6/256 1/256 0/256 1/256 2/256 7/256 10/256. At3g06290 (SAC3B)
|
|
|
- Timothy Bridges
- 5 years ago
- Views:
Transcription
1 Chr.III M 5M 1M 15M 2M 23M BAC clones F22F7 F1A16 F24F17 F24P17 T8E24 F17A9 F21O3 F17A17 F18C1 F2O1 F28L1 F5E6 F3E22 T1B9 MLP3 Number of recombinants 6/256 1/256 /256 1/256 2/256 7/256 1/256 At3g629 (SAC3B) TAG (8175) ATG p31 (sac3b-6) C(1321)AA TAA Gln Stop codon Figure S1. Map-based cloning and characterization of the SAC3B. Genetic mapping delimited the p31 mutation between the BAC clone F2O1 and T8E24 in a mapping interval between K and K on chromosome 3. Whole genome sequencing was subsequently performed to search all mutations in the p31 mutant. SAC3B was identified by sequence alignment of p31 and in the mapping interval. Schematic of the SAC3B are shown and the position of the mutation is as indicated. Black boxes indicate the exons and lines between boxes indicate introns.
![[A] [D] Figure S2. Morphological phenotypes of and.](/docs-images/83/87811479/images/2-0.jpg "[A] Schematic of At3g629 and insertion sites (left) and genotyping results (right) of and.")
2 [A] [D] Figure S2. Morphological phenotypes of and. [A] Schematic of At3g629 and insertion sites (left) and genotyping results (right) of and. Compared to wild type plants, and both show shorter roots, reduced height, and downward curly leaves [D].
![% of input % of input % of input [A] nua-3 thp1-1.16.12.8.4 H3K9me2 d35s d35sluc d35snptii TUB8 d35s d35sluc d35snptii TUB8 nua-3-d35sluc H3K9me2 NoAb [D].5.4.3.2.1 Pol II nua-3-d35sluc d35s d35sluc d35snptii TUB8 d35s d35sluc d35snptii TUB8 Pol II II NoAb [E] 1.](/docs-images/83/87811479/images/3-0.jpg "8.6.4.2 H3K27me p31 nua-3-d35sluc d35s d35sluc d35snptii TSI TUB8 d35s d35sluc d35snptii TSI TUB8 H3K27me NoAb Figure S3. Characterization of nua-3 and thp1-1 mutants.")
![[A] Genotyping of nua-3 and thp1-1 mutants. thp1-1-d35sluc plants show severe morphological phenotypes compared to wild type.](/docs-images/83/87811479/images/3-1.jpg "The numbers 1 to 18 indicate individual lines of thp1-1-d35sluc mutants.")
![and [D] show ChIP-qPCR analyses of H3K9me2 levels and RNA polymerase Pol II occupancy, respectively, at d35s promoter regions in the nua-3- d35sluc mutant compared to.](/docs-images/83/87811479/images/3-2.jpg "[E] ChIP-qPCR analyses of H3K27me levels at d35s promoter regions in p31 and nua-3-d35sluc mutant compared to. Error bars indicate SD from three technical repeats.")
3 % of input % of input % of input [A] nua-3 thp H3K9me2 d35s d35sluc d35snptii TUB8 d35s d35sluc d35snptii TUB8 nua-3-d35sluc H3K9me2 NoAb [D] Pol II nua-3-d35sluc d35s d35sluc d35snptii TUB8 d35s d35sluc d35snptii TUB8 Pol II II NoAb [E] H3K27me p31 nua-3-d35sluc d35s d35sluc d35snptii TSI TUB8 d35s d35sluc d35snptii TSI TUB8 H3K27me NoAb Figure S3. Characterization of nua-3 and thp1-1 mutants. [A] Genotyping of nua-3 and thp1-1 mutants. thp1-1-d35sluc plants show severe morphological phenotypes compared to wild type. The numbers 1 to 18 indicate individual lines of thp1-1-d35sluc mutants. and [D] show ChIP-qPCR analyses of H3K9me2 levels and RNA polymerase Pol II occupancy, respectively, at d35s promoter regions in the nua-3- d35sluc mutant compared to. [E] ChIP-qPCR analyses of H3K27me levels at d35s promoter regions in p31 and nua-3-d35sluc mutant compared to. Error bars indicate SD from three technical repeats. Results were confirmed by three biological replicates.
![Percent of s Percent of s [A] VS down regulated s (total](/docs-images/83/87811479/images/4-1.jpg "348) 24 Input list Background 18 12 6 12 Input list VS")
4 1 3 Genome Up Down Genome Up Down Genome Up Down 3 4 Length (bp) GC content (%) FPKM level Percent of s Percent of s [A] VS down regulated s (total 348) 24 Input list Background Input list VS up-regulated s (total 276) Background Figure S4. RNAseq data analysis of differently expressed s (DEGs) between and. GO enrichment analysis of downregulated [A] or up-regulated s in mutants compared to. Box-plot figures showing DEG characteristics in terms of length (left panel), GC content (middle panel), and expression level (right panel).
