Exam 2 Biology II Winter 2013
|
|
- Eugenia Jordan
- 5 years ago
- Views:
Transcription
1 Exam 2 Biology II Winter 2013 Name: Notice that on the last page of this exam, you will find a genetic code table and some potentially useful sequences. You can tear it off to make it more useful. This page may also be used as scratch paper if you like. Multiple Choice Questions. Circle the one best answer for each question unless otherwise noted. (2 points each) 1. Many people think cystic fibrosis (CF) results from inheriting a CF gene. This is a misunderstanding because: A. CF actually results from inheriting a non-functional protein. B. CF is not a genetic disease: it results from insufficient secretion. C. CF results from the inheritance of a specific allele. D. CF results from a mutation, not from the inheritance of a gene. 2. The best illustration of Mendel s Law of Segregation is: A. An individual with genotype Aa produces ½ A gametes and ½ a gametes. B. Mating of two Aa individuals gives a ¼ chance of an aa offspring. C. An individual with genotype AaBb produces AB, Ab, ab, and ab gametes. D. An Aa individual would show the phenotype of the dominant A allele. E. An individual with two co-dominant alleles (e.g., A L and A M ) shows both phenotypes. 3. The best illustration of Mendel s Law of Independent Assortment is: A. An individual with genotype Aa produces ½ A gametes and ½ a gametes. B. Mating of two Aa individuals gives a ¼ chance of an aa offspring. C. An individual with genotype AaBb produces AB, Ab, ab, and ab gametes. D. An Aa individual would show the phenotype of the dominant A allele. E. An individual with two co-dominant alleles (e.g., A L and A M ) shows both phenotypes. 4. An enzyme that would not be found in the nucleus of a eukaryotic cell is: A. DNA ligase B. RNA polymerase II C. RNA polymerase I D. topoisomerase (also known as DNA gyrase) E. none of the above: all of these would be found in the eukaryotic nucleus. 5. A dominant allele is: A. the most common allele of a particular gene. B. the normal allele. C. the allele that determines the phenotype of a heterozygote. D. the allele that encodes the non-functional form of a protein. Version A p. 1 of 7 February 13, 2013
2 6. In order to start transcription of an mrna, eukaryotic RNA polymerase looks for: A. the -10 and -35 sequences B. the Shine-Dalgarno sequence C. the TATA box D. transcription factors E. the start codon 7. If we sequenced the DNA from cells in many different tissues of the human body, we would find that: A. The CFTR gene is found only in epithelial cells of the lung, pancreas and other secretory tissues. B. Every cell has one copy of the CFTR gene. C. Every cell has two copies of the CFTR gene. D. The CFTR gene is in the nucleus of most cells but in the cytoplasm of lung and pancreas cells. 8. Which of the following is capable of breaking hydrogen bonds between two DNA strands? Choose all that apply. A. DNA polymerase III B. helicase C. RNA polymerase D. primase E. initiator protein 9. For a particular gene, which of these would be the longest molecule? A. mrna in the cytoplasm B. mrna in the nucleus C. coding sequence D. exon 10. Which of the following does not occur during RNA processing in eukaryotes? A. addition of a poly(a) tail B. removal of introns C. removal of RNA primers D. addition of a G nucleotide to the 5 phosphate 11. Which investigators showed that one gene encodes one enzyme? A. Watson and Crick B. Beadle and Tatum C. Hershey and Chase D. Meselson and Stahl 12. Avery, McCarty and MacLeod s experiments provided evidence that DNA is the genetic material by: A. showing that Streptococcus pneumoniae was not transformed by DNAse treated cell extract. B. showing that heat-treated S cells could still transform R cells. C. showing that radioactive phosphorus did not enter virus-infected bacteria. D. showing that radioactive sulfur did not enter virus-infected bacteria. E. showing that DNA replication is semiconservative. Version A p. 2 of 7 February 13, 2013
3 13. Put the following terms in size order, from largest to smallest (3 points): protein, chromosome, virus, nucleotide, eukaryotic cell, mitochondrion, phospholipid 14. From the list below, choose four DNA or RNA sequences and put them in the left column of blanks below. Then, choose the proteins that bind these sequences and match them up by putting them in the appropriate blanks in the right column (5 points). origin enhancer sequences proteins helicase sigma factor 30S subunit histone terminator start codon Shine-Dalgarno TBP -10 and -35 intron transcription factor initiator primase TATA box 15. Bob and his wife Jane like chocolate. Bob s mother is a real chocoholic: she loves, loves, loves chocolate (and has no real interest in seeking treatment). Bob s father, though, never cared for chocolate. Bob s first child (a son) and second child (a daughter) like chocolate, and son #3 is a chocoholic like his grandmother, but to Bob s surprise, daughter #4 doesn t like chocolate. a. Assuming taste for chocolate is a genetic trait, draw a pedigree for this family in the space at right (3 points). b. Determine dominance and give specific evidence to support your claim (2 points). c. Define appropriate genetic symbols (2 points). d. Give everyone in the pedigree a genotype (2 points). 16. In the appropriate boxes in the replication fork diagram at right: a. Label the leading and lagging strands (2 points). b. Label the indicated end (3 or 5 ) (1 point). c. Name the indicated enzyme (1 point). Version A p. 3 of 7 February 13, 2013
