 24 AtICS1 (A) and 23 AtICS2 (B) recombinant clones, one and two were found to be splice variants (denoted by asterisks), respectively. Molecular weight markers used were PhiX174- HaeIII in (A) and Lambda-HindIII in (B). 5of10
6 Fig. S6. Quantification of SA in Arabidopsis leaves by GC-MS. Representative selected ion chromatograms of silylated SA (m/z 267, black trace) and internal standard (I.S.) o-anisic acid (m/z 209, blue trace) are shown on the left (A, C, E, and G), and mass spectra of silylated SA on the right (B, D, F, and H). (A and B) Authentic SA standard; (C and D) wild-type; (E and F) sid2 2 mutant; and (G and H) transgenic line B1 harboring the full-length PtiICS cdna under control of the 35S promoter. (I) Calibration curve for SA. Each symbol represents means SD of three independent measurements. 6of10
7 Fig. S7. Evidence of alternative splicing in rice OsICS based on EST/cDNA sequences. Graph was obtained from the Gramene Rice Genome Browser ( 7of10
8 Fig. S8. Evidence of alternative splicing in grape VvICS based on G-MO.R-Se assembly and de novo gene model building using RNA-Seq data [Denoeud et al. (2008) Genome Biol 9:R175]. Graph was obtained from the Grape Genome Browser ( 8 of 10
9 Fig. S9. Limitation of DNA fragment sizing by an automatic DNA sequencer. A representative chromatogram of DNA size standards, ranging in size from 50 bp to 2,500 bases, analyzed with a Beckman CEQ8000 Genetic Analyzer. Fluorescence (Well Red D1)-labeled DNA size standards were custom synthesized by BioVentures, Inc., and include the following sizes: 50, 75, 100, 125, 150, 200, 250, 300, 350, 400, 450, 475, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1800, 1900, 2000, 2100, 2300, 2400, and 2500 bases. The samples were analyzed using the Fragment Analysis module with the run time set at 3 hours, and the voltage set at 3.5 kv. Fragment sizes are indicated above the corresponding peaks, except for those that could not be resolved ( 1,500 bases, marked by a bracket). 9of10
10 Table S1. List of primers used in various PCR and RT-PCR amplifications Primer name Sequence (5 to 3 ) Application PtiICSF1 ATGGCAACCGCTACTCTAGC RT-PCR for PtiICS, PCR for 6-kb gene construct PtiICSR3 TCAGTTGATGATTCCTGAGTTCTC RT-PCR for PtiICS, PCR for 6-kb gene construct PtiICSF1 Same as above RT-PCR for PtiICS used in clone sequencing PtiICSexon16R GGGGAAACATTATCAAATTGC RT-PCR for PtiICS used in clone sequencing PtiICSF2noplstid ATGGCTAATGGCTGCCAAGGAAAC RT-PCR for mature PtiICS PtiICSR3 Same as above RT-PCR for mature PtiICS PtiICSgF ACGTCGACTAATGTTAAGAAAGAATTTGGCTTG PCR for 8-kb gene construct PtiICSgR ATGGTACCTAATTCAGACAGATCAGCAACAAA PCR for 8-kb gene construct PtiICSF1noplastidNcoI CCATGGCTAATGGCTGCCAAGGAAAC E. coli complementation PtiICSR3 Same as above E. coli complementation AtICS1F1 ATGGCAACTGCTGTTTTATCTCCGGCAGC RT-PCR for AtICS1 AtICS1R2new TCAATTAATCGCCTGTAGAGATG RT-PCR for AtICS1 AtICS1F1noplastidNcoI CCATGGCTTCTATGAATGGTTGTGATGGA E. coli complementation AtICS1R2new Same as above E. coli complementation AtICS2F1 ATGGCAAACGGATGTGAGGCTGACCA RT-PCR for AtICS2 AtICS2R2 TTAGTTGATTGGTTGCAAAGC RT-PCR for AtICS2 EntCFNcoI CCATGGCAAATCCGTCCCCTCGCCTTTG E. coli complementation EntCRstop TTAATGCAATCCAAAAACGTTCAACA E. coli complementation 10 of 10
SUPPLEMENTARY INFORMATION
AS-NMD modulates FLM-dependent thermosensory flowering response in Arabidopsis NATURE PLANTS www.nature.com/natureplants 1 Supplementary Figure 1. Genomic sequence of FLM along with the splice sites. Sequencing
Proposed experiments to study SAR