![RNA sq DNA methylation % of input % of input Relative expression level [A] 1.2 1.8.6.4.2.2.15.1.5 sac3b downregulated s AT4G1521 At3g2855 At2g551 p31 sac3b-4 (FPKM) (FPKM) AT4G1521.875.3 AT3G2855 95.](/docs-images/83/87811479/images/5-2.jpg "735 23.6 AT2G551 37.45 14.15 genome mean 18.155 16.74 At4g1521 At3g2855 At2g551 Actin7 At4g1521 At3g2855 At2g551 Actin7 H3K9me2 H3K9me2 NoAb NoAb p31 p31 [D].12.8 Pol II p31.")
5 RNA sq DNA methylation % of input % of input Relative expression level [A] sac3b downregulated s AT4G1521 At3g2855 At2g551 p31 sac3b-4 (FPKM) (FPKM) AT4G AT3G AT2G genome mean At4g1521 At3g2855 At2g551 Actin7 At4g1521 At3g2855 At2g551 Actin7 H3K9me2 H3K9me2 NoAb NoAb p31 p31 [D].12.8 Pol II p31.4 At4g1521 At3g2855 At2g551 Actin7 At4g1521 At3g2855 At2g551 Actin7 Pol II II NoAb NoAb [E] At4g1521 At3g2855 At2g551 Figure S5. sac3b mutation caused epitic silencing of the endogenous s. Relative expression levels of At4g1521, At3g2855 and At2g551 in p31 and mutants compared to their wild type plants. RT-qPCR [A] and RNAseq results were shown. SAC3B dysfunction increases H3K9me2 level and decreases chromatin occupancy of Pol II [D] at tested loci. Error bars indicate SD from three technical repeats. Results were confirmed by three biological replicates. A house-keeping, Actin7, serves as a control. [E] Snapshots from whole genome bisulfite sequencing and RNAseq data showing DNA methylation and expression at the endogenous loci, respectively.
![[A] FLC (1+2R) sense-1 sense-2f sense-2r 3 1 st 35S 2 nd 35S Interspacer LUC 1 st 35S 2 nd 35S interspacer](/docs-images/83/87811479/images/6-0.jpg "LUC coding region 1 st 35S 2 nd 35S p31 interspacer LUC coding region Figure S6.")
6 [A] FLC (1+2R) sense-1 sense-2f sense-2r 3 1 st 35S 2 nd 35S Interspacer LUC 1 st 35S 2 nd 35S interspacer LUC coding region 1 st 35S 2 nd 35S p31 interspacer LUC coding region Figure S6. Detection of DNA:RNA hybridization by R-loop footprinting. [A] Sequence analysis of individual clones showing R-loop footprinting at FLC locus amplified by FLC-1 / FLC-2R primers (Sun et al., 213) in. Positions of primers used in R-loop footprinting experiment (sense-1+sense-2r and sense-2f+sense-3). Sequence analysis of individual clones showing R-loop footprinting amplified by sense-1/sense-2r and sense-2f/sense-3 primer pairs in (upper panel) and p31 (lower panel).
7 d35sluc template strand anti-1 LUC Interspacer 2 nd 35S 1 st 35S anti-2r part of LUC interspacer part of LUC interspacer p31 Figure S7. Sequence analysis of individual clones from and p31. Positions of primers used in R-loop footprinting experiments of d35s::luc template strand are as indicated.
8 Frequence Percent (%) [A] Length distribution col- sac3b-4 sac3b Hypo DSR total (635 loci) 24nt (47 loci) 21nt DSR (81 loci) Hyper DSR total (55 loci) 24nt (45 loci) 21nt DSR (48 loci) Figure S8. SAC3B mutations alter small RNAs acumulation [A] Patterns of small RNA size distribution and global small RNA abundance. Categorization of hypo-dsrs identified in both and. Categorization of hyper-dsrs identified in both and.
![24nt sirna 21nt sirna DNA methylation 24nt sirna 21nt sirna DNA methylation [A] TAS1b TAS1c](/docs-images/83/87811479/images/9-2.jpg "Chr3:212771-212775 Chr5:71851-71855 IR71 TAS3a (At3g17185) TAS3b (At5g49615) TAS3c (At5g57735)")
![[A] SAC3B mutations reduce levels of DNA methylation and sirna accumulation at TAS1b, TAS1c,](/docs-images/83/87811479/images/9-4.jpg "Chr3:212771-212775, and Chr5:71851-71855.")
9 24nt sirna 21nt sirna DNA methylation 24nt sirna 21nt sirna DNA methylation [A] TAS1b TAS1c Chr3: Chr5: IR71 TAS3a (At3g17185) TAS3b (At5g49615) TAS3c (At5g57735) Figure S9. Examples of loci where DNA methylation and sirna levels are dependent or independent of SAC3B. [A] SAC3B mutations reduce levels of DNA methylation and sirna accumulation at TAS1b, TAS1c, Chr3: , and Chr5: DNA methylation and sirna accumulation at IR71, TAS3a, TAS3b, and TAS3c. Snapshots from whole genome bisulfite sequencing and sirnaseq data are shown.
10 [A] Hypo DMR Hyper DMR (337) 2 (267) (454) 121 (356) sac3b hypo DMRs (total 2) sac3b hyper DMRs (total 121) Figure S1. The number of hypo [A] and hyper DMRs compared to the, and the compositions of the overlapped hyper and hypo DMRs between and.