4 17. You are studying six human genes, which we can symbolize simply with letters A-E. a. If a female has the genotype AABbccDdEE, what are the gametes that she can make? (2 points) b. Suppose she marries a male who has hairy feet, a trait resulting from the d allele, and is heterozygous for the other five genes. What is the probability that they will have a child with hairy feet? (2 points) 18. Primary ciliary dyskinesia (PCD) is a disease in which ciliated cells normally involved in protecting the respiratory tract and in hearing fail to function, resulting in deafness and susceptibility to lung infections. It is caused by mutations in the DNAI1 gene on chromosome 9. Below is a segment of DNAI1, starting with the +1 nucleotide, and the same region from a PCD patient. Normal: PCD: TCTTCAGACGAGGGAGCGTTTTGTAGGCTCTCCAGGGGTTGAGATGATTCCTGCTTCTGC TCTTCAGACGAGGGAGCGTTTTGTATGCTCTCCAGGGGTTGAGATGATTCCTGCTTCTGC a. What do we call one gene with multiple effects (e.g., respiratory and hearing defects)? (1 point) b. What mutation has occurred in the PCD patient s DNA? (1 point) c. How would we classify this mutation in terms of its effect on the DNA? (1 point) d. How would we classify this mutation in terms of its effect on the protein? (2 points) e. Would you expect the PCD patient s allele to be a dominant or recessive allele? Explain. (2 points) 19. The sequence below is the first part of an mrna from a bacterial cell, starting with the +1 nucleotide: UGAGCAUCCCAUGGACCAUGAUAGGAGGUCCACAUGGUCCA a. There are three potential start codons. Circle the one that will actually be used and tell how you know that this is the correct one. (2 points) b. Suppose this gene were introduced into the nucleus of a eukaryotic cell and correctly transcribed to produce this same mrna. Would the same protein be produced? Why or why not? (2 points) Version A p. 4 of 7 February 13, 2013
5 20. The bright red color of Chippy the Cardinal s feathers is controlled by a gene, R, that has three alleles: R R produces red pigment, R B produces blue pigment, and r produces no pigment (leading to white feathers). Chippy s mother was a blue cardinal, and Chippy s father was the red son of a white mother. a. What is Chippy s genotype? (1 point) b. If Chippy has 19 brothers and sisters, what would you predict their genotypes and phenotypes would be? (4 points) 21. In cats, black fur is dominant over brown. But, there s a second gene which determines the intensity of the color. Cats homozygous for the recessive allele of this second gene have a dilute phenotype, either grey or tan. You have a grey male cat whose mother was brown and a brown female whose mother was tan. Since you re feeding them anyway, you decide they should contribute to the household income, so you breed them and sell the kittens. You know that grey or tan kittens are the most popular, so you price these at $25 each, with browns selling for $10 and the less-popular blacks priced at $5. If you were able to obtain 40 kittens (from several litters), how much income would you expect? (5 points) 22. A woman with type O+ blood has a child with type A blood. She is not sure which of two men is the father, so she consults a genetic counselor who suggests that the two men be blood-typed as an initial step in the investigation. Mr. X has type B+ blood, while Mr. Y has type AB+ blood. a. Which of these men can be ruled out, and why? (2 points) b. What is the genotype of the other man? (2 points) Version A p. 5 of 7 February 13, 2013
6 23. It may surprise you to know that your dislike of Brussel sprouts has a biochemical basis! The gene for the enzyme glucosinolate isomerase (GluIso) has 10 exons that make up the CDS for this protein. If all 10 exons (especially exons 4 and 5) are present, the protein is localized to the cell membrane and highly functional: it makes Brussel sprouts taste less bitter. You have isolated molecules from your own cells to figure out why your GluIso doesn t appear to work properly, and you have found that stable GluIso mrna is made and translated into protein. However, your experiments revealed that most of the GluIso protein is not associated with the cell membrane but is secreted into the extracellular environment. a. What is one modification of the GluIso mrna that stabilizes it? (1 