Supplemental Figure S1. Validation of auxin-related gene expression from Fig. 1A. Relative gene expression in 2x and 3x seeds 6 days after
|
|
|
- Curtis Lloyd
- 5 years ago
- Views:
Transcription
1 Supplemental Figure S1. Validation of auxin-related gene expression from Fig. 1A. Relative gene expression in 2x and 3x seeds 6 days after pollination (6 DAP), as determined by RT-qPCR for YUC10 (A), YUC11 (B), TAR1 (C), PGP10 (D) and ARFs (E). Each figure panel shows a representative biological replicate. ARF12, 13, 14, 15, 21 and 22 were assayed together due to high sequence similarity. Three technical replicates were performed and error bars indicate standard deviation. Differences are significant for Student s T-test for p<0.05 (*) or p<0.001 (**).
2 Supplemental Figure S2. Auxin-related genes are upregulated in the endosperm of 3x seeds. Log2-fold expression change between genes expressed in the endosperm of 3x and 2x seeds. Genes coding for auxin signaling, biosynthesis, and transport proteins are indicated by orange, green and blue colors, respectively.
3 Supplemental Figure S3. Relative expression of NITRILASE (NIT) coding genes. (A) Expression of genes coding for NIT IAM-synthetizing enzymes in each endosperm domain along seed development. Gene expression values indicate normalized microarray signal intensity according to Belmonte et al. (2013). (B) Relative expression of NIT1-3 genes, compared to the global distribution of gene expression in different subdomains and time-points of endosperm development, according to Belmonte et al. (2013). Arrows indicate the gene expression category for each NIT gene.
4 Supplemental Figure S4. Expression of DD25::IaaH induces seed abortion. (A) Quantification of seed phenotypes in independent lines expressing DD25::IaaH. The seeds were classified in three distinct classes, as shown in Supplemental Fig. S5. (B) Seed germination rates in lines expressing DD25::IaaH. (C, D) Same as for (A) and (B), but using DD25::IaaH as pollen donor crossed to WT. Numbers on top indicate number of seeds analyzed. (E-F) Activity of maternal DR5v2 at 5 days after pollination with WT (E) or DD25::IaaH (F) pollen. Pictures show representative seeds of three independent siliques per cross. Scale bars indicate 50 μm. (G) Percentage of seeds showing increased DR5v2::VENUS expression after pollination with a WT, osd1 or DD25::IaaH-expressing father. For DD25::IaaH, line #10 was used. The seeds were categorized as showing weak or strong DR5 signals according to panels (E) and (F), respectively. WT, wild type.
5 Supplemental Figure S5. Seed classification used for the phenotypic quantification of DD25::IaaH phenotypes in Fig. 4 and Supplemental Figs. S4 and S7. (A) WT-like seed, (B) Intermediate phenotype, misshapen seeds, (C) Fully collapsed and shriveled seed. (D) Overall view of the progeny of a DD25::IaaH transgenic line.
6 Supplemental Figure S6. Endosperm cellularization as determined by Feulgen staining. (A-C) Seeds at 5 days after pollination (DAP) of WT 2x (A), WT 3x (B) and DD25::IaaH 2x (C). (D-F) Same as for (A-C), but for 7 DAP seeds. Pictures show representative seeds of 10 independent siliques per cross. Arrows indicate cellularized endosperm and arrowheads indicate free endosperm nuclei surrounding the embryo. Scale bars indicate 50 μm. WT, wild type.
7 Supplemental Fig. S7. Expression map of commonly upregulated genes in 3x seeds and DD25::IaaH seeds. Gene expression was assessed in the endosperm and in the seed coat at different stages of seed development (containing pre-globular, globular and heart-stage embryos). Plotted are the genes belonging to GO-terms related with endosperm cellularisation (Table 2).
8
9 Supplemental Figure S8. Seed phenotypes of 2x and 3x seeds. Mature seeds of WT Col-0, 2x (A) and 3x (B), and axr1 mutant, 2x (C) and 3x (D). (E) Quantification of seed malformation in 2x seeds of wild-type (WT), axr1 and wei8 tar1 tar2/+ plants. (F-G) Phenotypic classification of 3x seeds resulting from crosses with WT, axr1 and klu mutant mothers (F), and their corresponding germination rate (G). (H-I) Phenotypic classification of 3x seeds resulting from crosses with the mini3 mutant (F), and their corresponding germination rate (I). (J-K) Phenotypic classification of 2x seeds resulting from crosses of WT, axr1 and klu mutant mothers to a father expressing DD25::IaaH (H), and their corresponding germination rate (I). Differences between WT and mutant seed germination in (I) are significant for Chi-square test for p<0.05 (*). Numbers on top indicate number of seeds assayed.
10 Supplemental Figure S9. Loss of AXR1 function restores endosperm cellularization in 3x seeds. (A-C) 2x axr1 seeds at 5, 6 and 7 days after pollination (DAP). (D-F) Same as for (A-C), but for 3x WT seeds. (G-I) Same as (A-C), but for 3x axr1 seeds. Pictures show representative seeds of 10 independent siliques per cross. Arrows indicate cellularized endosperm and arrowheads indicate free endosperm nuclei surrounding the embryo. Scale bars indicate 50 μm. WT, wild type.