Supplemental Figure legends Figure S1. (A) (B) (C) (D) Figure S2. Figure S3. (A-E) Figure S4. Figure S5. (A, C, E, G, I) (B, D, F, H, Figure S6.
Supplemental Figure legends Figure S1. Map-based cloning and complementation testing for ZOP1. (A) ZOP1 was mapped to a ~273-kb interval on Chromosome 1. In the interval, a single-nucleotide G to A substitution
Supplemental Figure 1 A
Supplemental Figure 1 A Supplemental Data. Han et al. (2016). Plant Cell 10.1105/tpc.15.00997 BamHI -1616 bp SINE repeats SalI ATG SacI +1653 bp HindIII LB HYG p35s pfwa LUC Tnos RB pfwa-bamhi-f: CGGGATCCCGCCTTTCTCTTCCTCATCTGC
Nature Genetics: doi: /ng Supplementary Figure 1. ChIP-seq genome browser views of BRM occupancy at previously identified BRM targets.
Supplementary Figure 1 ChIP-seq genome browser views of BRM occupancy at previously identified BRM targets. Gene structures are shown underneath each panel. Supplementary Figure 2 pref6::ref6-gfp complements
Supplemental Data. Na Xu et al. (2016). Plant Cell /tpc
Supplemental Figure 1. The weak fluorescence phenotype is not caused by the mutation in At3g60240. (A) A mutation mapped to the gene At3g60240. Map-based cloning strategy was used to map the mutated site
IDN1 and IDN2: two proteins required for de novo DNA methylation in Arabidopsis thaliana.
IDN1 and IDN2: two proteins required for de novo DNA methylation in Arabidopsis thaliana. Israel Ausin, Todd C. Mockler, Joanne Chory, and Steven E. Jacobsen Col Ler nrpd1a rdr2 dcl3-1 ago4-1 idn1-1 idn2-1
C24. ros1-1. ros1-1 rdm18-1. ros1-1 rdm18-2. ros1-1 nrpe1
Figure S1 Methylation level 1 0.8 0.6 0.4 0.2 0 p35s methylation levels 24 ros1-1 ros1-1 rdm18-1 ros1-1 rdm18-2 ros1-1 nrpe1 mg mhg mhh Figure S1. RM18/PKL promotes silencing at the p35s-npt II transgene
Supplementary Figure 1. jmj30-2 and jmj32-1 produce null mutants. (a) Schematic drawing of JMJ30 and JMJ32 genome structure showing regions amplified
Supplementary Figure 1. jmj30-2 and jmj32-1 produce null mutants. (a) Schematic drawing of JMJ30 and JMJ32 genome structure showing regions amplified by primers used for mrna expression analysis. Gray
Candidate region (0.74 Mb) ATC TCT GGG ACT CAT GAG CAG GAG GCT AGC ATC TCT GGG ACT CAT TAG CAG GAG GCT AGC
A idm-3 idm-3 B Physical distance (Mb) 4.6 4.86.6 8.4 C Chr.3 Recom. Rate (%) ATG 3.9.9.9 9.74 Candidate region (.74 Mb) n=4 TAA D idm-3 G3T(E4) G4A(W988) WT idm-3 ATC TCT GGG ACT CAT GAG CAG GAG GCT AGC
SUPPLEMENTARY INFORMATION
AS-NMD modulates FLM-dependent thermosensory flowering response in Arabidopsis NATURE PLANTS www.nature.com/natureplants 1 Supplementary Figure 1. Genomic sequence of FLM along with the splice sites. Sequencing
Supplemental Data. Zhou et al. (2016). Plant Cell /tpc
Supplemental Figure 1. Confirmation of mutant mapping results. (A) Complementation assay with stably transformed genomic fragments (ComN-N) (2 kb upstream of TSS and 1.5 kb downstream of TES) and CaMV
SAC3B, a central component of the mrna export complex TREX-2, is required for prevention of epigenetic gene silencing in Arabidopsis
Published online 26 September 26 Nucleic Acids Research, 27, Vol. 45, No. 8 97 doi:.93/nar/gkw85 SAC3B, a central component of the mrna export complex TREX-2, is required for prevention of epigenetic gene
SAC3B, a central component of the mrna export complex TREX-2, is required for prevention of epigenetic gene silencing in Arabidopsis
Published online 26 September 26 Nucleic Acids Research, 27, Vol. 45, No. 8 97 doi:.93/nar/gkw85 SAC3B, a central component of the mrna export complex TREX-2, is required for prevention of epigenetic gene
Supplementary Tables. Primers and probes. Target Primer / probe sequences Chemistry Human HBB F: AACTGTGTTCACTAGCAACCTCAAA
Supplementary Tables Primers and probes Target Primer / probe sequences Chemistry H F: AACTGTGTTCACTAGCAACCTCAAA promoter R: ACAGGGCAGTAACGGCAGACT H Downstream Actb alpha (162) alpha (162.) (Pro) (16)
Alternative Cleavage and Polyadenylation of RNA
Developmental Cell 18 Supplemental Information The Spen Family Protein FPA Controls Alternative Cleavage and Polyadenylation of RNA Csaba Hornyik, Lionel C. Terzi, and Gordon G. Simpson Figure S1, related
Supplemental Data. Jing et al. (2013). Plant Cell /tpc
Supplemental Figure 1. Characterization of epp1 Mutants. (A) Cotyledon angles of 5-d-old Col wild-type (gray bars) and epp1-1 (black bars) seedlings under red (R), far-red (FR) and blue (BL) light conditions,
Fig. S1. Clustering analysis of expression array and ChIP-PCR assay in the ARF3 locus. (A) Typical examples of the transgenic plants used for
Fig. S1. Clustering analysis of expression array and ChIP-PCR assay in the ARF3 locus. (A) Typical examples of the transgenic plants used for ChIP-chip and ChIP-PCR assays. The presence of pas1:t7:as1
Spermatazoa. Sertoli cells. Morc1 WT adult. Morc1 KO adult. Morc1 WT P14.5. Morc1 KO P14.5. Germ cells. Germ cells. Spermatids.