Proposed experiments to study SAR Question or hypothesis Proposed experiments Expectation 1. Arabidopsis can be used to study SAR Test SAR response in Arabidopsis Yes, SAR on Arabidopsis 2. What are contributing
3 -end. Sau3A. 3 -end TAA TAA. ~9.1kb SalI TAA. ~12.6kb. HindШ ATG 5,860bp TAA. ~12.7kb
Supplemental Data. Chen et al. (2008). Badh2, encoding betaine aldehyde dehydrogenase, inhibits the biosynthesis of 2-acetyl-1-pyrroline, a major component in rice fragrance. A pcam-cah/cah Sau3A Promoter
Supplemental Data. Sethi et al. (2014). Plant Cell /tpc
Supplemental Data Supplemental Figure 1. MYC2 Binds to the E-box but not the E1-box of the MPK6 Promoter. (A) E1-box and E-box (wild type) containing MPK6 promoter fragment. The region shown in red denotes
ABI3 Controls Embryo De-greening Through Mendel's I locus
Supporting Online Material for ABI3 Controls Embryo De-greening Through Mendel's I locus Frédéric Delmas a,b,c, Subramanian Sankaranarayanan d, Srijani Deb d, Ellen Widdup d, Céline Bournonville b,c,norbert
Supplemental Figure legends Figure S1. (A) (B) (C) (D) Figure S2. Figure S3. (A-E) Figure S4. Figure S5. (A, C, E, G, I) (B, D, F, H, Figure S6.
Supplemental Figure legends Figure S1. Map-based cloning and complementation testing for ZOP1. (A) ZOP1 was mapped to a ~273-kb interval on Chromosome 1. In the interval, a single-nucleotide G to A substitution
- 1 - Supplemental Data
- 1-1 Supplemental Data 2 3 4 5 6 7 8 9 Supplemental Figure S1. Differential expression of AtPIP Genes in DC3000-inoculated plants. Gene expression in leaves was analyzed by real-time RT-PCR and expression
Chapter 20 Recombinant DNA Technology. Copyright 2009 Pearson Education, Inc.
Chapter 20 Recombinant DNA Technology Copyright 2009 Pearson Education, Inc. 20.1 Recombinant DNA Technology Began with Two Key Tools: Restriction Enzymes and DNA Cloning Vectors Recombinant DNA refers
Molecular Cell Biology - Problem Drill 11: Recombinant DNA
Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna
Supplemental Data. Cui et al. (2012). Plant Cell /tpc a b c d. Stem UBC32 ACTIN
A Root Stem Leaf Flower Silique Senescence leaf B a b c d UBC32 ACTIN C * Supplemental Figure 1. Expression Pattern and Protein Sequence of UBC32 Homologues in Yeast, Human, and Arabidopsis. (A) Expression
BS 50 Genetics and Genomics Week of Oct 24
BS 50 Genetics and Genomics Week of Oct 24 Additional Practice Problems for Section Question 1: The following table contains a list of statements that apply to replication, transcription, both, or neither.
Figure S1. Figure S2 RT-PCR. qpcr RT-PCR. Northern. IVSwt ΔIVS IVS IVS IVS. NTC mock IVSwt ΔIVS IVS IVS. mock IVSwt ΔIVS
Figure S1 40 cycles IVS IVS IVS NTC wt Δ Δ mut pri-mirna163 * Fig. S1 Transcripts generated from the MIR163 gene variants in which splice sites have been mutated are not spliced. products were separated
Construction of plant complementation vector and generation of transgenic plants
MATERIAL S AND METHODS Plant materials and growth conditions Arabidopsis ecotype Columbia (Col0) was used for this study. SALK_072009, SALK_076309, and SALK_027645 were obtained from the Arabidopsis Biological
Chapter 8: Recombinant DNA. Ways this technology touches us. Overview. Genetic Engineering
Chapter 8 Recombinant DNA and Genetic Engineering Genetic manipulation Ways this technology touches us Criminal justice The Justice Project, started by law students to advocate for DNA testing of Death
S156AT168AY175A (AAA) were purified as GST-fusion proteins and incubated with GSTfused
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 Supplemental Materials Supplemental Figure S1 (a) Phenotype of the wild type and grik1-2 grik2-1 plants after 8 days in darkness.