11 Supplemental Figure S10. Over-production of auxin in the seed coat results in a triploid-like seed phenotype. (A) Representative photo of seeds aborting in a transgenic line expressing KLU::YUC6. (B-C) Seeds expressing KLU::YUC6 show embryo retardation and the endosperm shows signs of continued proliferation (arrows). (D) Quantification of seed phenotypes in independent lines expressing KLU::YUC6. Numbers on top indicate number of seeds assayed. (E- F) The transgenic KLU::YUC6 seeds show increased auxin activity, as measured by the DR5v2 auxin sensor. Scale bars indicate 50 μm. WT, wild type.
12 Supplemental Figure S11. Downregulation of auxin-related genes coincides with the timing of endosperm cellularization. (A-B) Reporter activity for YUC10::YUC10:GFP (A) and PGP10::GFP (B) during seed development (4 to 6 days after pollination, DAP). Scale bars indicate 50 μm. (C-E) Relative gene expression in seeds at 4, 5 and 6 DAP, as determined by RT-qPCR for YUC11 (C), TAR1 (D), and ARFs (E). Each figure panel shows a representative biological replicate. ARF12, 13, 14, 15, 21 and 22 were assayed together due to high sequence similarity. Three technical replicates were performed and error bars indicate standard deviation. Differences are significant for Student s T-test for p<0.05 (*). N/D, transcript not detected.
13 Supplemental Table S1 Significantly enriched biological processes for genes upregulated in 3x seeds (Ler osd1 cross) but not in DD25::IaaH 2x seeds, at 6 days after pollination (Log2FC >1, p- value 0.05). GO-terms that are similar to those enriched for genes commonly upregulated in 3x seeds and DD25::IaaH seeds (Table 2) are marked in bold. GO-term p-value Number of genes Description GO: E killing of cells of other organism GO: E cell killing GO: E defense response to fungus GO: E-02 2 intracellular auxin transport GO: E-02 2 antibiotic transport GO: E-02 2 cadmium ion homeostasis GO: E-02 2 cell wall mannoprotein biosynthetic process GO: E-02 3 gamma-aminobutyric acid metabolic process GO: E-02 3 carpel formation GO: E-02 4 regulation of sequence-specific DNA binding transcription factor activity GO: E-02 7 toxin metabolic process GO: E-02 8 response to zinc ion GO: E-02 8 detoxification GO: E cellular response to water deprivation GO: E response to toxic substance GO: E monosaccharide metabolic process GO: E regulation of stomatal movement GO: E cell wall modification GO: E regulation of transcription from RNA polymerase II promoter
14 Supplemental Table S2. Primer list Name Promoter DD25 Gene reference AT3G04540 Used for Primer sequence (5-3 )* GGGGACAAGTTTGTACAAAAAAGCAGGCTGAGCTCCTTCCTACGTTTTGTCACTA Cloning GGGGACCACTTTGTACAAGAAAGCTGGGTACTAGTAGACAACGAAGCAGCCATTAT Promoter KLU AT1G13710 Cloning GGGGACAAGTTTGTACAAAAAAGCAGGCTGAGCTCCAGTGTGCAATTTTCGTTAGGA GGGGACCACTTTGTACAAGAAAGCTGGGTGCTAGCGGCAGGAGAGAGAGAGTGTTG YUC6 AT5G25620 Cloning PP2A AT1G69960 qpcr PHE1 AT1G65330 qpcr YUC10 AT1G48910 qpcr YUC11 AT1G21430 qpcr TAR1 AT1G23320 qpcr PGP10 AT1G10680 qpcr ARF12,13, 14,15,21,22 AT1G34310 AT1G34170 AT1G35540 AT1G35520 AT1G34410 AT1G34390 qpcr AGL62 AT5G60440 qpcr AGL36 AT5G26650 qpcr PEG2 AT1G49290 qpcr PEG9 At5g15140 qpcr ADM AT4G11940 qpcr *primer adaptors are underlined GGGGACAAGTTTGTACAAAAAAGCAGGCTGGAAGAGAGAGATGGAAGGTAAAC GGGGACCACTTTGTACAAGAAAGCTGGGTGATCATCAATTCCCACCACA TAACGTGGCCAAAATGATGC GTTCTCCACAACCGCTTGGT TCCAACACCGAAAACTCCAT CGCATGTGCGGTCATCC GCGAGATTCAGGTTATCAATGG GTAACCAGTAGCAAACACAATCG GTTTGCAGTGCCTCTCTGTG TGTGGCGTATTCGTCAAGGT GTTCCTTATTACTCCACATACGTG CATCAGGGTTGTTCGGTGAC ACAACAAGCATTGGATCGGC TTGATCGTCGATAGCCGGTG AAGTTCAAATGCAAGGTG TGCAGAATTCAGGCCATGG CCTCCTCACCAACACAACAA ACCTTTGAACCCCTCGAGTT GTGCTCTCATCTACAGTCCA CATCATCTTCTTGGTTCGGG GGAAGTGATAGAAGCGGTAGAG TAAACCTCGCACTCACAATCTC ACAACAAGACGACGAATAATCTG GCATACCTTAGTAGCAAACCG TTGAAAGAGTTTGCGGATGTG AGGACCAACATTATGGTCATACC
Supplemental Data. Guo et al. (2015). Plant Cell /tpc
Supplemental Figure 1. The Mutant exb1-d Displayed Pleiotropic Phenotypes and Produced Branches in the Axils of Cotyledons. (A) Branches were developed in exb1-d but not in wild-type plants. (B) and (C)
sides of the aleurone (Al) but it is excluded from the basal endosperm transfer layer
Supplemental Data. Gómez et al. (2009). The maize transcription factor MRP-1 (Myb-Related-Protein-1) is a key regulator of the differentiation of transfer cells. Supplemental Figure 1. Expression analyses
Supplemental Data. Na Xu et al. (2016). Plant Cell /tpc
Supplemental Figure 1. The weak fluorescence phenotype is not caused by the mutation in At3g60240. (A) A mutation mapped to the gene At3g60240. Map-based cloning strategy was used to map the mutated site
S156AT168AY175A (AAA) were purified as GST-fusion proteins and incubated with GSTfused
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 Supplemental Materials Supplemental Figure S1 (a) Phenotype of the wild type and grik1-2 grik2-1 plants after 8 days in darkness.