point) b. Where in the cell would you expect the GluIso protein to be translated? (1 point) c. Briefly describe a mechanism involving RNA processing that could have led to the phenotype described for your mutant allele (you may use illustrations to support your answer). (3 points) 24. For the three RNA polymerases listed below, describe what type of RNA is produced. (1 point each) Homo sapiens RNA Polymerase III: Escherichia coli RNA Polymerase: Yeast RNA Polymerase I: 25. Gene expression for any given gene in Prokaryotes must eventually be turned off. Describe in detail how bacteria can turn off gene expression by terminating (you may use illustrations to support answers): Transcription (3 points): Translation (3 points): Version A p. 6 of 7 February 13, 2013
7 The genetic code: Some possibly useful sequences: 10 sequence: 5 TATAAT 35 sequence: 5 TTGACAT TATA box: 5 TATAAA Shine-Dalgarno: 5 AGGAGG Version A p. 7 of 7 February 13, 2013
Exam 2 Biology II Winter 2013
Exam 2 Biology II Winter 2013 Name: Notice that on the last page of this exam, you will find a genetic code table and some potentially useful sequences. You can tear it off to make it more useful. This
More informationReview Quizzes Chapters 11-16
Review Quizzes Chapters 11-16 1. In pea plants, the allele for smooth seeds (S) is dominant over the allele for wrinkled seeds (s). In an experiment, when two hybrids are crossed, what percent of the offspring
More informationAP Biology Review Chapters Review Questions Chapter 11: Mendelian Patterns of Inheritance Chapter 12: Molecular Biology of the Gene
AP Biology Review Chapters 11-12 Review Questions Chapter 11: Mendelian Patterns of Inheritance a) Know genotypes and phenotypes of a monohybrid cross in the P, F1, and F2 generations. Be familiar with
More informationBiology Summer 2013 MIDTERM EXAM
Biology 105 - Summer 2013 MIDTERM EXAM Name: SCORE: 5 X 2 Point Questions 10 points 12 X 5 Point Questions 60 points 4 X 10 Point Questions 40 points Drop the lowest of the 10 point questions -10 points
More informationAP BIOLOGY RNA, DNA, & Proteins Chapters 16 & 17 Review
AP BIOLOGY RNA, DNA, & Proteins Chapters 16 & 17 Review Enzyme that adds nucleotide subunits to an RNA primer during replication DNA polymerase III Another name for protein synthesis translation Sugar
More informationKeystone Biology Remediation B2: Genetics
Keystone Biology Remediation B2: Genetics Assessment Anchors: to describe and/or predict observed patterns of inheritance (i.e. dominant, recessive, codominance, incomplete dominance, sex-linked, polygenic,
More informationChromosomes. Chromosomes. Genes. Strands of DNA that contain all of the genes an organism needs to survive and reproduce
Chromosomes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce Genes Segments of DNA that specify how to build a protein genes may specify more than one
More informationMultiple Choice (3.35 each) Total = 100pts. Choice the choice that best answers the question! Good luck!
NAME DATE Multiple Choice (3.35 each) Total = 100pts. Choice the choice that best answers the question! Good luck! 1. Could the characteristic followed in the pedigree be caused by an autosomal dominant
More informationSubterm 2 Final Review Guide
Name: Date: Period: Subterm 2 Final Review Guide *** This review guide is only some of what you should know for the final. Make sure you study ALL of your notes and any diagrams that are appropriate (Pedigrees,
More informationChapter 13 - Concept Mapping
Chapter 13 - Concept Mapping Using the terms and phrases provided below, complete the concept map showing the discovery of DNA structure. amount of base pairs five-carbon sugar purine DNA polymerases Franklin
More informationBiol 331 Genetics Exam 1a Fall 2016
Biol 331 Genetics Exam 1a Fall 2016 Multiple Choice. (2points each) 1. An allele is. A. one of the bases in DNA B. an alternate form of a gene C. another term for epistasis D. present only in males and
More informationAP Biology Review Chapters Review Questions Chapter 11: Mendelian Patterns of Inheritance Chapter 12: Molecular Biology of the Gene
AP Biology Review Chapters 11-12 Review Questions Chapter 11: Mendelian Patterns of Inheritance a) Know genotypes and phenotypes of a monohybrid cross in the P, F1, and F2 generations. Be familiar with
More informationMolecular Genetics I DNA
Molecular Genetics I DNA Deoxyribonucleic acid is the molecule that encodes the characteristics of living things. It is the molecule that is passed from a mother cell to daughter cells, and the molecule
More informationDESIGNER GENES SAMPLE TOURNAMENT
DESIGNER GENES SAMPLE TOURNAMENT PART ONE- GENETICS PROBLEMS In dogs, the inheritance of hair color involves a gene (B) for black hair and a gene (b) for brown hair. A dominant (C) is also involved. It
More informationName 10 Molecular Biology of the Gene Test Date Study Guide You must know: The structure of DNA. The major steps to replication.