A Repressor Complex Governs the Integration of
Developmental Cell 15 Supplemental Data A Repressor Complex Governs the Integration of Flowering Signals in Arabidopsis Dan Li, Chang Liu, Lisha Shen, Yang Wu, Hongyan Chen, Masumi Robertson, Chris A.
IDN1 and IDN2: two proteins required for de novo DNA methylation in Arabidopsis thaliana.
IDN1 and IDN2: two proteins required for de novo DNA methylation in Arabidopsis thaliana. Israel Ausin, Todd C. Mockler, Joanne Chory, and Steven E. Jacobsen Col Ler nrpd1a rdr2 dcl3-1 ago4-1 idn1-1 idn2-1
Supporting Information
Supporting Information Poelman et al. 10.1073/pnas.1110748108 SI Text Cloning of Transcription Factor BoMYC as an Example in the Study. A partial sequence (575 bp) of the cabbage transcription factor (MYC)
Schematic representation of the endogenous PALB2 locus and gene-disruption constructs
Supplementary Figures Supplementary Figure 1. Generation of PALB2 -/- and BRCA2 -/- /PALB2 -/- DT40 cells. (A) Schematic representation of the endogenous PALB2 locus and gene-disruption constructs carrying
Nature Genetics: doi: /ng Supplementary Figure 1. ChIP-seq genome browser views of BRM occupancy at previously identified BRM targets.
Supplementary Figure 1 ChIP-seq genome browser views of BRM occupancy at previously identified BRM targets. Gene structures are shown underneath each panel. Supplementary Figure 2 pref6::ref6-gfp complements
SUPPLEMENTARY INFORMATION
Gene replacements and insertions in rice by intron targeting using CRISPR Cas9 Table of Contents Supplementary Figure 1. sgrna-induced targeted mutations in the OsEPSPS gene in rice protoplasts. Supplementary
Map-Based Cloning of Qualitative Plant Genes
Map-Based Cloning of Qualitative Plant Genes Map-based cloning using the genetic relationship between a gene and a marker as the basis for beginning a search for a gene Chromosome walking moving toward
GENETICS EXAM 3 FALL a) is a technique that allows you to separate nucleic acids (DNA or RNA) by size.
Student Name: All questions are worth 5 pts. each. GENETICS EXAM 3 FALL 2004 1. a) is a technique that allows you to separate nucleic acids (DNA or RNA) by size. b) Name one of the materials (of the two
Fig. S1. Clustering analysis of expression array and ChIP-PCR assay in the ARF3 locus. (A) Typical examples of the transgenic plants used for
Fig. S1. Clustering analysis of expression array and ChIP-PCR assay in the ARF3 locus. (A) Typical examples of the transgenic plants used for ChIP-chip and ChIP-PCR assays. The presence of pas1:t7:as1
Next Gen Sequencing. Expansion of sequencing technology. Contents
Next Gen Sequencing Contents 1 Expansion of sequencing technology 2 The Next Generation of Sequencing: High-Throughput Technologies 3 High Throughput Sequencing Applied to Genome Sequencing (TEDed CC BY-NC-ND
Design. Construction. Characterization
Design Construction Characterization DNA mrna (messenger) A C C transcription translation C A C protein His A T G C T A C G Plasmids replicon copy number incompatibility selection marker origin of replication
Chapter 6 - Molecular Genetic Techniques
Chapter 6 - Molecular Genetic Techniques Two objects of molecular & genetic technologies For analysis For generation Molecular genetic technologies! For analysis DNA gel electrophoresis Southern blotting
Gene Expression Technology
Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene
Molecular Genetics Techniques. BIT 220 Chapter 20
Molecular Genetics Techniques BIT 220 Chapter 20 What is Cloning? Recombinant DNA technologies 1. Producing Recombinant DNA molecule Incorporate gene of interest into plasmid (cloning vector) 2. Recombinant