SUPPLEMENTARY INFORMATION
AS-NMD modulates FLM-dependent thermosensory flowering response in Arabidopsis NATURE PLANTS www.nature.com/natureplants 1 Supplementary Figure 1. Genomic sequence of FLM along with the splice sites. Sequencing
B. Transgenic plants with strong phenotype (%)
A. TCTAGTTGTTGTTGTTATGGTCTAGTTGTTGTTGTTATGGTCTAATTT AAATATGGTCTAAAGAAGAAGAATATGGTCTAAAGAAGAAGAATATGG 2XP35S STTM165 5 GGGGGATGAAGctaCCTGGTCCGA3 3 CCCCCUACUUC---GGACCAGGCU5 mir165 HindIII mir165 96 nt GTTGTTGTTGTTATGGTCTAGTTGTTGTTGTTATGGTCTAATTT
Supplemental Data. Wang et al. Plant Cell. (2013) /tpc
SNL1 SNL Supplemental Figure 1. The Expression Patterns of SNL1 and SNL in Different Tissues of Arabidopsis from Genevestigator Web Site (https://www.genevestigator.com/gv/index.jsp). 1 A 1. 1..8.6.4..
Supplemental Data. Cui et al. (2012). Plant Cell /tpc a b c d. Stem UBC32 ACTIN
A Root Stem Leaf Flower Silique Senescence leaf B a b c d UBC32 ACTIN C * Supplemental Figure 1. Expression Pattern and Protein Sequence of UBC32 Homologues in Yeast, Human, and Arabidopsis. (A) Expression
A Repressor Complex Governs the Integration of
Developmental Cell 15 Supplemental Data A Repressor Complex Governs the Integration of Flowering Signals in Arabidopsis Dan Li, Chang Liu, Lisha Shen, Yang Wu, Hongyan Chen, Masumi Robertson, Chris A.
Supplemental materials
Supplemental materials Materials and methods for supplemental figures Yeast two-hybrid assays TAP46-PP2Ac interactions I. The TAP46 was used as the bait and the full-length cdnas of the five C subunits
AD BD TOC1. Supplementary Figure 1: Yeast two-hybrid assays showing the interaction between
AD X BD TOC1 AD BD X PIFΔAD PIF TOC1 TOC1 PIFΔAD PIF N TOC1 TOC1 C1 PIFΔAD PIF C1 TOC1 TOC1 C PIFΔAD PIF C TOC1 Supplementary Figure 1: Yeast two-hybrid assays showing the interaction between PIF and TOC1
Supplemental Data. Sethi et al. (2014). Plant Cell /tpc
Supplemental Data Supplemental Figure 1. MYC2 Binds to the E-box but not the E1-box of the MPK6 Promoter. (A) E1-box and E-box (wild type) containing MPK6 promoter fragment. The region shown in red denotes
Supplemental Data. Benstein et al. (2013). Plant Cell /tpc
Supplemental Figure 1. Purification of the heterologously expressed PGDH1, PGDH2 and PGDH3 enzymes by Ni-NTA affinity chromatography. Protein extracts (2 µl) of different fractions (lane 1 = total extract,
ABI3 Controls Embryo De-greening Through Mendel's I locus
Supporting Online Material for ABI3 Controls Embryo De-greening Through Mendel's I locus Frédéric Delmas a,b,c, Subramanian Sankaranarayanan d, Srijani Deb d, Ellen Widdup d, Céline Bournonville b,c,norbert
Supporting Information
Supporting Information ing and Friml.73/pnas.6727 R5rev::GFP R5rev::GFP um R5rev::GFP um NP F G H R5rev::GFP/pin3 iaamxq63 iaamxq63 Try iaamxj234 iaamxj234 Try Fig. S. Increased auxin levels and differentiation
Supplemental Data. Wu et al. (2). Plant Cell..5/tpc RGLG Hormonal treatment H2O B RGLG µm ABA µm ACC µm GA Time (hours) µm µm MJ µm IA
Supplemental Data. Wu et al. (2). Plant Cell..5/tpc..4. A B Supplemental Figure. Immunoblot analysis verifies the expression of the AD-PP2C and BD-RGLG proteins in the Y2H assay. Total proteins were extracted
Supplementary Figure 1. jmj30-2 and jmj32-1 produce null mutants. (a) Schematic drawing of JMJ30 and JMJ32 genome structure showing regions amplified
Supplementary Figure 1. jmj30-2 and jmj32-1 produce null mutants. (a) Schematic drawing of JMJ30 and JMJ32 genome structure showing regions amplified by primers used for mrna expression analysis. Gray
Supplemental Figure 1. VLN5 retains conserved residues at both type 1 and type 2 Ca 2+ -binding
Supplemental Figure 1. VLN5 retains conserved residues at both type 1 and type 2 Ca 2+ -binding sites in the G1 domain. Multiple sequence alignment was performed with DNAMAN6.0.40. Secondary structural
Supplementary Information. c d e
Supplementary Information a b c d e f Supplementary Figure 1. atabcg30, atabcg31, and atabcg40 mutant seeds germinate faster than the wild type on ½ MS medium supplemented with ABA (a and d-f) Germination
WiscDsLox485 ATG < > //----- E1 E2 E3 E4 E bp. Col-0 arr7 ARR7 ACTIN7. s of mrna/ng total RNA (x10 3 ) ARR7.