a. Spermatazoa Sertoli cells Morc1 WT adult c. Morc1 KO adult Morc1 WT P1.5 Morc1 KO P1.5 Morc1 WT adult Morc1 KO adult Germ cells Germ cells Spermatids Spermatozoa Supplementary Figure 1. Confirmation
Nature Genetics: doi: /ng.3556 INTEGRATED SUPPLEMENTARY FIGURE TEMPLATE. Supplementary Figure 1
INTEGRATED SUPPLEMENTARY FIGURE TEMPLATE Supplementary Figure 1 REF6 expression in transgenic lines. (a,b) Expression of REF6 in REF6-HA ref6 and REF6ΔZnF-HA ref6 plants detected by RT qpcr (a) and immunoblot
A Repressor Complex Governs the Integration of
Developmental Cell 15 Supplemental Data A Repressor Complex Governs the Integration of Flowering Signals in Arabidopsis Dan Li, Chang Liu, Lisha Shen, Yang Wu, Hongyan Chen, Masumi Robertson, Chris A.
A Naturally Occurring Epiallele associates with Leaf Senescence and Local Climate Adaptation in Arabidopsis accessions He et al.
A Naturally Occurring Epiallele associates with Leaf Senescence and Local Climate Adaptation in Arabidopsis accessions He et al. Supplementary Notes Origin of NMR19 elements Because there are two copies
Supplemental Figure 1 HDA18 has an HDAC domain and therefore has concentration dependent and TSA inhibited histone deacetylase activity.
Supplemental Figure 1 HDA18 has an HDAC domain and therefore has concentration dependent and TSA inhibited histone deacetylase activity. (A) Amino acid alignment of HDA5, HDA15 and HDA18. The blue line
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Endogenous gene tagging to study subcellular localization and chromatin binding. a, b, Schematic of experimental set-up to endogenously tag RNAi factors using the CRISPR Cas9 technology,
Jung-Nam Cho, Jee-Youn Ryu, Young-Min Jeong, Jihye Park, Ji-Joon Song, Richard M. Amasino, Bosl Noh, and Yoo-Sun Noh
Developmental Cell, Volume 22 Supplemental Information Control of Seed Germination by Light-Induced Histone Arginine Demethylation Activity Jung-Nam Cho, Jee-Youn Ryu, Young-Min Jeong, Jihye Park, Ji-Joon
Supplemental Figure 1.
Supplemental Data. Charron et al. Dynamic landscapes of four histone modifications during de-etiolation in Arabidopsis. Plant Cell (2009). 10.1105/tpc.109.066845 Supplemental Figure 1. Immunodetection
Supplementary Figure 1 An overview of pirna biogenesis during fetal mouse reprogramming. (a) (b)
Supplementary Figure 1 An overview of pirna biogenesis during fetal mouse reprogramming. (a) A schematic overview of the production and amplification of a single pirna from a transposon transcript. The
Supplemental Data. Sethi et al. (2014). Plant Cell /tpc
Supplemental Data Supplemental Figure 1. MYC2 Binds to the E-box but not the E1-box of the MPK6 Promoter. (A) E1-box and E-box (wild type) containing MPK6 promoter fragment. The region shown in red denotes
Supplemental Data. Cui et al. (2012). Plant Cell /tpc a b c d. Stem UBC32 ACTIN
A Root Stem Leaf Flower Silique Senescence leaf B a b c d UBC32 ACTIN C * Supplemental Figure 1. Expression Pattern and Protein Sequence of UBC32 Homologues in Yeast, Human, and Arabidopsis. (A) Expression
Supplementary Information
Supplementary Information Super-resolution imaging of fluorescently labeled, endogenous RNA Polymerase II in living cells with CRISPR/Cas9-mediated gene editing Won-Ki Cho 1, Namrata Jayanth 1, Susan Mullen
Schematic representation of the endogenous PALB2 locus and gene-disruption constructs
Supplementary Figures Supplementary Figure 1. Generation of PALB2 -/- and BRCA2 -/- /PALB2 -/- DT40 cells. (A) Schematic representation of the endogenous PALB2 locus and gene-disruption constructs carrying
Somatic Primary pirna Biogenesis Driven by cis-acting RNA Elements and Trans-Acting Yb
Cell Reports Supplemental Information Somatic Primary pirna Biogenesis Driven by cis-acting RNA Elements and Trans-Acting Yb Hirotsugu Ishizu, Yuka W. Iwasaki, Shigeki Hirakata, Haruka Ozaki, Wataru Iwasaki,
Construction of plant complementation vector and generation of transgenic plants
MATERIAL S AND METHODS Plant materials and growth conditions Arabidopsis ecotype Columbia (Col0) was used for this study. SALK_072009, SALK_076309, and SALK_027645 were obtained from the Arabidopsis Biological
Supplemental Data. Guo et al. (2015). Plant Cell /tpc
Supplemental Figure 1. The Mutant exb1-d Displayed Pleiotropic Phenotypes and Produced Branches in the Axils of Cotyledons. (A) Branches were developed in exb1-d but not in wild-type plants. (B) and (C)
BIOLOGY - CLUTCH CH.20 - BIOTECHNOLOGY.