File name: Supplementary Information Description: Supplementary figures and supplementary tables. File name: Peer review file Description:
File name: Supplementary Information Description: Supplementary figures and supplementary tables. File name: Peer review file Description: Supplementary Figure 1. dcas9-mq1 fusion protein induces de novo
Reading Lecture 8: Lecture 9: Lecture 8. DNA Libraries. Definition Types Construction
Lecture 8 Reading Lecture 8: 96-110 Lecture 9: 111-120 DNA Libraries Definition Types Construction 142 DNA Libraries A DNA library is a collection of clones of genomic fragments or cdnas from a certain
Genome annotation & EST
Genome annotation & EST What is genome annotation? The process of taking the raw DNA sequence produced by the genome sequence projects and adding the layers of analysis and interpretation necessary
Supplemental Data. Guo et al. (2015). Plant Cell /tpc
Supplemental Figure 1. The Mutant exb1-d Displayed Pleiotropic Phenotypes and Produced Branches in the Axils of Cotyledons. (A) Branches were developed in exb1-d but not in wild-type plants. (B) and (C)
Supplemental Data. Zhou et al. (2016). Plant Cell /tpc
Supplemental Figure 1. Confirmation of mutant mapping results. (A) Complementation assay with stably transformed genomic fragments (ComN-N) (2 kb upstream of TSS and 1.5 kb downstream of TES) and CaMV
Bi 8 Lecture 5. Ellen Rothenberg 19 January 2016
Bi 8 Lecture 5 MORE ON HOW WE KNOW WHAT WE KNOW and intro to the protein code Ellen Rothenberg 19 January 2016 SIZE AND PURIFICATION BY SYNTHESIS: BASIS OF EARLY SEQUENCING complex mixture of aborted DNA
Alternative Cleavage and Polyadenylation of RNA
Developmental Cell 18 Supplemental Information The Spen Family Protein FPA Controls Alternative Cleavage and Polyadenylation of RNA Csaba Hornyik, Lionel C. Terzi, and Gordon G. Simpson Figure S1, related
Supplemental Data. Na Xu et al. (2016). Plant Cell /tpc
Supplemental Figure 1. The weak fluorescence phenotype is not caused by the mutation in At3g60240. (A) A mutation mapped to the gene At3g60240. Map-based cloning strategy was used to map the mutated site
Supplemental Figure 1. Immunoblot analysis of wild-type and mutant forms of JAZ3
Supplemental Data. Chung and Howe (2009). A Critical Role for the TIFY Motif in Repression of Jasmonate Signaling by a Stabilized Splice Variant of the JASMONATE ZIM-domain protein JAZ10 in Arabidopsis.
HiPer RT-PCR Teaching Kit
HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The
SUPPLEMENTARY INFORMATION
Materials and Methods Transgenic Plant Materials and DNA Constructs. VEX1::H2B-GFP, ACA3::H2B-GFP, KRP6::H2B-GFP, KRP6::mock21ts-GFP, KRP6::TE21ts- GFP and KRP6::miR161ts-GFP constructs were generated
Genome Sequence Assembly
Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:
SUPPLEMENTARY INFORMATION
Local auxin metabolism regulates environment-induced hypocotyl elongation Zuyu Zheng 1,2, Yongxia Guo 3, Ondřej Novák 4,5, William Chen 2, Karin Ljung 4, Joseph P. Noel 1,3, *, and Joanne Chory 1,2, *
Applicazioni biotecnologiche
Applicazioni biotecnologiche Analisi forense Sintesi di proteine ricombinanti Restriction Fragment Length Polymorphism (RFLP) Polymorphism (more fully genetic polymorphism) refers to the simultaneous occurrence
Supplemental Data. Li et al. (2015). Plant Cell /tpc
Supplemental Data Supplemental Figure 1: Characterization of asr3 T-DNA knockout lines and complementation transgenic lines. (A) The scheme of At2G33550 (ASR3) with gray boxes indicating exons and dash