A WiscDsLox8 ATG < > -9 +0 > ---------//----- E E E E E UTR +9 UTR +0 > 00bp B S D ol-0 arr7 ol-0 arr7 ARR7 ATIN7 D s of mrna/ng total RNA opie 0. ol-0 (x0 ) arr7 ARR7 Supplemental Fig.. Genotyping and
Supplemental Figure 1. Rosette Leaf Morphology of Single, Double and Triple Mutants of eid3, phya-201 and phyb-5. Photographs of Ler wild type,
Supplemental Figure 1. Rosette Leaf Morphology of Single, Double and Triple Mutants of eid3, phya-201 and phyb-5. Photographs of Ler wild type, phya-201, phyb-5, phya-201 phyb-5, eid3, phya-201 eid3, phyb-5
Supplemental Data. Borg et al. Plant Cell (2014) /tpc
Supplementary Figure 1 - Alignment of selected angiosperm DAZ1 and DAZ2 homologs Multiple sequence alignment of selected DAZ1 and DAZ2 homologs. A consensus sequence built using default parameters is shown
Supplemental Data. Steiner et al. Plant Cell. (2012) /tpc
Supplemental Figure 1. SPY does not interact with free GST. Invitro pull-down assay using E. coli-expressed MBP-SPY and GST, GST-TCP14 and GST-TCP15. MBP-SPY was used as bait and incubated with equal amount
Supplemental Figure 1.
Supplemental Data. Charron et al. Dynamic landscapes of four histone modifications during de-etiolation in Arabidopsis. Plant Cell (2009). 10.1105/tpc.109.066845 Supplemental Figure 1. Immunodetection
Supplemental Data. Fan et al. (2014). Plant Cell /tpc
Supplemental Data. Fan et al. (). Plant Cell./tpc.. Cell wall EXP EXP EXP9 HLH/bHLH AIF HFR HBI PAR ABAR Atg778 At3g39 Atg38 Atg3 EXP EXP6 EXP8 Photosynthesis PSAD- PSAD- PSBY PSBO- PSAN LHCB6 PSBS LHCB
Nature Genetics: doi: /ng.3556 INTEGRATED SUPPLEMENTARY FIGURE TEMPLATE. Supplementary Figure 1
INTEGRATED SUPPLEMENTARY FIGURE TEMPLATE Supplementary Figure 1 REF6 expression in transgenic lines. (a,b) Expression of REF6 in REF6-HA ref6 and REF6ΔZnF-HA ref6 plants detected by RT qpcr (a) and immunoblot
Nature Genetics: doi: /ng Supplementary Figure 1. ChIP-seq genome browser views of BRM occupancy at previously identified BRM targets.
Supplementary Figure 1 ChIP-seq genome browser views of BRM occupancy at previously identified BRM targets. Gene structures are shown underneath each panel. Supplementary Figure 2 pref6::ref6-gfp complements
Supplementary Information
Supplementary Information MED18 interaction with distinct transcription factors regulates plant immunity, flowering time and responses to hormones Supplementary Figure 1. Diagram showing T-DNA insertion
Supplemental Data. Lin et al. Plant Cell. (2014) /tpc
Supplemental Figure 1. Scheme for extraction of polysome-mrna from in vitro germinated pollen (in vitro), pollinated (in vivo stage, ST14 and ST15a) and non-pollinated (Bud stage, ST10-12) floral buds.
Supplemental Figure 1. Phos-Tag mobility shift detection of in vivo phosphorylated ERF6 in 35S:ERF6 WT plants after B. cinerea inoculation.
Supplemental Figure 1. Phos-Tag mobility shift detection of in vivo phosphorylated ERF6 in 35S:ERF6 WT plants after B. cinerea inoculation. Protein extracts from 35S:ERF6 WT seedlings treated with B. cinerea
Supplemental Data. Farmer et al. (2010) Plant Cell /tpc
Supplemental Figure 1. Amino acid sequence comparison of RAD23 proteins. Identical and similar residues are shown in the black and gray boxes, respectively. Dots denote gaps. The sequence of plant Ub is
Table S1. List of primers used in this study.
Gene/Construct/ mutant Primer name Sequence (5 ->3 ) Confimation of T-DNA insertion clh1-1 LBb1 5 GCGTGGACCGCTTGCTGCAACT3 1LP1 5 CCGAAAATGATAAATGCATGG3 1RP1 5 ATGTCCAGCTCGAAAGATTCC3 clh2-1 Lb4 5 CTACAAATTGCCTTTTCTTATCGAC3
Supplemental Data. Dai et al. (2013). Plant Cell /tpc Absolute FyPP3. Absolute
A FyPP1 Absolute B FyPP3 Absolute Dry seeds Imbibed 24 hours Dry seeds Imbibed 24 hours C ABI5 Absolute Dry seeds Imbibed 24 hours Supplemental Figure 1. Expression of FyPP1, FyPP3 and ABI5 during seed
Supplemental Figure 1 HDA18 has an HDAC domain and therefore has concentration dependent and TSA inhibited histone deacetylase activity.