!! www.clutchprep.com CONCEPT: DNA CLONING DNA cloning is a technique that inserts a foreign gene into a living host to replicate the gene and produce gene products. Transformation the process by which
Nature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1. Validation of CDK9-inhibitor treatment.
Supplementary Figure 1 Validation of CDK9-inhibitor treatment. (a) Schematic of GAPDH with the middle of the amplicons indicated in base pairs. The transcription start site (TSS) and the terminal polyadenylation
Erhard et al. (2013). Plant Cell /tpc
Supplemental Figure 1. c1-hbr allele structure. Diagram of the c1-hbr allele found in stocks segregating 1:1 for rpd1-1 and rpd1-2 homozygous mutants showing the presence of a 363 base pair (bp) Heartbreaker
Enzyme that uses RNA as a template to synthesize a complementary DNA
Biology 105: Introduction to Genetics PRACTICE FINAL EXAM 2006 Part I: Definitions Homology: Comparison of two or more protein or DNA sequence to ascertain similarities in sequences. If two genes have
Arabidopsis actin depolymerizing factor AtADF4 mediates defense signal transduction triggered by the Pseudomonas syringae effector AvrPphB
Arabidopsis actin depolymerizing factor mediates defense signal transduction triggered by the Pseudomonas syringae effector AvrPphB Files in this Data Supplement: Supplemental Table S1 Supplemental Table
Lecture 2: Biology Basics Continued. Fall 2018 August 23, 2018
Lecture 2: Biology Basics Continued Fall 2018 August 23, 2018 Genetic Material for Life Central Dogma DNA: The Code of Life The structure and the four genomic letters code for all living organisms Adenine,
7.03 Fall 2003 Problem Set #3 Solutions Issued Friday, October 17, 2003
7.03 Fall 2003 Problem Set #3 Solutions Issued Friday, October 17, 2003 1. (a) We are analyzing mutagens that specifically induce G C A T mutations in DNA. Therefore, we must determine the potential double
BS 50 Genetics and Genomics Week of Oct 24
BS 50 Genetics and Genomics Week of Oct 24 Additional Practice Problems for Section Question 1: The following table contains a list of statements that apply to replication, transcription, both, or neither.
Nature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Distribution of mirnas between lncrna and protein-coding genes. Pie chart showing distribution of human mirna between protein coding and lncrna genes. To the right, lncrna mirna
SUPPLEMENTARY INFORMATION
Gene replacements and insertions in rice by intron targeting using CRISPR Cas9 Table of Contents Supplementary Figure 1. sgrna-induced targeted mutations in the OsEPSPS gene in rice protoplasts. Supplementary
SUPPLEMENT MATERIALS FOR CURTIN,
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 SUPPLEMENT MATERIALS FOR CURTIN, et al. Validating genome-wide association candidates: Selecting, testing, and characterizing
Supplementary Information
Supplementary Information MED18 interaction with distinct transcription factors regulates plant immunity, flowering time and responses to hormones Supplementary Figure 1. Diagram showing T-DNA insertion
Supplementary Figures Montero et al._supplementary Figure 1
Montero et al_suppl. Info 1 Supplementary Figures Montero et al._supplementary Figure 1 Montero et al_suppl. Info 2 Supplementary Figure 1. Transcripts arising from the structurally conserved subtelomeres
previously. co and fca-9 alleles were isolated from the Col background. Plants were
Supporting Online Material Materials and Methods Plant Growth Conditions The flc-3, FRI Sf2 -Col (S1), fve-4 (S2), ld-1 (S3) and fpa (S4) lines were described previously. co and fca-9 alleles were isolated
Supplementary Materials
Supplementary Materials Table S1. Oligonucleotide sequences and PCR conditions used to amplify the indicated genes. TA = annealing temperature; gdna = genomic DNA; cdna = complementary DNA; c = concentration.
Molecular Genetics of Disease and the Human Genome Project
9 Molecular Genetics of Disease and the Human Genome Project Fig. 1. The 23 chromosomes in the human genome. There are 22 autosomes (chromosomes 1 to 22) and two sex chromosomes (X and Y). Females inherit
Genome research in eukaryotes
Functional Genomics Genome and EST sequencing can tell us how many POTENTIAL genes are present in the genome Proteomics can tell us about proteins and their interactions The goal of functional genomics
Chemical and/or enzymatic deamination across various sequencing methods to localize modified cytosines.