Supplemental Data. Tilbrook et al. (2016). Plant Cell /tpc
Supplemental Figure 1. Protein alignment of with. Identical aligned residues highlighted in black and similar and non-similar residues highlighted in grey and white, respectively. Position of Trp residues
Supplemental Data. Borg et al. Plant Cell (2014) /tpc
Supplementary Figure 1 - Alignment of selected angiosperm DAZ1 and DAZ2 homologs Multiple sequence alignment of selected DAZ1 and DAZ2 homologs. A consensus sequence built using default parameters is shown
Using mutants to clone genes
Using mutants to clone genes Objectives 1. What is positional cloning? 2. What is insertional tagging? 3. How can one confirm that the gene cloned is the same one that is mutated to give the phenotype
Supplemental Data. Hu et al. Plant Cell (2017) /tpc
1 2 3 4 Supplemental Figure 1. DNA gel blot analysis of homozygous transgenic plants. (Supports Figure 1.) 5 6 7 8 Rice genomic DNA was digested with the restriction enzymes EcoRⅠ and BamHⅠ. Lanes in the
To investigate the heredity of the WFP gene, we selected plants that were homozygous
Supplementary information Supplementary Note ST-12 WFP allele is semi-dominant To investigate the heredity of the WFP gene, we selected plants that were homozygous for chromosome 1 of Nipponbare and heterozygous
Supplementary Fig 1. The responses of ERF109 to different hormones and stresses. (a to k) The induced expression of ERF109 in 7-day-old Arabidopsis
Supplementary Fig 1. The responses of ERF109 to different hormones and stresses. (a to k) The induced expression of ERF109 in 7-day-old Arabidopsis seedlings expressing ERF109pro-GUS. The GUS staining
CONSTRUCTION OF GENOMIC LIBRARY
MODULE 4-LECTURE 4 CONSTRUCTION OF GENOMIC LIBRARY 4-4.1. Introduction A genomic library is an organism specific collection of DNA covering the entire genome of an organism. It contains all DNA sequences
Microarrays: since we use probes we obviously must know the sequences we are looking at!
These background are needed: 1. - Basic Molecular Biology & Genetics DNA replication Transcription Post-transcriptional RNA processing Translation Post-translational protein modification Gene expression
Next-generation sequencing technologies
Next-generation sequencing technologies Illumina: Summary https://www.youtube.com/watch?v=fcd6b5hraz8 Illumina platforms: Benchtop sequencers https://www.illumina.com/systems/sequencing-platforms.html
Genome Biology and Biotechnology
Genome Biology and Biotechnology Functional Genomics Prof. M. Zabeau Department of Plant Systems Biology Flanders Interuniversity Institute for Biotechnology (VIB) University of Gent International course
Bootcamp: Molecular Biology Techniques and Interpretation
Bootcamp: Molecular Biology Techniques and Interpretation Bi8 Winter 2016 Today s outline Detecting and quantifying nucleic acids and proteins: Basic nucleic acid properties Hybridization PCR and Designing
GTTCGGGTTCC TTTTGAGCAG
Supplementary Figures Splice variants of the SIP1 transcripts play a role in nodule organogenesis in Lotus japonicus. Wang C, Zhu H, Jin L, Chen T, Wang L, Kang H, Hong Z, Zhang Z. 5 UTR CDS 3 UTR TCTCAACCATCCTTTGTCTGCTTCCGCCGCATGGGTGAGGTCATTTTGTCTAGATGACGTGCAATTTACAATGA
Biotechnology: DNA Technology & Genomics
Chapter 20. Biotechnology: DNA Technology & Genomics 2003-2004 1 The BIG Questions! How can we use our knowledge of DNA to: " diagnose disease or defect? " cure disease or defect? " change/improve organisms?!