Supplemental Figure 1 HDA18 has an HDAC domain and therefore has concentration dependent and TSA inhibited histone deacetylase activity. (A) Amino acid alignment of HDA5, HDA15 and HDA18. The blue line
Supplemental Materials
Supplemental Materials Supplemental Figure S. Phenotypic assessment of alb4 mutant plants under different stress conditions. (A) High-light stress and drought stress. Wild-type (WT) and alb4 mutant plants
Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product.
Supplementary Information Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product. Total protein extracted from Kitaake wild type and rice plants carrying
Supplemental Figure legends Figure S1. (A) (B) (C) (D) Figure S2. Figure S3. (A-E) Figure S4. Figure S5. (A, C, E, G, I) (B, D, F, H, Figure S6.
Supplemental Figure legends Figure S1. Map-based cloning and complementation testing for ZOP1. (A) ZOP1 was mapped to a ~273-kb interval on Chromosome 1. In the interval, a single-nucleotide G to A substitution
Supplemental Data. Challa et al. (2016). Plant Cell /tpc
Supplemental Figure 1. DEX-induced TCP4 activity rescues jaw-d phenotypes. (A) and (B) Rosettess of 32-day-old Col-0;ProTCP4:mTCP4:GR plants (A) and jaw-d;protcp4:mtcp4:gr (B) plants grown in mock or in
Supplemental Data. Furlan et al. Plant Cell (2017) /tpc
Supplemental Data. Furlan et al. Plant Cell (0) 0.0/tpc..00. Supplemental Data. Furlan et al. Plant Cell (0) 0.0/tpc..00. Supplemental Data. Furlan et al. Plant Cell (0) 0.0/tpc..00. Supplemental Figure.
What are the Properties of the Protein EMB2777?
Of EMB2777 and F14J22.20 - exons & introns by Hanbee O What are the Properties of the Protein EMB2777?! Embryo defective / seed lethal transcriptional factor o Sas10 / U3 ribonucleoprotein (Utp) family
AD-FIL AD-YAB2 -2 BD-JAZ3 AD-YAB3 AD-YAB5 AD-FIL -4 3AT BD-JAZ3 AD-YAB3
3 4 9 10 11 12 AD-FIL AD-YAB5 2 B AD-YAB3 1 BD-JAZ 5 6 7 8 AD-FIL A AD-YAB2 Supplemental Data. Boter et al. (2015). Plant Cell 10.1105/tpc.15.00220 BD AD-YAB2-2 -2 BD-JAZ3 AD-YAB3 BD AD-YAB5-4 AD-FIL -4
Supplemental Information
Supplemental Information Supplemental Figure 1. The Heterologous Yeast System for Screening of Arabidopsis JA Transporters. (A) Exogenous JA inhibited yeast cell growth. Yeast cells were diluted to various
Jung-Nam Cho, Jee-Youn Ryu, Young-Min Jeong, Jihye Park, Ji-Joon Song, Richard M. Amasino, Bosl Noh, and Yoo-Sun Noh
Developmental Cell, Volume 22 Supplemental Information Control of Seed Germination by Light-Induced Histone Arginine Demethylation Activity Jung-Nam Cho, Jee-Youn Ryu, Young-Min Jeong, Jihye Park, Ji-Joon
Supplementary Information
Supplementary Information ER-localized auxin transporter PIN8 regulates auxin homeostasis and male gametophyte development in Arabidopsis Supplemental Figures a 8 6 4 2 Absolute Expression b Absolute Expression
Supplemental Figure 1
12 1 8 Embryo 6 5 4 Silk 6 4 2 3 2 1 1 15 21 24 3 35 4 45 days after pollination 2 6 12 24 72 hours after pollination 35 6 3 25 2 15 1 5 Endosperm 8 12 21 22 3 35 4 45 days after pollination 5 4 3 2 1
Fig. S1. TPL and TPL N176H protein interactions. (A) Semi-in vivo pull-down assays using recombinant GST N-TPL and GST N-TPL N176H fusions and
Fig. S1. TPL and TPL N176H protein interactions. (A) Semi-in vivo pull-down assays using recombinant GST N-TPL and GST N-TPL N176H fusions and transgenic Arabidopsis TPL-HA lysates. Immunoblotting of input
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Endogenous gene tagging to study subcellular localization and chromatin binding. a, b, Schematic of experimental set-up to endogenously tag RNAi factors using the CRISPR Cas9 technology,
Supplemental Data. Jing et al. (2013). Plant Cell /tpc
Supplemental Figure 1. Characterization of epp1 Mutants. (A) Cotyledon angles of 5-d-old Col wild-type (gray bars) and epp1-1 (black bars) seedlings under red (R), far-red (FR) and blue (BL) light conditions,
Review of previous work: Overview of previous work on DNA methylation and chromatin dynamics
CONTENTS Preface Acknowledgements Lists of Commonly Used Abbreviations Review of previous work: Overview of previous work on DNA methylation and chromatin dynamics Introduction Enzymes involved in DNA
BS 50 Genetics and Genomics Week of Oct 24
BS 50 Genetics and Genomics Week of Oct 24 Additional Practice Problems for Section Question 1: The following table contains a list of statements that apply to replication, transcription, both, or neither.
