2006 Nobel Prize in Chemistry and Medicine
|
|
- Shannon Bradley
- 5 years ago
- Views:
Transcription
1 2006 Nobel Prize in Chemistry and Medicine Lin Wang and Xianfeng Song Adviser: Sima Setayeshgar
2 Outline o Background: transcription of genes into proteins o 2006 Nobel prizes in chemistry and medicine o Related works by physicists
3 I. Background: transcription of genes into proteins
4 How is Protein Synthesized The central dogma of protein synthesis 1. Different RNAs: mrna, trna, rrna 2. DNA template strand is used to create mrna 3. Robosome binds to mrna, reads the codes, and synthesizes protein Purves et al., Life: The Science of Biology, 4th Edition
5 Unit of DNA: Nucleotide and Base Pairs Nucleotide: Base Sugar: deoxyribose Phosphate Base pairs: connected by hydrogen bond Uracil replace Thymine in RNA
6 Double Stranded DNA Single strand DNA backbone is linked by phosphates and deoxyribose. Base pairs link the two single strand DNA, form a double stranded DNA. Purves et al., Life: The Science of Biology, 4th Edition
7 Transcription TTGACA TATAAT -35 Promoter -10 gene +1 termination 1. RNA polymerase binds to the promoter region on template DNA strand. 2. RNA polymerase opens the dsdna, moves along the template DNA strand, and synthesizes RNA RNA strand is released when RNA polymerase sees the termination code.
8 Translation: Protein Synthesis 1. Three bases forms a codon on mrna. Condon represents an amino acid. Mul-tiple codons can represent one amino aicd. Ex: UCU, UCC, UCA, UCG are all codons for amino acid Ser. 2. Ribosome binds to mrna and finds the starting codon AUG. 3. Amino acid is brought by trna to ribosome to form polypeptide chain. 4. Translation stops when ribosome sees codon UAA. 5. Polypetide chain is released and folded into protein. Purves et al., Life: The Science of Biology, 4th Edition
9 II Nobel Prize in Chemistry and Medicine
10 2006 Nobel Prize in Chemistry Roger D. Kornberg Stanford University School of Medicine For his studies of molecular basis of eukaryotic transcription. 1. Develop an in vitro yeast transcription system, and find a method to control the progression of the transcription. 2. Depicts the crystals of RNA polymerase II, and other complexes involved in transcription process. (electron microscopy and X-ray.) 3. Combining the above two, he shows a dynamic picture of transcription process.
11 2006 Nobel Prize in Chemistry Physical picture of the position and configuration of the protein complexs involved in RNA synthesis. Big white: RNA polymerase Blue: DNA strand Red: RNA strand Green: helix in RNA polymerase Chemistry Nobel Prize
12 2006 Nobel Prize in Medicine Andrew Fire Pathology and Genetics, Stanford University Craig Mello Molecular medicine, University of Massachusetts For their discovery of RNA interference, an important gene regulation mechanism. Their finding has already had an impact in biomedical research.
13 2006 Nobel Prize in Medicine 1. RNA interference: Protect cells without immunology against viruses. Gene regulation. 2. Sources of dsrna: i. Virus release dsrna ii. Transposons. iii. Precursor of microrna. Nobel Prize in Physiology and Medicine 2006
14 Effect of RNA Interference Nobel Prize in Physiology and Medicine 2006 The effect on mex-3 mrna content in embryos after injection of single-stranded or double-stranded mex-3 RNA into the gonad of C. elegans. mex-3 mrna is abundant in the gonads and early embryos. The mrna was lost after injection of double-stranded RNA, while injection of antisense RNA only reduced the content of mrna to some extent. The extent of brown color reflects the amount of mrna present.
15 Molecular Mechanism of RNA interference Molecular Mechanism of RNA interference
16 Animation: Transcription and Translation o Transcription process o Translation process
17 III. Related works by Physicists
18 Backtracking of RNA polymerase - Transcription Processes Joshua W. Shaevitz, Steven M. Block et al., Nature (2003) Elongating: The RNAP actively synthesize RNA along DNA. Backtracking: When RNAP makes a mistake, e.g. inserts the wrong base into the RNA chain, the polymerase is able to back up along the DNA and cut off the end portion of the newlysynthesized RNA containing the incorrectlyincorporated base.