Name 10 Molecular Biology of the Gene Test Date Study Guide You must know: The structure of DNA. The major steps to replication. The difference between replication, transcription, and translation. How
More informationPart I: Predicting Genetic Outcomes
Part I: Predicting Genetic Outcomes Deoxyribonucleic acid (DNA) is found in every cell of living organisms, and all of the cells in each organism contain the exact same copy of that organism s DNA. Because
More informationDNA segment: T A C T G T G G C A A A
DNA Structure, Replication, Protein Synthesis & Name Period Genetics Study Guide Chapter 12 and 13 Structure of DNA and Protein Synthesis 1. What macromolecule is coded for by genes located on DNA? Provide
More informationJohn s Student Union Study Guide for Final Exam
John s Student Union Study Guide for Final Exam 1. What organelle do Prokaryotes and Eukaryotes have in common? Ribosomes 2. Covalent vs Ionic bonds: Covalent: sharing electrons (Polar & Nonpolar) Ionic:
More informationCOMPETITOR NAMES: TEAM NAME: TEAM NUMBER:
COMPETITOR NAMES: TEAM NAME: TEAM NUMBER: Section 1:Crosses In a fictional species of mice, with species name Mus SciOlyian, fur color is controlled by a single autosomal gene. The allele for brown fur
More informationCell and Molecular Biology -- Biology 20A
Cell and Molecular Biology -- Biology 20A Bio 20A Final 7-31-98 Name Each numbered question has equal value. Please read each question carefully. 1. In what phase of meiosis do chromosomes do most of their
More informationChapter 2. An Introduction to Genes and Genomes
PowerPoint Lectures for Introduction to Biotechnology, Second Edition William J.Thieman and Michael A.Palladino Chapter 2 An Introduction to Genes and Genomes Lectures by Lara Dowland Chapter Contents
More information2 nd Term Final. Revision Sheet. Students Name: Grade: 9 A/B. Subject: Biology. Teacher Signature. Page 1 of 12
2 nd Term Final Revision Sheet Students Name: Grade: 9 A/B Subject: Biology Teacher Signature Page 1 of 12 Nour Al Maref International School Riyadh, Saudi Arabia Biology Worksheet (2 nd Term) Chapter-7
More informationChapter 8 From DNA to Proteins. Chapter 8 From DNA to Proteins
KEY CONCEPT Section 1 DNA was identified as the genetic material through a series of experiments. Griffith finds a transforming principle. Griffith experimented with the bacteria that cause pneumonia.
More informationStudy Guide A. Answer Key
From DNA to Proteins Answer Key SECTION 1. IDENTIFYING DNA AS THE GENETIC MATERIAL 1. Mice lived 2. Mice died 3. Mice lived 4. Mice died 5. S 6. bacteria 7. DNA; DNA; DNA 8. protein 9. radioactive 10.
More informationWhat would this eye color phenomenon be called?
Name: School: Total Score: / 50 1 1. Which nitrogenous bases present in DNA are purines, and which are pyrimidines? What is the main difference between a purine and a pyrimidine? (2 points) 2. To the right
More informationWinter Quarter Midterm Exam
1. For a science fair project, two students decided to repeat the Hershey and Chase experiment, with modifications. They decided to label the nitrogen of the DNA, rather than the phosphate. They reasoned
More informationMolecular Genetics Quiz #1 SBI4U K T/I A C TOTAL
Name: Molecular Genetics Quiz #1 SBI4U K T/I A C TOTAL Part A: Multiple Choice (15 marks) Circle the letter of choice that best completes the statement or answers the question. One mark for each correct
More information2/25/15. The Experiment. Griffith. GO Avery! Avery TRANSFORMATION. o animations.html
o http://www.hhmi.org/biointeractive/dna/ animations.html o Revisit the difference b/w a contagious and a genetic disease Griffith The Experiment o Isolated two strains (versions) of pneumonia bacteria
More informationKEY CONCEPT DNA was identified as the genetic material through a series of experiments. Found live S with R bacteria and injected
Section 1: Identifying DNA as the Genetic Material KEY CONCEPT DNA was identified as the genetic material through a series of experiments. VOCABULARY bacteriophage MAIN IDEA: Griffith finds a transforming
More informationDNA. Griffith s Transforming Principle Experiment 11/30/2006 DNA 2
DNA Griffith s Transforming Principle Experiment 11/30/2006 DNA 2 1 Avery, McCarty, & MacLeod 1944 Extended Griffith s work 16 years later Search for the transforming factor Live rough cells + Protein
More informationGENETICS. I. Review of DNA/RNA A. Basic Structure DNA 3 parts that make up a nucleotide chains wrap around each other to form a
GENETICS I. Review of DNA/RNA A. Basic Structure DNA 3 parts that make up a nucleotide 1. 2. 3. chains wrap around each other to form a Chains run in opposite direction known as Type of bond between the
More informationThe Molecular Basis of Inheritance
The Molecular Basis of Inheritance Chapter 16 Objectives Describe the contributions of the following people: Griffith; Avery, McCary, and MacLeod; Hershey and Chase; Chargaff; Watson and Crick; Franklin;
More informationBICD100 Midterm (10/27/10) KEY
BICD100 Midterm (10/27/10) KEY 1. Variation in tail length is characteristic of some dog breeds, such as Pembroke Welsh Corgis, which sometimes show a bob tail (short tail) phenotype (see illustration
More informationSTUDY GUIDE SECTION 10-1 Discovery of DNA
STUDY GUIDE SECTION 10-1 Discovery of DNA Name Period Date Multiple Choice-Write the correct letter in the blank. 1. The virulent strain of the bacterium S. pneumoniae causes disease because it a. has
More informationChapter 12 Packet DNA 1. What did Griffith conclude from his experiment? 2. Describe the process of transformation.