SUPPLEMENTARY INFORMATION
doi:10.1038/nature09861 & &' -(' ()*+ ')(+,,(','-*+,&,,+ ',+' ' 23,45/0*6787*9:./09 ;78?4?@*+A786?B- &' )*+*(,-* -(' ()*+ ')(+,,(','-*+,&,,+ ',+'./)*+*(,-*..)*+*(,-*./)*+*(,-*.0)*+*(,-*..)*+*(,-*
RNA-Seq Now What? BIS180L Professor Maloof May 24, 2018
RNA-Seq Now What? BIS180L Professor Maloof May 24, 2018 We have differentially expressed genes, what do we want to know about them? We have differentially expressed genes, what do we want to know about
Name AP Biology Mrs. Laux Take home test #11 on Chapters 14, 15, and 17 DUE: MONDAY, DECEMBER 21, 2009
MULTIPLE CHOICE QUESTIONS 1. Inducible genes are usually actively transcribed when: A. the molecule degraded by the enzyme(s) is present in the cell. B. repressor molecules bind to the promoter. C. lactose
Supplemental Data. Seo et al. (2014). Plant Cell /tpc
Supplemental Figure 1. Protein alignment of ABD1 from other model organisms. The alignment was performed with H. sapiens DCAF8, M. musculus DCAF8 and O. sativa Os10g0544500. The WD40 domains are underlined.
Supplementary Table, Figures and Videos
Supplementary Table, Figures and Videos Table S1. Oligonucleotides used for different approaches. (A) RT-qPCR study. (B) qpcr study after ChIP assay. (C) Probes used for EMSA. Figure S1. Notch activation
supplementary information
DOI: 10.1038/ncb1979 Figure S1 Alignment and domain composition of HsTSN and PaTSN. Since both HsTSN (accession number AAA80488) and PaTSN (accession number CAL38976) have five staphylococcal nuclease
Technical Review. Real time PCR
Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously
Supplemental Data. Bai et al. Plant Cell. (2012) /tpc A
A B Unconserved Conserved AIF4 AIF2 AIF3 AIF1 UPB1 IBH1 Supplemental Figure 1. IBH1, UPB1 and AIFs belong to the same HLH family. (A), Part of a phylogenetic tree constructed using conserved domains shows
SUPPLEMENTARY INFORMATION
Gene replacements and insertions in rice by intron targeting using CRISPR Cas9 Table of Contents Supplementary Figure 1. sgrna-induced targeted mutations in the OsEPSPS gene in rice protoplasts. Supplementary
9. What proteins will be affected by mutations in the trans-acting elements? Cis-acting elements?
6. What regulates the expression of a gene? 7. What are the cis- and trans-acting elements? 8. Can a deficiency in a trans-acting element be overcome by the addition of another copy of the gene to a cell?
Figure S1. DELLA Proteins Act as Positive Regulators to Mediate GA-Regulated Anthocyanin
Supplemental Information Figure S1. DELLA Proteins Act as Positive Regulators to Mediate GA-Regulated Anthocyanin Biosynthesis. (A) Effect of GA on anthocyanin content in WT and ga1-3 seedlings. Mock,
Supplemental Data. Zhou et al. (2016). Plant Cell /tpc
Supplemental Figure 1. Confirmation of mutant mapping results. (A) Complementation assay with stably transformed genomic fragments (ComN-N) (2 kb upstream of TSS and 1.5 kb downstream of TES) and CaMV
Supplementary Fig 1. The responses of ERF109 to different hormones and stresses. (a to k) The induced expression of ERF109 in 7-day-old Arabidopsis
Supplementary Fig 1. The responses of ERF109 to different hormones and stresses. (a to k) The induced expression of ERF109 in 7-day-old Arabidopsis seedlings expressing ERF109pro-GUS. The GUS staining
Supplemental Data. Huo et al. (2013). Plant Cell /tpc
Supplemental Data. Huo et al. (2013). Plant Cell 10.1105/tpc.112.108902 1 Supplemental Figure 1. Alignment of NCED4 Amino Acid Sequences from Different Lettuce Varieties. NCED4 amino acid sequences are
Supplemental Figure 1. DAPI Staining Analysis of Wild-type and mads3-4 Microspores.
Fig. S1 Supplemental Figure 1. DAPI Staining Analysis of Wild-type and mads3-4 Microspores. (A): Wild-type microspores appeared to undergo normal meiosis, generating a tetrad at stage 8 (Zhang and Wilson
b number of motif occurrences
supplementary information DOI: 1.138/ncb194 a b number of motif occurrences number of motif occurrences number of motif occurrences I II III IV V X TTGGTCAGTGCA 3 8 23 4 13 239 TTGGTCAGTGCT 7 5 8 1 3 83
Experimental Tools and Resources Available in Arabidopsis. Manish Raizada, University of Guelph, Canada
Experimental Tools and Resources Available in Arabidopsis Manish Raizada, University of Guelph, Canada Community website: The Arabidopsis Information Resource (TAIR) at http://www.arabidopsis.org Can order
SUPPLEMENTARY INFORMATION
Ca 2+ /calmodulin Regulates Salicylic Acid-mediated Plant Immunity Liqun Du, Gul S. Ali, Kayla A. Simons, Jingguo Hou, Tianbao Yang, A.S.N. Reddy and B. W. Poovaiah * *To whom correspondence should be
Supplemental Figure 1. Immunoblot analysis of wild-type and mutant forms of JAZ3
Supplemental Data. Chung and Howe (2009). A Critical Role for the TIFY Motif in Repression of Jasmonate Signaling by a Stabilized Splice Variant of the JASMONATE ZIM-domain protein JAZ10 in Arabidopsis.