19 Backtracking of RNA polymerase - Experiment Setup Joshua W. Shaevitz, Steven M. Block et al., Nature (2003) Dumbell optical trapping setup for studying RNA polymerase Green: RNAP Red: RNA Blue: DNA Photo of the optical trapping instrument used to measure RNA polymerase backtracking Beads: Micron-sized glass beads
20 Backtracking of RNA polymerase - Optical tweezers Joshua W. Shaevitz, Steven M. Block et al., Nature (2003) What is it? The technique to use light to manipulate microscopic objects as small as a single atom. Can be used to apply forces in the pn-range and to measure displacements in the nm range of objects ranging in size from 10 nm to over 100mm. How does it work? A laser beam is focused by a highquality microscope objective to a spot in the specimen plane. This spot creates an optical trap by means of momentum transfer.
21 Backtracking of RNA polymerase - Experimental Result Joshua W. Shaevitz, Steven M. Block et al., Nature (2003) Movie of RNA polymerase motion showing no long pauses, sped up 30 times. Record of RNA polymerase motion taken during left movie (no long pause). Movie of RNA polymerase motion demonstrating a five minute pause, sped up 60 times. Record of RNA polymerase motion taken during left movie (long pause). The details of long pause reveal the backtracking.
22 Thanks!
23 Effect of RNA Interference When gene mex-3 is expressed, embryo can be stained. b. Normal embryo shows a normal staining level. c. Inject antisense RNA, the staining intense is reduced. d. Inject double stranded RNA, the staining disappears.
24 Kinetic Proofreading: FRET E a E d reactant2 acceptor E T donor reactant1 d E 0 donor acceptor FRET: The larger E T,the smaller the distance between donor and acceptor. Shown in the right graph, FRET is used in studying the reaction between two reactants.
25 Kinetic Proofreading Model Reaction pathway without proofreading Minimum error rate: f 0 = exp(-δg CD /RT) ΔG CD : largest free energy difference between reaction pathways R: mol gas constant 1 error in requires ΔG CD to be 23 KJ. Difficulty!! Reaction pathway with proofreading Error rate: f 1 = f error in now requires ΔG CD to be 11 KJ. Easier!! J. J. Hopfield et al. PNAS (1974)
26 Kinetic Proofreading in Translation Identified the different states in a single step of translation: Reaction between two trnas. Using correct and wrong substrates, they find: Selection ratio at step 2: 3.6:1 Selection ratio at step 5: 24:1 Scott C Blanchard et al. Nature Structural & Molecular Biology(2004)
DNA is the MASTER PLAN. RNA is the BLUEPRINT of the Master Plan
Sec. 12-3 RNA and Protein Synthesis Roles of DNA and RNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 1 RNA uses the information from DNA to make proteins Differs from DNA: 1. Ribose
More informationI. Gene Expression Figure 1: Central Dogma of Molecular Biology
I. Gene Expression Figure 1: Central Dogma of Molecular Biology Central Dogma: Gene Expression: RNA Structure RNA nucleotides contain the pentose sugar Ribose instead of deoxyribose. Contain the bases
More informationFrom Gene to Protein
8.2 Structure of DNA From Gene to Protein deoxyribonucleic acid - (DNA) - the ultimate source of all information in a cell This information is used by the cell to produce the protein molecules which are
More informationBiology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall
Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 Essential Question What is transcription and translation and how do they take place? 3 of 39 12 3 RNA and Protein Synthesis Genes are coded
More informationBiology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall
Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 12 3 RNA and Protein Synthesis Genes are coded DNA instructions that control the production of proteins. Genetic messages can be decoded by
More informationGene Expression Transcription/Translation Protein Synthesis
Gene Expression Transcription/Translation Protein Synthesis 1. Describe how genetic information is transcribed into sequences of bases in RNA molecules and is finally translated into sequences of amino
More informationDNA Structure and Replication, and Virus Structure and Replication Test Review
DNA Structure and Replication, and Virus Structure and Replication Test Review What does DNA stand for? Deoxyribonucleic Acid DNA is what type of macromolecule? DNA is a nucleic acid The building blocks
More informationDNA, RNA, and PROTEIN SYNTHESIS
DNA, RNA, and PROTEIN SYNTHESIS 1 DNA DNA contains genes, sequences of nucleotide bases The genes code for polypeptides (proteins) Proteins are used to build cells and do much of the work inside cells
More informationPROTEIN SYNTHESIS. copyright cmassengale
PROTEIN SYNTHESIS 1 DNA and Genes 2 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 3 RNA Differs from DNA RNA has a sugar ribose DNA has a sugar deoxyribose 4 Other
More informationKey Area 1.3: Gene Expression
Key Area 1.3: Gene Expression RNA There is a second type of nucleic acid in the cell, called RNA. RNA plays a vital role in the production of protein from the code in the DNA. What is gene expression?