Supplementary Figure 1 Chemical and/or enzymatic deamination across various sequencing methods to localize modified cytosines. (a) Upon treatment with bisulfite under acidic conditions and at elevated
Supplementary Figure 1. Nature Structural & Molecular Biology: doi: /nsmb.3494
Supplementary Figure 1 Pol structure-function analysis (a) Inactivating polymerase and helicase mutations do not alter the stability of Pol. Flag epitopes were introduced using CRISPR/Cas9 gene targeting
GENETICS - CLUTCH CH.15 GENOMES AND GENOMICS.
!! www.clutchprep.com CONCEPT: OVERVIEW OF GENOMICS Genomics is the study of genomes in their entirety Bioinformatics is the analysis of the information content of genomes - Genes, regulatory sequences,
Biology 105: Introduction to Genetics PRACTICE FINAL EXAM Part I: Definitions. Homology: Reverse transcriptase. Allostery: cdna library
Biology 105: Introduction to Genetics PRACTICE FINAL EXAM 2006 Part I: Definitions Homology: Reverse transcriptase Allostery: cdna library Transformation Part II Short Answer 1. Describe the reasons for
Nature Genetics: doi: /ng Supplementary Figure 1
Supplementary Figure 1 Ihh interacts preferentially with its upstream neighboring gene Nhej1. Genes are indicated by gray lines, and Ihh and Nhej1 are highlighted in blue. 4C seq performed in E14.5 limbs
Supporting Information
Supporting Information Park et al. 10.1073/pnas.1410555111 5 -TCAAGTCCATCTACATGGCC-3 5 -CAGCTGCCCGGCTACTACTA-3 5 -TGCAGCTGCCCGGCTACTAC-3 5 -AAGCTGGACATCACCTCCCA-3 5 -TGACAGGAACACCTACAAGT-3 5 -AAGGCACCTTTCTGTCTCCA-3
The RAD51pro::GFP strain was created using the standard agrobacterium-mediated floral
SUPPLEMENTAL EXPERIMENTAL PROCEDURES Generation of the RAD51pro::GFP transgene The RAD51pro::GFP strain was created using the standard agrobacterium-mediated floral dip transformation on atxr5/6 mutants
Supplementary Fig 1. The responses of ERF109 to different hormones and stresses. (a to k) The induced expression of ERF109 in 7-day-old Arabidopsis
Supplementary Fig 1. The responses of ERF109 to different hormones and stresses. (a to k) The induced expression of ERF109 in 7-day-old Arabidopsis seedlings expressing ERF109pro-GUS. The GUS staining
Novel methods for RNA and DNA- Seq analysis using SMART Technology. Andrew Farmer, D. Phil. Vice President, R&D Clontech Laboratories, Inc.
Novel methods for RNA and DNA- Seq analysis using SMART Technology Andrew Farmer, D. Phil. Vice President, R&D Clontech Laboratories, Inc. Agenda Enabling Single Cell RNA-Seq using SMART Technology SMART
1
1 2 3 4 5 Cosmids are plasmid vectors that contain cos sites. The cos site is the only requirement for DNA to be packaged into a phage particle 6 7 8 9 10 11 12 13 14 15 16 For de novo sequencing using
File name: Supplementary Information Description: Supplementary figures and supplementary tables. File name: Peer review file Description:
File name: Supplementary Information Description: Supplementary figures and supplementary tables. File name: Peer review file Description: Supplementary Figure 1. dcas9-mq1 fusion protein induces de novo
Map-Based Cloning of Qualitative Plant Genes
Map-Based Cloning of Qualitative Plant Genes Map-based cloning using the genetic relationship between a gene and a marker as the basis for beginning a search for a gene Chromosome walking moving toward
Supplementary Figure 1
Supplementary Figure 1 Supplementary Fig. 1 shrna mediated knockdown of ZRSR2 in K562 and 293T cells. (a) ZRSR2 transcript levels in stably transduced K562 cells were determined using qrt-pcr. GAPDH was
Supporting Information
Supporting Information Deng et al. 10.1073/pnas.1102117108 Fig. S1. Predicted structure of Arabidopsis bzip60 RNA. Lowest free energy form (ΔG = 309.72 (initially 343.10) of bzip60 mrna folded by M-Fold
Genetics fundamentals and DNA toolkit. Partha Roy
Genetics fundamentals and DNA toolkit Partha Roy 1 (REVIEW of Terminologies and Concepts) Haploid organism: single copy of chromosome (ex: bacteria, yeast) Diploid organism: two copies of chromosome (paternal
Supplemental Data. Wu and Xue (2010). Plant Cell /tpc
Supplemental Data. Wu and Xue (21). Plant Cell 1.115/tpc.11.75564 A P1-S P1-A P2-S P2-A P3-S P3-A P4-S P4-A B Relative expression Relative expression C 5. 4.5 4. 3.5 3. 2.5 2. 1.5 1..5 5. 4.5 4. 3.5 3.
