Pattern Formation via Small RNA Mobility SUPPLEMENTAL FIGURE 1 SUPPLEMENTAL INFORMATION. Daniel H. Chitwood et al.

Transcription

1 SUPPLEMENTAL INFORMATION Pattern Formation via Small RNA Mobility Daniel H. Chitwood et al. SUPPLEMENTAL FIGURE 1 Supplemental Figure 1. The ARF3 promoter drives expression throughout leaves. (A, B) Expression of the parf3:gus reporter is detected throughout leaves on both the adaxial and abaxial sides in both proximal (A) and distal (B) sections. Note the high reporter activity in the margins and provasculature (PV, arrow) and the diffuse cytoplasmic activity of the GUS protein when not translationally fused to ARF3 (Fig. 1).

2 SUPPLEMENTAL FIGURE 2 Supplemental Figure 2. MIR390 precursor expression in older leaf primordia. (A-B) Transverse sections of pmir390a:gus and pmir390b:gus reporters. pmir390a:gus (A) is expressed more broadly in leaves than pmir390b:gus (B), and both reporters are more active on the adaxial side of leaves than the abaxial side. Note the activity of both reporters in the abaxial epidermis (arrowheads). (C-D) In situ hybridization analyses for MIR390A (C) and MIR390B (D) show prominent accumulation of MIR390 precursors in the epidermis on both the adaxial and abaxial sides of leaves, perhaps as a result from differential processing of precursor transcripts between the epidermis and underlying tissue layers. 2

3 SUPPLEMENTAL FIGURE 3 Supplemental Figure 3. In situ hybridization with MIR390A and MIR390B sense probes. (A, B) Sense probes for MIR390A (A) and MIR390B (B) yield no detectable hybridization signal. 3

4 SUPPLEMENTAL FIGURE 4 Supplemental Figure 4. Diagrammatic representation of riboprobes used to detect MIR390A and MIR390B precursor transcripts and mature mir390. The MIR390A and MIR390B stem-loop structures are drawn and the mir390 (green) and mir390* (purple) sequences indicated. MIR390A and MIR390B precursor probes consist of 244bp and 249bp fragments, respectively, amplified from genomic DNA using the primer pairs listed below. Each fragment includes the 3 side of the predicted stem-loop structure immediately following the mir390* sequence and downstream primary transcript sequence. The mature mir390 probe consists of a 215bp subset of the MIR390B probe in sense orientation fused to mature mir390 anti-sense sequence, and was amplified from genomic DNA using the primer pair listed below. MIR390A F TTGGCTCTTCTTACTACAATG MIR390A R AATACAGATGAAACTTACCCG MIR390B F ATAGCTTCTTCTTGCTTATATG MIR390B R TAAGTTGTAACTTGTAAGACC mir390 F ATAGCTTCTTCTTGCTTATATG mir390 R AAGCTCAGGAGGGATAGGCCACCTGCGATTTTTCTCACTTTC 4

5 SUPPLEMENTAL FIGURE 5 Supplemental Figure 5. Measurement of mir390 levels in serrate-2. MiR390 levels in RNA isolated from wild-type and se-2 mutant seedling apices was measured using an RNA blot assay. RNA was isolated from apices of 7 day-old seedlings using Trizol. 2.0ug of total RNA was resolved by denaturing PAGE in parallel with a mir390 RNA standard and transferred to a positively-charged membrane. Following hybridization with the mir390 complementary oligonucleotide probe, hybridization signals were measured using an Instant Imager (Packard Bioscience). Mature mir390 levels in se-2 are reduced ~4-5 fold compared to Col-0. 5

6 SUPPLEMENTAL FIGURE 6 Supplemental Figure 6. Localization of mature mir390 by in situ hybridization using a locked nucleic acid (LNA) probe. (A) Longitudinal section showing ubiquitous accumulation of mir390 in the apical region of a wild-type seedling. This expression pattern is identical to that obtained using the mir390 riboprobe (Fig. 4). (B) The murine mirna, mir124a, served as negative control and yields no detectable in situ hybridizations signal. (C) Transverse section hybridized with mir390 LNA probe. As with the riboprobe, hybridization with the mir390 LNA probe reveals that mature mir390 accumulates throughout the leaf but predominantly in the margins and provasculature (PV, arrow). (D) In situ hybridization with the negative control mir124a LNA probe. 6

7 SUPPLEMENTAL FIGURE 7 Supplemental Figure 7. Localized expression of AGO7 and TAS3A restricts the domain of tasir-arf biogenesis. (A) Longitudinal section showing the expression of a pago7:gus reporter in the vasculature and pith region beneath the shoot apical meristem and on the adaxial side of leaf primordia (arrowheads). Under dark field microscopy, GUS activity is visualized as red staining. Note the lack of observable reporter activity within the shoot apical meristem and youngest leaf primordia. (B) In situ hybridization analysis for TAS3A shows expression on the adaxial side of leaf primordia (arrowheads), confirming the activity of the TAS3A gene-trap (Fig. 5B) and demonstrating that TAS3A accumulates cell-autonomously. Antisense TAS3A probe was amplified from Arabidopsis Col-0 cdna using the following primer sequences: TAS3A F CGTTTCTTAAGACTCTCTCTC TAS3A R GAATTTATGTCAACCATACATC 7