More informationVideos. Lesson Overview. Fermentation
Lesson Overview Fermentation Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast
More informationPROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein
PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein This is also known as: The central dogma of molecular biology Protein Proteins are made
More informationBio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes?
Bio11 Announcements TODAY Genetics (review) and quiz (CP #4) Structure and function of DNA Extra credit due today Next week in lab: Case study presentations Following week: Lab Quiz 2 Ch 21: DNA Biology
More informationProtein Synthesis. DNA to RNA to Protein
Protein Synthesis DNA to RNA to Protein From Genes to Proteins Processing the information contained in DNA into proteins involves a sequence of events known as gene expression and results in protein synthesis.
More informationIndependent Study Guide The Blueprint of Life, from DNA to Protein (Chapter 7)
Independent Study Guide The Blueprint of Life, from DNA to Protein (Chapter 7) I. General Principles (Chapter 7 introduction) a. Morse code distinct series of dots and dashes encode the 26 letters of the
More information(deoxyribonucleic acid)
1 The Central Dogma of Molecular Biology Mark Mayo Cypress College 2 The Central Dogma of Molecular Biology 3 Importance of Proteins There are three main kinds: structural - make up most body parts hormone
More informationNotes: (Our Friend) DNA. DNA Structure DNA is composed of 2 chains of repeating. A nucleotide = + +
Notes: (Our Friend) DNA Some DNA Basics DNA stands for DNA functions to & genetic info. This information tells an organism s cells what to make and when to make them. Proteins form cell structures and
More informationDNA RNA PROTEIN. Professor Andrea Garrison Biology 11 Illustrations 2010 Pearson Education, Inc. unless otherwise noted
DNA RNA PROTEIN Professor Andrea Garrison Biology 11 Illustrations 2010 Pearson Education, Inc. unless otherwise noted DNA Molecule of heredity Contains all the genetic info our cells inherit Determines
More informationDNA Structure DNA Nucleotide 3 Parts: 1. Phosphate Group 2. Sugar 3. Nitrogen Base
DNA,, RNA,, AND PROTEIN SYNTHESIS DNA Deoxyribonucleic Acid Enables cells to have different forms and perform different functions Primary functions of DNA: Store and transmit genetic information that tells
More informationRNA and Protein Synthesis
RNA and Protein Synthesis CTE: Agriculture and Natural Resources: C5.3 Understand various cell actions, such as osmosis and cell division. C5.4 Compare and contrast plant and animal cells, bacteria, and
More informationName Date Class. The Central Dogma of Biology
Concept Mapping The Central Dogma of Biology Complete the events chain showing the events that occur as DNA codes for RNA, which guides the synthesis of proteins, the central dogma of biology. These terms
More informationReplication Review. 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells?
Replication Review 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells? 3. Where does DNA Replication take place in the cell cycle? 4. 4. What guides DNA Replication?