- 1 - Supplemental Data
- 1-1 Supplemental Data 2 3 4 5 6 7 8 9 Supplemental Figure S1. Differential expression of AtPIP Genes in DC3000-inoculated plants. Gene expression in leaves was analyzed by real-time RT-PCR and expression
SUPPLEMENTARY INFORMATION
doi:10.1038/nature11326 Supplementary Figure 1: Histone exchange increases over the ORF in a set2 mutant. (a) Gene average analysis. Schematic representation of the bin distribution over the coding and
Biological Sciences 50 Practice Exam 2
NAME: Fall 2005 TF: Biological Sciences 50 Practice Exam 2 A. Be sure to write your name on the top of each of page of the examination. B. Write each answer only on the same page as the pertinent question.
Supplementary Figure 2
Supplementary Figure 2 a SBS-C1 SBS-C2 SBS-C3 SBS-C4 SBS-C5 SBS-C6 SBS-C7 SBS-C8 SBS-C9 LCR CNS-1 CNS-2 Il5 Rad50 Il13 Il4 Kif3a Sept8 0 50 100 150 200kb Sau3AI 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17
Supplementary Fig. 1. Microscopic image of cotyledon adaxial epidermis of 3-dayold Col, epf2-1, ros1-4 and rdd. Scale bar, 100 m.
Supplementary Fig. 1. Microscopic image of cotyledon adaxial epidermis of 3-dayold Col, epf2-1, ros1-4 and rdd. Scale bar, 100 m. Supplementary Fig. 2. The small-cell-cluster phenotype of different ros1
The study of the structure, function, and interaction of cellular proteins is called. A) bioinformatics B) haplotypics C) genomics D) proteomics
Human Biology, 12e (Mader / Windelspecht) Chapter 21 DNA Which of the following is not a component of a DNA molecule? A) a nitrogen-containing base B) deoxyribose sugar C) phosphate D) phospholipid Messenger
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature10928 Materials and Methods 1. Plant material and growth conditions. All plant lines used were in Col-0 background unless otherwise specified. pif4-101 mutant
Supplemental Data Supplemental Figure 1.
Supplemental Data Supplemental Figure 1. Silique arrangement in the wild-type, jhs, and complemented lines. Wild-type (WT) (A), the jhs1 mutant (B,C), and the jhs1 mutant complemented with JHS1 (Com) (D)
Before starting, write your name on the top of each page Make sure you have all pages
Biology 105: Introduction to Genetics Name Student ID Before starting, write your name on the top of each page Make sure you have all pages You can use the back-side of the pages for scratch, but we will
Student Learning Outcomes (SLOS)
Student Learning Outcomes (SLOS) KNOWLEDGE AND LEARNING SKILLS USE OF KNOWLEDGE AND LEARNING SKILLS - how to use Annhyb to save and manage sequences - how to use BLAST to compare sequences - how to get
SUPPLEMENTARY INFORMATION
Ca 2+ /calmodulin Regulates Salicylic Acid-mediated Plant Immunity Liqun Du, Gul S. Ali, Kayla A. Simons, Jingguo Hou, Tianbao Yang, A.S.N. Reddy and B. W. Poovaiah * *To whom correspondence should be
Reading Lecture 8: Lecture 9: Lecture 8. DNA Libraries. Definition Types Construction
Lecture 8 Reading Lecture 8: 96-110 Lecture 9: 111-120 DNA Libraries Definition Types Construction 142 DNA Libraries A DNA library is a collection of clones of genomic fragments or cdnas from a certain
DNA REPLICATION & BIOTECHNOLOGY Biology Study Review
DNA REPLICATION & BIOTECHNOLOGY Biology Study Review DNA DNA is found in, in the nucleus. It controls cellular activity by regulating the production of, which includes It is a very long molecule made up
PCR analysis was performed to show the presence and the integrity of the var1csa and var-
Supplementary information: Methods: Table S1: Primer Name Nucleotide sequence (5-3 ) DBL3-F tcc ccg cgg agt gaa aca tca tgt gac tg DBL3-R gac tag ttt ctt tca ata aat cac tcg c DBL5-F cgc cct agg tgc ttc
Supplemental Figure 1
Supplemental Figure 1 A gta2-1 gta2-2 1kb AT4G08350 B Col-0 gta2-1 LP+RP+LBb1.3 C Col-0 gta2-2 LP+RP+LB1 D Col-0 gta2-2 gta2-1 GTA2 TUBLIN E Col0 gta2-1 gta2-2 Supplemental Figure 1. Phenotypic analysis
3 -end. Sau3A. 3 -end TAA TAA. ~9.1kb SalI TAA. ~12.6kb. HindШ ATG 5,860bp TAA. ~12.7kb
Supplemental Data. Chen et al. (2008). Badh2, encoding betaine aldehyde dehydrogenase, inhibits the biosynthesis of 2-acetyl-1-pyrroline, a major component in rice fragrance. A pcam-cah/cah Sau3A Promoter
Lecture 2: Biology Basics Continued
Lecture 2: Biology Basics Continued Central Dogma DNA: The Code of Life The structure and the four genomic letters code for all living organisms Adenine, Guanine, Thymine, and Cytosine which pair A-T and
Galaxy Platform For NGS Data Analyses