A novel tool for monitoring endogenous alpha-synuclein transcription by NanoLuciferase
A novel tool for monitoring endogenous alpha-synuclein transcription by NanoLuciferase tag insertion at the 3 end using CRISPR-Cas9 genome editing technique Sambuddha Basu 1, 3, Levi Adams 1, 3, Subhrangshu
Candidate region (0.74 Mb) ATC TCT GGG ACT CAT GAG CAG GAG GCT AGC ATC TCT GGG ACT CAT TAG CAG GAG GCT AGC
A idm-3 idm-3 B Physical distance (Mb) 4.6 4.86.6 8.4 C Chr.3 Recom. Rate (%) ATG 3.9.9.9 9.74 Candidate region (.74 Mb) n=4 TAA D idm-3 G3T(E4) G4A(W988) WT idm-3 ATC TCT GGG ACT CAT GAG CAG GAG GCT AGC
6/256 1/256 0/256 1/256 2/256 7/256 10/256. At3g06290 (SAC3B)
Chr.III M 5M 1M 15M 2M 23M BAC clones F22F7 F1A16 F24F17 F24P17 T8E24 F17A9 F21O3 F17A17 F18C1 F2O1 F28L1 F5E6 F3E22 T1B9 MLP3 Number of recombinants 6/256 1/256 /256 1/256 2/256 7/256 1/256 At3g629 (SAC3B)
Roche Molecular Biochemicals Technical Note No. LC 10/2000
Roche Molecular Biochemicals Technical Note No. LC 10/2000 LightCycler Overview of LightCycler Quantification Methods 1. General Introduction Introduction Content Definitions This Technical Note will introduce
Erhard et al. (2013). Plant Cell /tpc
Supplemental Figure 1. c1-hbr allele structure. Diagram of the c1-hbr allele found in stocks segregating 1:1 for rpd1-1 and rpd1-2 homozygous mutants showing the presence of a 363 base pair (bp) Heartbreaker
Genome-wide genetic screening with chemically-mutagenized haploid embryonic stem cells
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 Supplementary Information Genome-wide genetic screening with chemically-mutagenized haploid embryonic stem cells Josep V. Forment 1,2, Mareike Herzog
Enzyme that uses RNA as a template to synthesize a complementary DNA
Biology 105: Introduction to Genetics PRACTICE FINAL EXAM 2006 Part I: Definitions Homology: Comparison of two or more protein or DNA sequence to ascertain similarities in sequences. If two genes have
Supplemental Data. Farmer et al. (2010) Plant Cell /tpc
Supplemental Figure 1. Amino acid sequence comparison of RAD23 proteins. Identical and similar residues are shown in the black and gray boxes, respectively. Dots denote gaps. The sequence of plant Ub is
Supplementary Figure 1. Processing and quality control for recombinant proteins.
Supplementary Figure 1 Processing and quality control for recombinant proteins. (a) Schematic representation of processing of a recombinant protein library. Recombinant proteins were generated individually.
Supplemental Materials. Zhu et al. RNAi suppression of DDM1 in poplar
%mc Supplemental Materials Zhu et al. RNAi suppression of in poplar Supplemental Fig. S1 Total cellular cytosine methylation for selected events determined by HPLC. The association between methylcytosine
Sequence Annotation & Designing Gene-specific qpcr Primers (computational)
James Madison University From the SelectedWorks of Ray Enke Ph.D. Fall October 31, 2016 Sequence Annotation & Designing Gene-specific qpcr Primers (computational) Raymond A Enke This work is licensed under
Biology 105: Introduction to Genetics PRACTICE FINAL EXAM Part I: Definitions. Homology: Reverse transcriptase. Allostery: cdna library
Biology 105: Introduction to Genetics PRACTICE FINAL EXAM 2006 Part I: Definitions Homology: Reverse transcriptase Allostery: cdna library Transformation Part II Short Answer 1. Describe the reasons for
Supplementary Figure 1 An overview of pirna biogenesis during fetal mouse reprogramming. (a) (b)
Supplementary Figure 1 An overview of pirna biogenesis during fetal mouse reprogramming. (a) A schematic overview of the production and amplification of a single pirna from a transposon transcript. The
Measuring and Understanding Gene Expression
Measuring and Understanding Gene Expression Dr. Lars Eijssen Dept. Of Bioinformatics BiGCaT Sciences programme 2014 Why are genes interesting? TRANSCRIPTION Genome Genomics Transcriptome Transcriptomics
Chinese Academy of Sciences, Datun Road, Chaoyang District, Beijing, 10101, China
SUPPLEMENTARY INFORMATION Title: Bi-directional processing of pri-mirnas with branched terminal loops by Arabidopsis Dicer-like1 Hongliang Zhu 1,2,3, Yuyi Zhou 1,2,4, Claudia Castillo-González 1,2, Amber