More informationChapter 10: Gene Expression and Regulation
Chapter 10: Gene Expression and Regulation Fact 1: DNA contains information but is unable to carry out actions Fact 2: Proteins are the workhorses but contain no information THUS Information in DNA must
More informationUnit 5 DNA, RNA, and Protein Synthesis
1 Biology Unit 5 DNA, RNA, and Protein Synthesis 5:1 History of DNA Discovery Fredrick Griffith-conducted one of the first experiment s in 1928 to suggest that bacteria are capable of transferring genetic
More informationChapter 12. DNA TRANSCRIPTION and TRANSLATION
Chapter 12 DNA TRANSCRIPTION and TRANSLATION 12-3 RNA and Protein Synthesis WARM UP What are proteins? Where do they come from? From DNA to RNA to Protein DNA in our cells carry the instructions for making
More informationProtein Synthesis: Transcription and Translation
Protein Synthesis: Transcription and Translation Proteins In living things, proteins are in charge of the expression of our traits (hair/eye color, ability to make insulin, predisposition for cancer, etc.)
More informationDNA, RNA, and Protein Synthesis
http://faculty.uca.edu/~johnc/mbi1440.htm DNA, RNA, and Protein Synthesis http://www.wappingersschools.org/rck/staff/teacherhp/johnson/visualvocab/mrna.gif DNA base pairs carry the genetic Section 12-1
More informationPROTEIN SYNTHESIS. copyright cmassengale
PROTEIN SYNTHESIS 1 DNA and Genes 2 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 3 RNA Differs from DNA RNA has a sugar ribose DNA has a sugar deoxyribose 4 Other
More informationHello! Outline. Cell Biology: RNA and Protein synthesis. In all living cells, DNA molecules are the storehouses of information. 6.
Cell Biology: RNA and Protein synthesis In all living cells, DNA molecules are the storehouses of information Hello! Outline u 1. Key concepts u 2. Central Dogma u 3. RNA Types u 4. RNA (Ribonucleic Acid)
More informationVideos. Bozeman Transcription and Translation: Drawing transcription and translation:
Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast RNA and DNA. 29b) I can explain
More informationResources. How to Use This Presentation. Chapter 10. Objectives. Table of Contents. Griffith s Discovery of Transformation. Griffith s Experiments
How to Use This Presentation To View the presentation as a slideshow with effects select View on the menu bar and click on Slide Show. To advance through the presentation, click the right-arrow key or
More informationChapter 14: From DNA to Protein
Chapter 14: From DNA to Protein Steps from DNA to Proteins Same two steps produce all proteins: 1) DNA is transcribed to form RNA Occurs in the nucleus RNA moves into cytoplasm 2) RNA is translated in
More informationWhat happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!!
What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!! Protein Synthesis/Gene Expression Why do we need to make proteins? To build parts for our body as
More informationDNA RNA PROTEIN SYNTHESIS -NOTES-
DNA RNA PROTEIN SYNTHESIS -NOTES- THE COMPONENTS AND STRUCTURE OF DNA DNA is made up of units called nucleotides. Nucleotides are made up of three basic components:, called deoxyribose in DNA In DNA, there
More informationLesson 8. DNA: The Molecule of Heredity. Gene Expression and Regulation. Introduction to Life Processes - SCI 102 1
Lesson 8 DNA: The Molecule of Heredity Gene Expression and Regulation Introduction to Life Processes - SCI 102 1 Genes and DNA Hereditary information is found in discrete units called genes Genes are segments
More informationRNA, & PROTEIN SYNTHESIS. 7 th Grade, Week 4, Day 1 Monday, July 15, 2013
RNA, & PROTEIN SYNTHESIS 7 th Grade, Week 4, Day 1 Monday, July 15, 2013 The Central Dogma RNA vs. DNA Ribonucleic Acid RNA is required for translation of genetic information stored in DNA into protein
More information6.C: Students will explain the purpose and process of transcription and translation using models of DNA and RNA
6.C: Students will explain the purpose and process of transcription and translation using models of DNA and RNA DNA mrna Protein DNA is found in the nucleus, but making a protein occurs at the ribosome
More informationProkaryotic Transcription
Prokaryotic Transcription Transcription Basics DNA is the genetic material Nucleic acid Capable of self-replication and synthesis of RNA RNA is the middle man Nucleic acid Structure and base sequence are
More informationRNA & PROTEIN SYNTHESIS
RNA & PROTEIN SYNTHESIS DNA & RNA Genes are coded DNA instructions that control the production of proteins within the cell. The first step in decoding these genetic messages is to copy part of the nucleotide
More informationوراثة األحياء الدقيقة Microbial Genetics
وراثة األحياء الدقيقة Microbial Genetics د. تركي محمد الداود مكتب 2 ب 45 أساسيات في علم الوراثة Fundamentals of Genetics Lecture 4 Physical Chemistry of Nucleic Acids DNA and RNA molecules can appear in
More informationHow do we know what the structure and function of DNA is? - Double helix, base pairs, sugar, and phosphate - Stores genetic information
DNA: CH 13 How do we know what the structure and function of DNA is? - Double helix, base pairs, sugar, and phosphate - Stores genetic information Discovering DNA s Function 1928: Frederick Griffith studied
More informationName 10 Molecular Biology of the Gene Test Date Study Guide You must know: The structure of DNA. The major steps to replication.