Chapter 12 Packet DNA and RNA Name Period California State Standards covered by this chapter: Cell Biology 1. The fundamental life processes of plants and animals depend on a variety of chemical reactions
More informationThe Genetic Material. Unit 6: DNA & Protein Synthesis
Unit 6: DNA & Protein Synthesis The Genetic Material How was DNA discovered to be the chemical unit of heredity? Scientists already knew that chromosomes played a role in heredity, but the chemical composition
More informationGenetics: Analysis of Genes and Genomes, Ninth Edition. Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION
CHAPTER 1 STUDENT NOT STUDY FOR SALE GUIDE OR DISTRIBUTION TEST BANK Daniel Jones L. Hartl & Bartlett and Bruce Learning, J. Cochrane LLC Multiple Choice 1. NOT What FOR happens SALE if organisms OR DISTRIBUTION
More informationA. Incorrect! Garrod s experiment linked genes to enzymes. It is important to be familiar with the milestone experiments in genetics.
Genetics - Problem Drill 11: DNA - The Chemical Basis of Genetics No. 1 of 10 1. Which scientist first gave evidence that DNA is the genetic material? (A) Garrod, who postulated that Alcaptonuria, or black
More informationGenetics Transcription Translation Replication
Genetics Transcription Translation Replication 1. Which statement best describes the relationship between an allele and a gene? A. An allele is a variation of a gene that can be expressed as a phenotype.
More informationBiology. Chapter 13. Observing Patterns in Inherited Traits. Concepts and Applications 9e Starr Evers Starr. Cengage Learning 2015
Biology Concepts and Applications 9e Starr Evers Starr Chapter 13 Observing Patterns in Inherited Traits 13.1 How Do Alleles Contribute to Traits? Blending inheritance 19th century idea Failed to explain
More information4/22/2014. Interest Grabber. Section Outline. Today s Goal. Percentage of Bases in Four Organisms. Figure 12 2 Griffith s Experiment
Order! Order! Genes are made of, a large, complex molecule. is composed of individual units called nucleotides. Three of these units form a code. The order, or sequence, of a code and the type of code
More informationNON MENDELIAN GENETICS. DNA, PROTEIN SYNTHESIS, MUTATIONS DUE DECEMBER 8TH
NON MENDELIAN GENETICS. DNA, PROTEIN SYNTHESIS, MUTATIONS DUE DECEMBER 8TH MONDAY TUESDAY WEDNESDAY THURSDAY FRIDAY 11/14 11/15 11/16 11/17 11/18 Non-Mendelian Genetics DNA Structure and Replication 11/28
More informationActive Learning Exercise 9. The Hereditary Material: DNA
Name Biol 211 - Group Number Active Learning Exercise 9. The Hereditary Material: DNA Reference: Chapter 16 (Biology by Campbell/Reece, 8 th ed.) 1. a.) What is a nucleotide? b.) What is a nitrogen base?
More informationd. reading a DNA strand and making a complementary messenger RNA
Biol/ MBios 301 (General Genetics) Spring 2003 Second Midterm Examination A (100 points possible) Key April 1, 2003 10 Multiple Choice Questions-4 pts. each (Choose the best answer) 1. Transcription involves:
More information5. Which of the following enzymes catalyze the attachment of an amino acid to trna in the formation of aminoacyl trna?
Sample Examination Questions for Exam 3 Material Biology 3300 / Dr. Jerald Hendrix Warning! These questions are posted solely to provide examples of past test questions. There is no guarantee that any
More informationI. To understand Genetics - A. Chemical nature of genes had to be discovered B. Allow us to understand how genes control inherited characteristics
Ch 12 Lecture Notes - DNA I. To understand Genetics - A. Chemical nature of genes had to be discovered B. Allow us to understand how genes control inherited characteristics 1 II. Griffith and Transformation
More informationIB BIO I Replication/Transcription/Translation Van Roekel/Madden. Name Date Period. D. It separates DNA strands. (Total 1 mark)
Name Date Period 1. What is the function of helicase? A. It forms bonds between DNA nucleotides. B. It adds new nucleotides to the DNA helix. C. It forms the DNA helix. D. It separates DNA strands. 2.