PLNT2530 (2018) Unit 6b Sequence Libraries
PLNT2530 (2018) Unit 6b Sequence Libraries Molecular Biotechnology (Ch 4) Analysis of Genes and Genomes (Ch 5) Unless otherwise cited or referenced, all content of this presenataion is licensed under the
Identification and characterization of a pathogenicity-related gene VdCYP1 from Verticillium dahliae
Identification and characterization of a pathogenicity-related gene VdCYP1 from Verticillium dahliae Dan-Dan Zhang*, Xin-Yan Wang*, Jie-Yin Chen*, Zhi-Qiang Kong, Yue-Jing Gui, Nan-Yang Li, Yu-Ming Bao,
A Nucleus-Encoded Chloroplast Protein YL1 Is Involved in Chloroplast. Development and Efficient Biogenesis of Chloroplast ATP Synthase in Rice
A Nucleus-Encoded Chloroplast Protein YL1 Is Involved in Chloroplast Development and Efficient Biogenesis of Chloroplast ATP Synthase in Rice Fei Chen 1,*, Guojun Dong 2,*, Limin Wu 1, Fang Wang 3, Xingzheng
previously. co and fca-9 alleles were isolated from the Col background. Plants were
Supporting Online Material Materials and Methods Plant Growth Conditions The flc-3, FRI Sf2 -Col (S1), fve-4 (S2), ld-1 (S3) and fpa (S4) lines were described previously. co and fca-9 alleles were isolated
PrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID peptidylglycine alpha-amidating monooxygenase PAM Human This gene encodes a multifunctional
Supplemental Figure 1 A
Supplemental Figure 1 A Supplemental Data. Han et al. (2016). Plant Cell 10.1105/tpc.15.00997 BamHI -1616 bp SINE repeats SalI ATG SacI +1653 bp HindIII LB HYG p35s pfwa LUC Tnos RB pfwa-bamhi-f: CGGGATCCCGCCTTTCTCTTCCTCATCTGC
Intron distance to transcription start (nt)*
Schwab et al. SOM: Enhanced microrna accumulation through stemloop-adjacent introns 1 Supplemental Table 1. Characteristics of introns used in this study Intron name Length intron (nt) Length cloned fragment
M Keramatipour 2. M Keramatipour 1. M Keramatipour 4. M Keramatipour 3. M Keramatipour 5. M Keramatipour
Molecular Cloning Methods Mohammad Keramatipour MD, PhD keramatipour@tums.ac.ir Outline DNA recombinant technology DNA cloning co Cell based PCR PCR-based Some application of DNA cloning Genomic libraries
Roche Molecular Biochemicals Technical Note No. LC 12/2000
Roche Molecular Biochemicals Technical Note No. LC 12/2000 LightCycler Absolute Quantification with External Standards and an Internal Control 1. General Introduction Purpose of this Note Overview of Method
Abcam.com. hutton.ac.uk. Ipmdss.dk. Bo Gong and Eva Chou
Abcam.com Bo Gong and Eva Chou Ipmdss.dk hutton.ac.uk What is a homeotic gene? A gene which regulates the developmental fate of anatomical structures in an organism Why study them? Understand the underlying
Using mutants to clone genes
Using mutants to clone genes Objectives: 1. What is positional cloning? 2. What is insertional tagging? 3. How can one confirm that the gene cloned is the same one that is mutated to give the phenotype
Before starting, write your name on the top of each page Make sure you have all pages
Biology 105: Introduction to Genetics Name Student ID Before starting, write your name on the top of each page Make sure you have all pages You can use the back-side of the pages for scratch, but we will
Supplementary Figure 1. jmj30-2 and jmj32-1 produce null mutants. (a) Schematic drawing of JMJ30 and JMJ32 genome structure showing regions amplified
Supplementary Figure 1. jmj30-2 and jmj32-1 produce null mutants. (a) Schematic drawing of JMJ30 and JMJ32 genome structure showing regions amplified by primers used for mrna expression analysis. Gray
Annex to the Accreditation Certificate D PL according to DIN EN ISO/IEC 17025:2005
Deutsche Akkreditierungsstelle GmbH German Accreditation Body Annex to the Accreditation Certificate D PL 13372 01 00 according to DIN EN ISO/IEC 17025:2005 Period of validity: 22.05.2014 to 25.03.2017
7.03, 2005, Lecture 20 EUKARYOTIC GENES AND GENOMES I
7.03, 2005, Lecture 20 EUKARYOTIC GENES AND GENOMES I For the last several lectures we have been looking at how one can manipulate prokaryotic genomes and how prokaryotic genes are regulated. In the next
Supplementary Figure 1 qrt-pcr expression analysis of NLP8 with and without KNO 3 during germination.