Name 10 Molecular Biology of the Gene Test Date Study Guide You must know: The structure of DNA. The major steps to replication. The difference between replication, transcription, and translation. How
More informationChapter 8. Microbial Genetics. Lectures prepared by Christine L. Case. Copyright 2010 Pearson Education, Inc.
Chapter 8 Microbial Genetics Lectures prepared by Christine L. Case Structure and Function of Genetic Material Learning Objectives 8-1 Define genetics, genome, chromosome, gene, genetic code, genotype,
More informationChapter 13 - Concept Mapping
Chapter 13 - Concept Mapping Using the terms and phrases provided below, complete the concept map showing the discovery of DNA structure. amount of base pairs five-carbon sugar purine DNA polymerases Franklin
More informationDNA. translation. base pairing rules for DNA Replication. thymine. cytosine. amino acids. The building blocks of proteins are?
2 strands, has the 5-carbon sugar deoxyribose, and has the nitrogen base Thymine. The actual process of assembling the proteins on the ribosome is called? DNA translation Adenine pairs with Thymine, Thymine
More informationUNIT 3 GENETICS LESSON #41: Transcription
UNIT 3 GENETICS LESSON #41: Transcription Objective: Explain how transcription converts a gene into a singlestranded RNA molecule. Suppose you want to play a game but you need tokens and you only have
More informationName: Period: Date: BIOLOGY HONORS DNA REVIEW GUIDE (extremely in detail) by Trung Pham. 5. What two bases are classified as purines? pyrimidine?
BIOLOGY HONORS DNA REVIEW GUIDE (extremely in detail) by Trung Pham 1. What is the base pair rule for DNA? RNA? 2. What is the sugar found in RNA called? 3. is replaced by the base uracil in RNA? 4. What
More information2. From the first paragraph in this section, find three ways in which RNA differs from DNA.
Name Chapter 17: From Gene to Protein Begin reading at page 328 Basic Principles of Transcription and Translation. Work on this chapter a single concept at a time, and expect to spend at least 6 hours
More informationUnit VII DNA to RNA to protein The Central Dogma
Unit VII DNA to RNA to protein The Central Dogma DNA Deoxyribonucleic acid, the material that contains information that determines inherited characteristics. A DNA molecule is shaped like a spiral staircase
More informationProtein Synthesis: From Gene RNA Protein Trait
Protein Synthesis: From Gene RNA Protein Trait Human Genome The human genome contains about genes. Each gene is a of DNA (sequence of nitrogen bases) contained within each chromosome. Each chromosome contains
More informationC. Incorrect! Threonine is an amino acid, not a nucleotide base.
MCAT Biology - Problem Drill 05: RNA and Protein Biosynthesis Question No. 1 of 10 1. Which of the following bases are only found in RNA? Question #01 (A) Ribose. (B) Uracil. (C) Threonine. (D) Adenine.