Supplementary Figures
Supplementary Figures Supplementary Figure 1. Apoptosis analyses and quantification. Activated caspase3 immunostaining on sections of E9.0 Tcof1 +/ -;p53 +/- (a) and Tcof1 +/ -;p53 -/- (b) littermate embryos
Trasposable elements: Uses of P elements Problem set B at the end
Trasposable elements: Uses of P elements Problem set B at the end P-elements have revolutionized the way Drosophila geneticists conduct their research. Here, we will discuss just a few of the approaches
Isolation of single-base genome-edited human ips cells without
Nature Methods Isolation of single-base genome-edited human ips cells without antibiotic selection Yuichiro Miyaoka, Amanda H. Chan, Luke M. Judge, Jennie Yoo, Miller Huang, Trieu D. Nguyen, Paweena P.
Pattern Formation via Small RNA Mobility SUPPLEMENTAL FIGURE 1 SUPPLEMENTAL INFORMATION. Daniel H. Chitwood et al.
SUPPLEMENTAL INFORMATION Pattern Formation via Small RNA Mobility Daniel H. Chitwood et al. SUPPLEMENTAL FIGURE 1 Supplemental Figure 1. The ARF3 promoter drives expression throughout leaves. (A, B) Expression
Supplementary Data Supplementary Figures
Supplementary Data Supplementary Figures Supplementary Figure 1. Pi04314 is expressed during infection, each GFP-Pi04314 fusion is stable and myr GFP-Pi04314 is removed from the nucleus while NLS GFP-Pi04314
PIE1 ARP6 SWC6 KU70 ARP6 PIE1. HSA SNF2_N HELICc SANT. pie1-3 A1,A2 K1,K2 K1,K3 K3,LB2 A3, A4 A3,LB1 A1,A2 K1,K2 K1,K3. swc6-1 A3,A4.
A B N-terminal SWC2 H2A.Z SWC6 ARP6 PIE1 HSA SNF2_N HELICc SANT C pie1-3 D PIE1 ARP6 5 Kb A1 200 bp A3 A2 LB1 arp6-3 A4 E A1,A2 A3, A4 A3,LB1 K1,K2 K1,K3 K3,LB2 SWC6 swc6-1 A1,A2 A3,A4 K1,K2 K1,K3 100
Figure S1. TT and MZ-CRC-1 cell viability and proliferation after Palbociclib treatment. Cell viability assays (A) and cell counting assays (B) were
Figure S1. TT and MZ-CRC-1 cell viability and proliferation after Palbociclib treatment. Cell viability assays (A) and cell counting assays (B) were performed with TT and MZ-CRC-1 cells treated with Palbociclib
Supplemental Data. Tang et al. Plant Cell. (2012) /tpc
Supplemental Figure 1. Relative Pchlide Fluorescence of Various Mutants and Wild Type. Seedlings were grown in darkness for 5 d. Experiments were repeated 3 times with same results. Supplemental Figure
Supplementary Figure 1 PZA inhibits root hair formation as well as cell elongation in the maturation zone of eto1-2 roots. (A) The PI staining of the
Supplementary Figure 1 PZA inhibits root hair formation as well as cell elongation in the maturation zone of eto1-2 roots. (A) The PI staining of the roots of three-day-old etiolated seedlings of Col-0
- PDI5. - Actin A 300-UTR5. PDI5 lines WT. Arabidopsis Chromosome 1. PDI5 (At1g21750) SALK_ SALK_ SALK_015253
Supplemental Data. Ondzighi et al. (2008). Arabidopsis Protein Disulfide Isomerase-5 Inhibits ysteine Proteases During Trafficking to Vacuoles Prior to Programmed ell Death of the dothelium in Developing
(b) Genotyping of SALK_ (AT1g51690) and SALK_ (At1g17720) to find homozygous single mutant plants.
Supplemental Table 1. Primers used for cloning and RT-PCR. The B-type subunits cdna CDS were amplified using high-fidelity PCR amplification with gene specific primers. The cdna CDS sequences were obtained
Supplemental Data. Li et al. (2015). Plant Cell /tpc
Supplemental Data Supplemental Figure 1: Characterization of asr3 T-DNA knockout lines and complementation transgenic lines. (A) The scheme of At2G33550 (ASR3) with gray boxes indicating exons and dash
Key Area 1.3: Gene Expression
Key Area 1.3: Gene Expression RNA There is a second type of nucleic acid in the cell, called RNA. RNA plays a vital role in the production of protein from the code in the DNA. What is gene expression?