More information1. (a) Define sex linkage... State one example of sex linkage... Key. 1st generation. Male. Female
1. Define sex linkage. State one example of sex linkage. Draw a simple pedigree chart that clearly shows sex linkage in humans. Use conventional symbols. Start with an affected woman and an unaffected
More informationPractice MODERN GENETICS
Name: Practice MODERN GENETICS 1. Which diagram represents a pair of homologous chromosomes? 8. The diagram below shows some chromosomal alterations. A) B) C) D) Which chromosome represents an alteration
More informationLesson 8. DNA: The Molecule of Heredity. Gene Expression and Regulation. Introduction to Life Processes - SCI 102 1
Lesson 8 DNA: The Molecule of Heredity Gene Expression and Regulation Introduction to Life Processes - SCI 102 1 Genes and DNA Hereditary information is found in discrete units called genes Genes are segments
More informationBundle 5 Test Review
Bundle 5 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? _Nucleic
More information1. The bacterium Escherichia coli (E. coli) uses glucose as a respiratory substrate. In the absence of glucose, E. coli can use lactose. The use of a different substrate is determined by the interaction
More informationThis is DUE: Tuesday, March 1, 2011 Come prepared to share your findings with your group.
Biology 160 NAME: Reading Guide 12: Population Dynamics, Humans, Part II This is DUE: Tuesday, March 1, 2011 Come prepared to share your findings with your group. *As before, please turn in only the Critical
More informationGeneral Biology 115, Summer 2014 Exam II: Form B June 23, Name Student Number
General Biology 115, Summer 2014 Exam II: Form B June 23, 2014 Name Student Number For questions 1 2, use the following information. A particular plasmid (pbr322) has two unique gene sequences that confer
More informationGeneral Biology 115, Summer 2014 Exam II: Form A June 23, Name Student Number
General Biology 115, Summer 2014 Exam II: Form A June 23, 2014 Name Student Number 1. Of the following, which best describes how the free energy generated during the reactions of Photosystem I is utilized?
More informationChapter 16 The Molecular Basis of Inheritance
Chapter 16 The Molecular Basis of Inheritance Chromosomes and DNA Morgan s experiments with Drosophila were able to link hereditary factors to specific locations on chromosomes. The double-helical model
More informationEssential Questions. DNA: The Genetic Material. Copyright McGraw-Hill Education
Essential Questions Which experiments led to the discovery of DNA as the genetic material? What is the basic structure of DNA? What is the basic structure of eukaryotic chromosomes? Vocabulary Review nucleic
More informationExam 1 Answers Biology 210 Sept. 20, 2006
Exam Answers Biology 20 Sept. 20, 2006 Name: Section:. (5 points) Circle the answer that gives the maximum number of different alleles that might exist for any one locus in a normal mammalian cell. A.
More informationB6 DNA STRUCTURE AND PROTEIN SYNTHESIS
B6 DNA STRUCTURE AND PROTEIN SYNTHESIS Practice questions Name: Class: Date: Time: 79 minutes Marks: 78 marks Comments: Biology Only Page of 26 Our understanding of genetics and inheritance has improved
More information4) separates the DNA strands during replication a. A b. B c. C d. D e. E. 5) covalently connects segments of DNA a. A b. B c. C d. D e.
1) Chargaff's analysis of the relative base composition of DNA was significant because he was able to show that a. the relative proportion of each of the four bases differs from species to species. b.
More informationDelve AP Biology Lecture 7: 10/30/11 Melissa Ko and Anne Huang
Today s Agenda: I. DNA Structure II. DNA Replication III. DNA Proofreading and Repair IV. The Central Dogma V. Transcription VI. Post-transcriptional Modifications Delve AP Biology Lecture 7: 10/30/11
More informationChapter 10 - Molecular Biology of the Gene
Bio 100 - Molecular Genetics 1 A. Bacterial Transformation Chapter 10 - Molecular Biology of the Gene Researchers found that they could transfer an inherited characteristic (e.g. the ability to cause pneumonia),
More informationDNA: the thread of life
DNA: the thread of life Lectured by Chompunuch Virunanon This presentation Partial Fulfillment of the Requirements for the 2303107 General Biology teaching, Department of Biology Chulalongkorn University
More information3.a.1- DNA and RNA 10/19/2014. Big Idea 3: Living systems store, retrieve, transmit and respond to information essential to life processes.
3.a.1- DNA and RNA Big Idea 3: Living systems store, retrieve, transmit and respond to information essential to life processes. EU 3.A: Heritable information provides for continuity of life. EU 3.B: Expression
More informationCh 12.DNA and RNA.Biology.Landis
Identity Section 12 1 DNA (pages 287 294) This section tells about the experiments that helped scientists discover the relationship between genes and DNA. It also describes the chemical structure of the
More informationTransformation: change in genotype & phenotype due to assimilation of external DNA by a cell.
DNA Replication Chapter 16: DNA as Genetic Material Genes are on Chromosomes T.H. Morgan o Working with Drosophila (fruit flies) o Genes are on chromosomes o But is it the protein or the DNA of the chromosomes
More informationPrinciple 2. Overview of Central. 3. Nucleic Acid Structure 4. The Organization of
Central dogma I and II the flow of genetic information 1. The Transforming Principle 2. Overview of Central Dogma 3. Nucleic Acid Structure 4. The Organization of DNA in Cells 5. DNA Replication 6. Gene
More informationGriffith and Transformation (pages ) 1. What hypothesis did Griffith form from the results of his experiments?