More informationExpression of the genome. Books: 1. Molecular biology of the gene: Watson et al 2. Genetics: Peter J. Russell
Expression of the genome Books: 1. Molecular biology of the gene: Watson et al 2. Genetics: Peter J. Russell 1 Transcription 1. Francis Crick (1956) named the flow of information from DNA RNA protein the
More informationSection 3: DNA Replication
Section 3: DNA Replication Main Idea: Replication- process by which DNA is copied during the cell cycle DNA Polymerase- a group of enzymes that bond the new nucleotides together 1 DNA Replication Replication
More informationCHapter 14. From DNA to Protein
CHapter 14 From DNA to Protein How? DNA to RNA to Protein to Trait Types of RNA 1. Messenger RNA: carries protein code or transcript 2. Ribosomal RNA: part of ribosomes 3. Transfer RNA: delivers amino
More informationBundle 6 Test Review
Bundle 6 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? Deoxyribonucleic
More informationFeedback D. Incorrect! No, although this is a correct characteristic of RNA, this is not the best response to the questions.
Biochemistry - Problem Drill 23: RNA No. 1 of 10 1. Which of the following statements best describes the structural highlights of RNA? (A) RNA can be single or double stranded. (B) G-C pairs have 3 hydrogen
More informationUnit IX Problem 3 Genetics: Basic Concepts in Molecular Biology
Unit IX Problem 3 Genetics: Basic Concepts in Molecular Biology - The central dogma (principle) of molecular biology: Information from DNA are transcribed to mrna which will be further translated to synthesize
More informationNucleic Acids: DNA and RNA
Nucleic Acids: DNA and RNA Living organisms are complex systems. Hundreds of thousands of proteins exist inside each one of us to help carry out our daily functions. These proteins are produced locally,
More informationGenes are coded DNA instructions that control the production of proteins within a cell. The first step in decoding genetic messages is to copy a part
Genes are coded DNA instructions that control the production of proteins within a cell. The first step in decoding genetic messages is to copy a part of the nucleotide sequence of the DNA into RNA. RNA
More informationBiotechnology Unit 3: DNA to Proteins. From DNA to RNA
From DNA to RNA Biotechnology Unit 3: DNA to Proteins I. After the discovery of the structure of DNA, the major question remaining was how does the stored in the 4 letter code of DNA direct the and of
More informationWhy are proteins important?
PROTEIN SYNTHESIS Why are proteins important? proteins help build cell structures some proteins are enzymes that promote biological reactions Proteins are found in muscles, blood, bones, etc.. RNA RNA
More informationThe Genetic Code and Transcription. Chapter 12 Honors Genetics Ms. Susan Chabot
The Genetic Code and Transcription Chapter 12 Honors Genetics Ms. Susan Chabot TRANSCRIPTION Copy SAME language DNA to RNA Nucleic Acid to Nucleic Acid TRANSLATION Copy DIFFERENT language RNA to Amino
More informationMolecular Genetics. The flow of genetic information from DNA. DNA Replication. Two kinds of nucleic acids in cells: DNA and RNA.
Molecular Genetics DNA Replication Two kinds of nucleic acids in cells: DNA and RNA. DNA function 1: DNA transmits genetic information from parents to offspring. DNA function 2: DNA controls the functions
More informationChapter 12 Notes DNA
Chapter 12 Notes DNA What makes up Genes? 3 teams of scientists answered this question. 1. Griffith Transformation 2. Avery DNA destroying protein 3. Hershey-Chase -- virus Griffith used bacteria 2 types
More informationNeurospora mutants. Beadle & Tatum: Neurospora molds. Mutant A: Mutant B: HOW? Neurospora mutants
Chapter 10: Central Dogma Gene Expression and Regulation Mutant A: Neurospora mutants Mutant B: Not made Not made Fact 1: DNA contains information but is unable to carry out actions Fact 2: Proteins are
More informationStructure. Structural Components of Nucleotides Base. Sugar. Introduction Nucleotide to Cells & Microscopy and Nucleic Acid. Phosphate Glycosidic bond
11 Structural Components of Nucleotides Base Sugar Introduction Nucleotide to Cells & Microscopy and Nucleic Acid Structure Phosphate Glycosidic bond H NUCLEOTIDE H Nucleic acid polymer of nucleotides
More informationLecture Overview. Overview of the Genetic Information. Marieb s Human Anatomy and Physiology. Chapter 3 DNA & RNA Protein Synthesis Lecture 6
Marieb s Human Anatomy and Physiology Marieb Hoehn Chapter 3 DNA & RNA Protein Synthesis Lecture 6 Lecture Overview The Genetic Information Structure of DNA/RNA DNA Replication Overview of protein synthesis
More informationBundle 5 Test Review
Bundle 5 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? _Nucleic