Regulation of transcription by the MLL2 complex and MLL complex-associated AKAP95
Supplementary Information Regulation of transcription by the complex and MLL complex-associated Hao Jiang, Xiangdong Lu, Miho Shimada, Yali Dou, Zhanyun Tang, and Robert G. Roeder Input HeLa NE IP lot:
Supplemental Data. Wang et al. (2016). Plant Cell /tpc
Supplemental Figure 1. Time-Course Analysis of Storage Proteins during Endosperm Development of the Wild-type 9311 and the gpa4-1 Mutant. (A) SDS-PAGE analyses of seed storage proteins during wild-type
SUPPLEMENTARY INFORMATION
doi: 10.1038/nature06147 SUPPLEMENTARY INFORMATION Figure S1 The genomic and domain structure of Dscam. The Dscam gene comprises 24 exons, encoding a signal peptide (SP), 10 IgSF domains, 6 fibronectin
Bioengineering of Tobacco Mosaic Virus to Create a Non- Infectious Positive Control for Ebola Diagnostic Assays
Supplementary Information for Bioengineering of Tobacco Mosaic Virus to Create a Non- Infectious Positive Control for Ebola Diagnostic Assays Patricia Lam 1, Neetu M. Gulati 2,3, Phoebe L. Stewart 2,3,
6/256 1/256 0/256 1/256 2/256 7/256 10/256. At3g06290 (SAC3B)
Chr.III M 5M 1M 15M 2M 23M BAC clones F22F7 F1A16 F24F17 F24P17 T8E24 F17A9 F21O3 F17A17 F18C1 F2O1 F28L1 F5E6 F3E22 T1B9 MLP3 Number of recombinants 6/256 1/256 /256 1/256 2/256 7/256 1/256 At3g629 (SAC3B)
Supplementary Table S1 qrt-pcr primers for the genes related to the flavonoid, lignin and starch metabolism pathways
Altered Phenylpropanoid Metabolism in the Maize Lc-Expressed Sweet Potato (Ipomoea batatas) Affects Storage Root Development. Hongxia Wang, JunYang, Min Zhang, Weijuan Fan, Nurit Firon, Sitakanta Pattanaik,
embryos. Asterisk represents loss of or reduced expression. Brackets represent
Supplemental Figures Supplemental Figure 1. tfec expression is highly enriched in tail endothelial cells (A- B) ISH of tfec at 15 and 16hpf in WT embryos. (C- D) ISH of tfec at 36 and 38hpf in WT embryos.
Engineering splicing factors with designed specificities
nature methods Engineering splicing factors with designed specificities Yang Wang, Cheom-Gil Cheong, Traci M Tanaka Hall & Zefeng Wang Supplementary figures and text: Supplementary Figure 1 Supplementary
(a) Scheme depicting the strategy used to generate the ko and conditional alleles. (b) RT-PCR for
Supplementary Figure 1 Generation of Diaph3 ko mice. (a) Scheme depicting the strategy used to generate the ko and conditional alleles. (b) RT-PCR for different regions of Diaph3 mrna from WT, heterozygote
Sperm cells are passive cargo of the pollen tube in plant fertilization
In the format provided by the authors and unedited. SUPPLEMENTARY INFORMATION VOLUME: 3 ARTICLE NUMBER: 17079 Sperm cells are passive cargo of the pollen tube in plant fertilization Jun Zhang 1, Qingpei
Supplemental Materials. Zhu et al. RNAi suppression of DDM1 in poplar
%mc Supplemental Materials Zhu et al. RNAi suppression of in poplar Supplemental Fig. S1 Total cellular cytosine methylation for selected events determined by HPLC. The association between methylcytosine
F 11/23 Happy Thanksgiving! 8 M 11/26 Gene identification in the genomic era Bamshad et al. Nature Reviews Genetics 12: , 2011
3 rd Edition 4 th Edition Lecture Day Date Topic Reading Problems Reading Problems 1 M 11/5 Complementation testing reveals that genes are distinct entities Ch. 7 224-232 2 W 11/7 One gene makes one protein
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/10/496/eaam6291/dc1 Supplementary Materials for Regulation of autophagy, NF-κB signaling, and cell viability by mir-124 in KRAS mutant mesenchymal-like NSCLC cells
Supplementary Figure 1
Supplementary Figure 1 Supplementary Fig. 1 shrna mediated knockdown of ZRSR2 in K562 and 293T cells. (a) ZRSR2 transcript levels in stably transduced K562 cells were determined using qrt-pcr. GAPDH was
The yeast two-hybrid assay
Master program Molecular and Cellular Life Sciences Block 1: Intracellular membrane processes 11th October 2011 The yeast two-hybrid assay Fulvio Reggiori Department of Cell Biology, UMC Utrecht For what
Fig. S1. Clustering analysis of expression array and ChIP-PCR assay in the ARF3 locus. (A) Typical examples of the transgenic plants used for
Fig. S1. Clustering analysis of expression array and ChIP-PCR assay in the ARF3 locus. (A) Typical examples of the transgenic plants used for ChIP-chip and ChIP-PCR assays. The presence of pas1:t7:as1
Supplemental Data. Hu et al. Plant Cell (2017) /tpc
1 2 3 4 Supplemental Figure 1. DNA gel blot analysis of homozygous transgenic plants. (Supports Figure 1.) 5 6 7 8 Rice genomic DNA was digested with the restriction enzymes EcoRⅠ and BamHⅠ. Lanes in the
Supporting Information
Supporting Information Park et al. 10.1073/pnas.1410555111 5 -TCAAGTCCATCTACATGGCC-3 5 -CAGCTGCCCGGCTACTACTA-3 5 -TGCAGCTGCCCGGCTACTAC-3 5 -AAGCTGGACATCACCTCCCA-3 5 -TGACAGGAACACCTACAAGT-3 5 -AAGGCACCTTTCTGTCTCCA-3