Section 12 1 DNA (pages 287 294) This section tells about the experiments that helped scientists discover the relationship between genes and DNA. It also describes the chemical structure of the DNA molecule.
More informationChapter 9. Topics - Genetics - Flow of Genetics - Regulation - Mutation - Recombination
Chapter 9 Topics - Genetics - Flow of Genetics - Regulation - Mutation - Recombination 1 Genetics Genome Chromosome Gene Protein Genotype Phenotype 2 Terms and concepts gene Fundamental unit of heredity
More informationUnit 6: Genetics & Molecular Genetics Assessment
Unit 6: Genetics & Molecular Genetics Assessment 1. NA replication takes place in the nucleus of eukaryotic cells during interphase. An enzyme called NA helicase relaxes the helix in certain places and
More informationCovalently bonded sugar-phosphate backbone with relatively strong bonds keeps the nucleotides in the backbone connected in the correct sequence.
Unit 14: DNA Replication Study Guide U7.1.1: DNA structure suggested a mechanism for DNA replication (Oxford Biology Course Companion page 347). 1. Outline the features of DNA structure that suggested
More informationBiol 3301 Genetics Exam #2A October 26, 2004
Biol 3301 Genetics Exam #2A October 26, 2004 This exam consists of 40 multiple choice questions worth 2.5 points each, for a total of 100 points. Good luck. Name SS# 1. Which of the following statements
More informationName: - Bio A.P. DNA Replication & Protein Synthesis
Name: - Bio A.P. DNA Replication & Protein Synthesis 1 ESSENTIAL KNOWLEDGE Big Idea 3: Living Systems store, retrieve, transmit and respond to information critical to living systems Enduring Understanding:
More informationName Campbell Chapter 16 The Molecular Basis of Inheritance
A.P. Biology Name Campbell Chapter 16 The Molecular Basis of Inheritance 305-310 Who are these dudes? A. B. What distinguishes DNA from all other molecules? What does the adage Like begets like mean? DNA
More informationFundamentals of Genetics. 4. Name the 7 characteristics, giving both dominant and recessive forms of the pea plants, in Mendel s experiments.
Fundamentals of Genetics 1. What scientist is responsible for our study of heredity? 2. Define heredity. 3. What plant did Mendel use for his hereditary experiments? 4. Name the 7 characteristics, giving
More informationDESIGNER GENES * SOUTHERN POLY REGIONAL 2006
DESIGNER GENES * SOUTHERN POLY REGIONAL 2006 1. A true-breeding plant with yellow seed is crossed to a true-breeding plant with green seeds. All of the F1s are yellow. The F1s are allowed to self. What
More informationCh 10 Molecular Biology of the Gene
Ch 10 Molecular Biology of the Gene For Next Week Lab -Hand in questions from 4 and 5 by TUES in my mailbox (Biology Office) -Do questions for Lab 6 for next week -Lab practical next week Lecture Read
More informationThe Molecular Basis of Inheritance (Ch. 13)
The Molecular Basis of Inheritance (Ch. 13) Many people contributed to our understanding of DNA T.H. Morgan (1908) Frederick Griffith (1928) Avery, McCarty & MacLeod (1944) Erwin Chargaff (1947) Hershey
More informationChapter 8. Microbial Genetics. Lectures prepared by Christine L. Case. Copyright 2010 Pearson Education, Inc.
Chapter 8 Microbial Genetics Lectures prepared by Christine L. Case Structure and Function of Genetic Material Learning Objectives 8-1 Define genetics, genome, chromosome, gene, genetic code, genotype,
More informationDNA: The Genetic Material. Chapter 14
DNA: The Genetic Material Chapter 14 The Genetic Material Frederick Griffith, 1928 studied Streptococcus pneumoniae, a pathogenic bacterium causing pneumonia there are 2 strains of Streptococcus: - S strain
More information8.1. DNA was identified as the genetic material through a series of experiments. Injected mice with R bacteria. Injected mice with S bacteria
SECTION 8.1 IDENTIFYING DNA AS THE GENETIC MATERIAL Study Guide KEY CONCEPT DNA was identified as the genetic material through a series of experiments. VOCABULARY bacteriophage Griffith finds a transforming
More informationChapter 12 Reading Questions
Chapter 12 Reading Questions Name Section 11 In Frederick Griffith s experiment, what four substances were given to laboratory mice, and what was the result of each? 4. Which result was surprising, and
More informationHonors Biology Reading Guide Chapter 10 v Fredrick Griffith Ø When he killed bacteria and then mixed the bacteria remains with living harmless
Honors Biology Reading Guide Chapter 10 v Fredrick Griffith Ø When he killed bacteria and then mixed the bacteria remains with living harmless bacteria some living bacteria cells converted to disease causing
More informationBIOLOGY 205 Midterm II - 19 February Each of the following statements are correct regarding Eukaryotic genes and genomes EXCEPT?