More informationChapter 10 - Molecular Biology of the Gene
Bio 100 - Molecular Genetics 1 A. Bacterial Transformation Chapter 10 - Molecular Biology of the Gene Researchers found that they could transfer an inherited characteristic (e.g. the ability to cause pneumonia),
More informationBiology. DNA & the Language of Life
Biology DNA & the Language of Life Genes are Made of DNA Fredrick Griffith (1928) studied pneumonia strains (one was harmless while the other was pathogenic, or disease-causing) Made non-harmful strains
More informationBig Idea 3C Basic Review
Big Idea 3C Basic Review 1. A gene is a. A sequence of DNA that codes for a protein. b. A sequence of amino acids that codes for a protein. c. A sequence of codons that code for nucleic acids. d. The end
More informationDNA and RNA. Chapter 12
DNA and RNA Chapter 12 Warm Up Exercise Test Corrections Make sure to indicate your new answer and provide an explanation for why this is the correct answer. Do this with a red pen in the margins of your
More informationSections 12.3, 13.1, 13.2
Sections 12.3, 13.1, 13.2 Background: Watson & Crick recognized that base pairing in the double helix allows DNA to be copied, or replicated Each strand in the double helix has all the information to remake
More informationProtein Synthesis
HEBISD Student Expectations: Identify that RNA Is a nucleic acid with a single strand of nucleotides Contains the 5-carbon sugar ribose Contains the nitrogen bases A, G, C and U instead of T. The U is
More informationNucleic Acid Structure:
Genetic Information In Microbes: The genetic material of bacteria and plasmids is DNA. Bacterial viruses (bacteriophages or phages) have DNA or RNA as genetic material. The two essential functions of genetic
More informationGene Expression: Transcription, Translation, RNAs and the Genetic Code
Lecture 28-29 Gene Expression: Transcription, Translation, RNAs and the Genetic Code Central dogma of molecular biology During transcription, the information in a DNA sequence (a gene) is copied into a
More informationBiology Celebration of Learning (100 points possible)
Name Date Block Biology Celebration of Learning (100 points possible) Matching (1 point each) 1. Codon a. process of copying DNA and forming mrna 2. Genes b. section of DNA coding for a specific protein
More informationBiology 30 DNA Review: Importance of Meiosis nucleus chromosomes Genes DNA
Biology 30 DNA Review: Importance of Meiosis Every cell has a nucleus and every nucleus has chromosomes. The number of chromosomes depends on the species. o Examples: Chicken 78 Chimpanzee 48 Potato 48
More informationMBioS 503: Section 1 Chromosome, Gene, Translation, & Transcription. Gene Organization. Genome. Objectives: Gene Organization
Overview & Recap of Molecular Biology before the last two sections MBioS 503: Section 1 Chromosome, Gene, Translation, & Transcription Gene Organization Joy Winuthayanon, PhD School of Molecular Biosciences
More informationUnit II Problem 3 Genetics: Summary of Basic Concepts in Molecular Biology
Unit II Problem 3 Genetics: Summary of Basic Concepts in Molecular Biology - The central dogma (principle) of molecular biology: Information from DNA are transcribed to mrna which will be further translated
More informationMake the protein through the genetic dogma process.
Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino
More informationClick here to read the case study about protein synthesis.
Click here to read the case study about protein synthesis. Big Question: How do cells use the genetic information stored in DNA to make millions of different proteins the body needs? Key Concept: Genetics
More informationDNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test
DNA is the genetic material Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test Dr. Amy Rogers Bio 139 General Microbiology Hereditary information is carried by DNA Griffith/Avery
More informationUnit 1: DNA and the Genome. Sub-Topic (1.3) Gene Expression
Unit 1: DNA and the Genome Sub-Topic (1.3) Gene Expression Unit 1: DNA and the Genome Sub-Topic (1.3) Gene Expression On completion of this subtopic I will be able to State the meanings of the terms genotype,
More informationChapter 8: DNA and RNA
Chapter 8: DNA and RNA Lecture Outline Enger, E. D., Ross, F. C., & Bailey, D. B. (2012). Concepts in biology (14th ed.). New York: McGraw- Hill. 1 8-1 DNA and the Importance of Proteins Proteins play
More informationChapter 8 From DNA to Proteins. Chapter 8 From DNA to Proteins
KEY CONCEPT Section 1 DNA was identified as the genetic material through a series of experiments. Griffith finds a transforming principle. Griffith experimented with the bacteria that cause pneumonia.