Supplementary Figure 1 qrt-pcr expression analysis of NLP8 with and without KNO 3 during germination. Seeds of Col-0 were harvested from plants grown at 16 C, stored for 2 months, imbibed for indicated
Supplementary Figure 1. CRISPR/Cas9-induced targeted mutations in TaGASR7, TaDEP1, TaNAC2, TaPIN1, TaLOX2 and TaGW2 genes in wheat protoplasts.
Supplementary Figure 1. CRISPR/Cas9-induced targeted mutations in TaGASR7, TaDEP1, TaNAC2, TaPIN1, TaLOX2 and TaGW2 genes in wheat protoplasts. Lanes 1 and 2: digested CRISPR/Cas9-transformed protoplasts;
Single-Cell Whole Transcriptome Profiling With the SOLiD. System
APPLICATION NOTE Single-Cell Whole Transcriptome Profiling Single-Cell Whole Transcriptome Profiling With the SOLiD System Introduction The ability to study the expression patterns of an individual cell
Supplemental Figure 1
Supplemental Figure 1 A gta2-1 gta2-2 1kb AT4G08350 B Col-0 gta2-1 LP+RP+LBb1.3 C Col-0 gta2-2 LP+RP+LB1 D Col-0 gta2-2 gta2-1 GTA2 TUBLIN E Col0 gta2-1 gta2-2 Supplemental Figure 1. Phenotypic analysis
NEW PARADIGM of BIOTECHNOLOGY - GENET BIO. GeNet Bio Global Gene Network
NEW PARADIGM of BIOTECHNOLOGY - GENET BIO GeNet Bio Global Gene Network GENET BIO DNA AMPLIFICATION PRODUCTS GUIDE Keynote of Products Prime TaqTM DNA Polymerase Prime TaqTM Premix ExPrime TaqTM DNA Polymerase
*** *** * *** *** *** * *** ** ***
Figure S: OsMADS6 over- or down-expression is stable across generations A, OsMADS6 expression in overexpressing (OX, OX, dark bars) and corresponding control (OX, WT, white bars) T4 plants. B, OsMADS6
Two classes of silencing RNAs move between Caenorhabditis elegans tissues.
Two classes of silencing RNAs move between Caenorhabditis elegans tissues. Antony M Jose, Giancarlo A Garcia, and Craig P Hunter. Supplementary Figures, Figure Legends, and Tables. Supplementary Figure
Chapter 10 Genetic Engineering: A Revolution in Molecular Biology
Chapter 10 Genetic Engineering: A Revolution in Molecular Biology Genetic Engineering Direct, deliberate modification of an organism s genome bioengineering Biotechnology use of an organism s biochemical
Figure S1 Correlation in size of analogous introns in mouse and teleost Piccolo genes. Mouse intron size was plotted against teleost intron size for t
Figure S1 Correlation in size of analogous introns in mouse and teleost Piccolo genes. Mouse intron size was plotted against teleost intron size for the pcloa genes of zebrafish, green spotted puffer (listed
WiscDsLox485 ATG < > //----- E1 E2 E3 E4 E bp. Col-0 arr7 ARR7 ACTIN7. s of mrna/ng total RNA (x10 3 ) ARR7.
A WiscDsLox8 ATG < > -9 +0 > ---------//----- E E E E E UTR +9 UTR +0 > 00bp B S D ol-0 arr7 ol-0 arr7 ARR7 ATIN7 D s of mrna/ng total RNA opie 0. ol-0 (x0 ) arr7 ARR7 Supplemental Fig.. Genotyping and
Supplementary Materials
Supplementary Materials Table S1. Oligonucleotide sequences and PCR conditions used to amplify the indicated genes. TA = annealing temperature; gdna = genomic DNA; cdna = complementary DNA; c = concentration.
Supplemental Data. Benstein et al. (2013). Plant Cell /tpc
Supplemental Figure 1. Purification of the heterologously expressed PGDH1, PGDH2 and PGDH3 enzymes by Ni-NTA affinity chromatography. Protein extracts (2 µl) of different fractions (lane 1 = total extract,
SUPPLEMENTARY INFORMATION
Ca 2+ /calmodulin Regulates Salicylic Acid-mediated Plant Immunity Liqun Du, Gul S. Ali, Kayla A. Simons, Jingguo Hou, Tianbao Yang, A.S.N. Reddy and B. W. Poovaiah * *To whom correspondence should be