Galaxy Platform For NGS Data Analyses Weihong Yan wyan@chem.ucla.edu Collaboratory Web Site http://qcb.ucla.edu/collaboratory http://collaboratory.lifesci.ucla.edu Workshop Outline ü Day 1 UCLA galaxy
SUPPLEMENTARY INFORMATION
Materials and Methods Transgenic Plant Materials and DNA Constructs. VEX1::H2B-GFP, ACA3::H2B-GFP, KRP6::H2B-GFP, KRP6::mock21ts-GFP, KRP6::TE21ts- GFP and KRP6::miR161ts-GFP constructs were generated
A subclass of HSP70s regulate development and abiotic stress responses in Arabidopsis thaliana
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 Journal of Plant Research A subclass of HSP70s regulate development and abiotic stress responses in Arabidopsis thaliana Linna Leng 1 Qianqian Liang
BIOL 300 Foundations of Biology Summer 2017 Telleen Lecture Outline
BIOL 300 Foundations of Biology Summer 2017 Telleen Lecture Outline RNA, the Genetic Code, Proteins I. How RNA differs from DNA A. The sugar ribose replaces deoxyribose. The presence of the oxygen on the
Figure S1. Figure S2 RT-PCR. qpcr RT-PCR. Northern. IVSwt ΔIVS IVS IVS IVS. NTC mock IVSwt ΔIVS IVS IVS. mock IVSwt ΔIVS
Figure S1 40 cycles IVS IVS IVS NTC wt Δ Δ mut pri-mirna163 * Fig. S1 Transcripts generated from the MIR163 gene variants in which splice sites have been mutated are not spliced. products were separated
Fig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.
Fig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.SCUBE2, E-cadherin.Myc, or HA.p120-catenin was transfected in a combination
A. Incorrect! This statement is true. Transposable elements can cause chromosome rearrangements.
Genetics - Problem Drill 17: Transposable Genetic Elements No. 1 of 10 1. Which of the following statements is NOT true? (A) Transposable elements can cause chromosome rearrangements. (B) Transposons can
Nature Biotechnology: doi: /nbt.4166
Supplementary Figure 1 Validation of correct targeting at targeted locus. (a) by immunofluorescence staining of 2C-HR-CRISPR microinjected embryos cultured to the blastocyst stage. Embryos were stained
Chapter 20 Biotechnology
Chapter 20 Biotechnology Manipulation of DNA In 2007, the first entire human genome had been sequenced. The ability to sequence an organisms genomes were made possible by advances in biotechnology, (the
i-stop codon positions in the mcherry gene
Supplementary Figure 1 i-stop codon positions in the mcherry gene The grnas (green) that can potentially generate stop codons from Trp (63 th and 98 th aa, upper panel) and Gln (47 th and 114 th aa, bottom
PLNT2530 (2018) Unit 6b Sequence Libraries
PLNT2530 (2018) Unit 6b Sequence Libraries Molecular Biotechnology (Ch 4) Analysis of Genes and Genomes (Ch 5) Unless otherwise cited or referenced, all content of this presenataion is licensed under the
Figure S1. Replication initiation sites at efficient ORIs do not coincide with nucleosomedepleted
Figure S1. Replication initiation sites at efficient ORIs do not coincide with nucleosomedepleted regions in the mouse genome. Typical examples of SNS profiles (Cayrou et al., 11) and nucleosome occupancies
Nature Genetics: doi: /ng Supplementary Figure 1. High-confidence PRC2 targets and candidate PREs.
Supplementary Figure 1 High-confidence PRC2 targets and candidate PREs. (a) Flowchart for identification of candidate Arabidopsis PREs. We identified 1504 genomic regions marked by at least 3 of the following:
BSCI410-Liu/Spring 06 Exam #1 Feb. 23, 06
Your Name: Your UID# 1. (20 points) Match following mutations with corresponding mutagens (X-RAY, Ds transposon excision, UV, EMS, Proflavin) a) Thymidine dimmers b) Breakage of DNA backbone c) Frameshift
Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis
1 Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype
PBG 430/530 Exam
1 PBG 430/530 Exam 2 2013 1. In a deoxyribonucleotide, 5 and 3 refer to the a. start site for transcription. b. start site for translation. c. carbons where (respectively) the phosphate and hydroxyl groups
Figure S1. nuclear extracts. HeLa cell nuclear extract. Input IgG IP:ORC2 ORC2 ORC2. MCM4 origin. ORC2 occupancy
A nuclear extracts B HeLa cell nuclear extract Figure S1 ORC2 (in kda) 21 132 7 ORC2 Input IgG IP:ORC2 32 ORC C D PRKDC ORC2 occupancy Directed against ORC2 C-terminus (sc-272) MCM origin 2 2 1-1 -1kb
Nature Biotechnology: doi: /nbt Supplementary Figure 1. In vitro validation of OTC sgrnas and donor template.
Supplementary Figure 1 In vitro validation of OTC sgrnas and donor template. (a) In vitro validation of sgrnas targeted to OTC in the MC57G mouse cell line by transient transfection followed by 4-day puromycin