More informationDNA, RNA and protein synthesis
DNA, RNA and protein synthesis DNA is deoxyribonucleic acid DNA contains all the genetic instructions for making proteins within the cell. Each DNA molecule is made of repeating subunits called nucleotides.
More informationAdv Biology: DNA and RNA Study Guide
Adv Biology: DNA and RNA Study Guide Chapter 12 Vocabulary -Notes What experiments led up to the discovery of DNA being the hereditary material? o The discovery that DNA is the genetic code involved many
More information13.1 RNA Lesson Objectives Contrast RNA and DNA. Explain the process of transcription.
13.1 RNA Lesson Objectives Contrast RNA and DNA. Explain the process of transcription. The Role of RNA 1. Complete the table to contrast the structures of DNA and RNA. DNA Sugar Number of Strands Bases
More informationProtein Synthesis Foldable
Ameoba Sisters Protein Synthesis Foldable Transcription What? How? What are the steps? Location? Why? Draw a picture to represent this. Translation What? How? What are the steps? Location? Why? Draw a
More informationLecture Overview. Overview of the Genetic Information. Chapter 3 DNA & RNA Lecture 6
Visual Anatomy & Physiology First Edition Martini & Ober Chapter 3 DNA & RNA Lecture 6 Lecture Overview What is the cell s genetic information? How/where is the genetic information stored in eukaryotic
More informationChapter 12: Molecular Biology of the Gene
Biology Textbook Notes Chapter 12: Molecular Biology of the Gene p. 214-219 The Genetic Material (12.1) - Genetic Material must: 1. Be able to store information that pertains to the development, structure,
More informationNUCLEIC ACIDS AND PROTEIN SYNTHESIS
NUCLEIC ACIDS AND PROTEIN SYNTHESIS DNA Cell Nucleus Chromosomes is a coiled double helix carrying hereditary information of the cell Contains the instructions for making from 20 different amino acids
More informationNucleic acids deoxyribonucleic acid (DNA) ribonucleic acid (RNA) nucleotide
Nucleic Acids Nucleic acids are molecules that store information for cellular growth and reproduction There are two types of nucleic acids: - deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) These
More informationDNA Function: Information Transmission
DNA Function: Information Transmission DNA is called the code of life. What does it code for? *the information ( code ) to make proteins! Why are proteins so important? Nearly every function of a living
More informationDNA. Essential Question: How does the structure of the DNA molecule allow it to carry information?
DNA Essential Question: How does the structure of the DNA molecule allow it to carry information? Fun Website to Explore! http://learn.genetics.utah.edu/content/molecules/ DNA History Griffith Experimented
More informationTranscription steps. Transcription steps. Eukaryote RNA processing
Transcription steps Initiation at 5 end of gene binding of RNA polymerase to promoter unwinding of DNA Elongation addition of nucleotides to 3 end rules of base pairing requires Mg 2+ energy from NTP substrates
More informationProtein Synthesis ~Biology AP~
Protein Synthesis ~Biology AP~ A Meridian Study Guide by David Guan, Jennifer Zheng [Edited by Lei Gong] Introduction: - DNA and RNA are essential for life because they code for enzymes, which regulate
More informationBiology 3201 Genetics Unit #5
Biology 3201 Genetics Unit #5 Protein Synthesis Protein Synthesis Protein synthesis: this is the process whereby instructions from DNA are used to create polypeptides that make up a protein. This process
More informationNucleic acids and protein synthesis
THE FUNCTIONS OF DNA Nucleic acids and protein synthesis The full name of DNA is deoxyribonucleic acid. Every nucleotide has the same sugar molecule and phosphate group, but each nucleotide contains one
More information