BIOLOGY 205 Midterm II - 19 February 1999 Name Multiple choice questions 4 points each (Best 12 out of 13). 1. Each of the following statements are correct regarding Eukaryotic genes and genomes EXCEPT?
More informationFrom DNA to Protein: Genotype to Phenotype
12 From DNA to Protein: Genotype to Phenotype 12.1 What Is the Evidence that Genes Code for Proteins? The gene-enzyme relationship is one-gene, one-polypeptide relationship. Example: In hemoglobin, each
More informationProblem Set 2
ame: 2006 7.012 Problem Set 2 Due before 5 PM on FRIDAY, September 29, 2006. Turn answers in to the box outside of 68-120. PLEASE WRITE YUR ASWERS THIS PRITUT. 1. You are doing a genetics experiment with
More informationThe Genetic Material. The Genetic Material. The Genetic Material. DNA: The Genetic Material. Chapter 14
DNA: Chapter 14 Frederick Griffith, 1928 studied Streptococcus pneumoniae, a pathogenic bacterium causing pneumonia there are 2 strains of Streptococcus: - S strain is virulent - R strain is nonvirulent
More informationGenetics Review. 5. Prokaryotic Inheritance a. Conjugation b. Plasmids
Genetics Review A. Top 10 If you learned anything from this unit, you should have learned: 1. Different versions of same gene are called alleles a. dominant vs. recessive b. homozygous vs. heterozygous
More informationYear Morgan and fellow researchers found that chromosomes contained DNA, RNA, and protein.
DNA Year 1920 Morgan and fellow researchers found that chromosomes contained DNA, RNA, and protein. Which one actually carries the genetic information? The stuff that gets passed on from generation
More informationDNA: The Genetic Material. Chapter 14. Genetic Material
DNA: The Genetic Material Chapter 14 Genetic Material Frederick Griffith, 1928 Streptococcus pneumoniae, a pathogenic bacterium causing pneumonia 2 strains of Streptococcus: - S strain virulent - R strain
More informationImportant Questions from the Previous Years' Board Papers Unit: Genetics and Evolution 2009 (Delhi Region) Set 1
One mark Questions: Important Questions from the Previous Years' Board Papers Unit: Genetics and Evolution 2009 (Delhi Region) Set 1 Q.1 Why hnrna is required to undergo splicing? The heterogeneous nuclear
More informationHow do we know what the structure and function of DNA is? - Double helix, base pairs, sugar, and phosphate - Stores genetic information
DNA: CH 13 How do we know what the structure and function of DNA is? - Double helix, base pairs, sugar, and phosphate - Stores genetic information Discovering DNA s Function 1928: Frederick Griffith studied
More informationDNA and DNA Replication
Name Period PreAP Biology QCA 2 Review Your EOS exam is approximately 70 MC questions. This review, coupled with your QCA 1 review you received in October should lead you back through the important concepts
More informationGenetics BOE approved April 15, 2010
Genetics BOE approved April 15, 2010 Learner Objective: Cells go through a natural progression of events to produce new cells. A. Cellular organelles work together to perform a specific function. B. The
More informationJanuary 11, Genetics with DNA.notebook. Genetics
Genetics 1.DNA (deoxyribonucleic acid) is a chemical code that contains information for an organisms growth and function. It is found in the nucleus of all cells. 2. A gene is a section of DNA on a chromosome.the
More informationMolecular Genetics of Disease and the Human Genome Project
9 Molecular Genetics of Disease and the Human Genome Project Fig. 1. The 23 chromosomes in the human genome. There are 22 autosomes (chromosomes 1 to 22) and two sex chromosomes (X and Y). Females inherit
More informationDNA: The Primary Source of Heritable Information. Genetic information is transmitted from one generation to the next through DNA or RNA
DNA and Replication DNA: The Primary Source of Heritable Information Genetic information is transmitted from one generation to the next through DNA or RNA Chromosomes Non-eukaryotic (bacteria) organisms
More informationGenetics, Fall 2005 TEST 2, 11/16/05 Page 1
Genetics, Fall 2005 TEST 2, 11/16/05 Page 1 STUDENT NAME: Give a brief definition of the following terms (5 points each; only nine definitions count for the grade): 1. phenotype 2. homozygous 3. codominance
More informationBio 102 Practice Problems Genetic Code and Mutation
Bio 102 Practice Problems Genetic Code and Mutation Multiple choice: Unless otherwise directed, circle the one best answer: 1. Beadle and Tatum mutagenized Neurospora to find strains that required arginine
More informationGenetics Test. Multiple Choice Identify the choice that best completes the statement or answers the question.
Genetics Test Multiple Choice Identify the choice that best completes the statement or answers the question. 41. Situations in which one allele for a gene is not completely dominant over another allele
More information