1. Introduction. Journal of Integrative Agriculture Advanced Online Publication 2015

Transcription

1 A genetic evidence of chromosomal fragment from bridge parent existing in substitution lines between two common wheat varieties ZHAO Pei 1*, WANG Ke 1*, LIN Zhi-shan 1*, LIU Hui-yun 1, LI Xin 1, DU Li-pu 1, YAN Yue-ming 2, YE Xing-guo 1 1 National Key Facility of Crop Gene Resources and Genetic Improvement/Institute of Crop Science, Chinese Academy of Agricultural Sciences, Beijing , P.R.China 2 Key Laboratory of Genetics and Biotechnology, College of Life Science, Capital Normal University, Beijing, P.R.China Abstract Locating of important agronomic genes onto chromosome is helpful for efficient development of new wheat varieties. Wheat chromosome substitution lines between two varieties have been widely used for locating genes because of their distinctive advantages in genetic analysis, compared with the aneuploid genetic materials. from the substituted chromosome, the other chromosomes between the substitution lines and its recipient parent should be identical, which eases the gene locating practice. In this study, a set of chromosome substitution lines with cv. Wichita (WI) as the recipient parent and cv. Cheyenne (CNN) as the donor parent were studied for the composition of high molecular weight glutenin subunits (HMW-GS) as well as a range of agronomic important traits. Results revealed that the substitution lines of WI(CNN5D), WI(CNN6A), and WI(CNN7B) had higher plant heights than the two parents of WI and CNN, and WI(CNN3D) had later maturity than the parents. By sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS) analysis, a substitution line WI(CNN5B) was found to contain different HMW-GS pattern from its two parents, in which 1By9 was replaced by 1By8 on chromosome 1BL. Apart Simple sequence repeat (SSR) analysis confirmed that the variation on 1BL in WI(CNN5B) was originated from Chinese Spring (CS). It is concluded that chromosomal fragments from bridge material and donor parent were quite often retained in intracultivaral chromosome substitution lines except the substituting chromosomes. Keywords: wheat, intracultivaral chromosome substitution lines, agronomic traits, high molecular weight glutenin subunits (HMW-GS), molecular markers 1 1. Introduction Wheat is an economical valued crop in the globe, and its genetic improvement contributes to its stable increase of grain production greatly (Shewry 2009). Gene locating onto chromosome would help to accelerate the development of new wheat varieties (Law et al. 1987). Chromosome substitution lines between two varieties have been used for more than half century for the primary screening and chromosomal locating of some interesting genes controlling important agronomic and physiological traits in wheat (Kuspria and Unrau 1957). Compared with other genetic germplasm used for gene locating in wheat such as nullisomic lines and ditelosomic lines, substitution lines have no negative effect on plant growth and development (Yen and Baenziger 1992). Thereby, using substitution lines to locate genes is a more appropriate way. By using Chinese Spring (CS) ditelosomics, nullisomic-tetrasomics, and CS-Cheyenne disomic substitution lines, four allelic genes of puroindoline b (Pinb) Pinb-2v1, Pinb-2v2, Pinb-2v3, and Pinb-2v4 were mapped on Correspondence YE Xing-guo * Contributed equally to this work.

2 chromosomes 7DL, 7BL, 7B, and 7AL, respectively (Chen et al. 2010). Previously, by employing two substitution lines CS(Cheyenne 5A) and CS(T. Spelta 5A) the synthesis synthase gene of glutathione and hydroxymethylglutathione in wheat during heat stress was locaated on chromosome 5A (Kocsy et al. 2004). Zemetra et al. (1986) developed a complete set of intracultivaral substitution lines between two winter wheat cultivars, Cheyenne (CNN) and Wichita (WI), in which CNN was used as the recipient and WI was the donor cultivar. This substitution set has been extensively used in wheat genetic analysis. By using the substitution lines, a gene affecting winterhardness and vernalization was located on chromosome 3B (Zemetra and Morris 1988), and two genes controlling the activity of two DNA-degrading enzymes of 24.0 and 27.0 kda were mapped onto chromosome 2D (Yen and Baenziger 1994). To understand grain yield in winter wheat, the reciprocal set of chromosome substitution lines in duplicate between CNN and WI were used, and it was found that chromosome 3A, 6A, 2B, and 3D greatly affected grain yield and yield components such as culms per square meter, seed weight, and seeds per culm (Berke et al. 1992a, b). Chromosome 3A also affected plant height and anthesis date (Shah et al. 1999a, b). Further study demonstrated that the quantitative trait loci (QTLs) for the above main agronomic traits were generally localized to three regions of chromosome 3A, in which the major QTLs for kernels per square meter and grain yield were associated within a 5-centimorgan (cm) interval (Campbell et al. 2003). Substitution lines of CNN(WI3A) and CNN(WI6A) had 15 to 20% higher grain yield than CNN, whereas WI(CNN3A) and WI(CNN6A) had 15 to 20% lower grain yield than WI (Baenziger et al. 2011). By using another complete set of chromosome substitution lines between CS and Synthetic 6x, it was proved that the genes inhibiting spikelet differentiation are located on chromosomes 2B and 7D, the genes related to drought tolerance on chromosome 2D (Bai et al. 2007), the genes regulating chlorophyll fluorescence parameters including F o, F m, F v /F m and F v /F o on chromosomes 5B, 3A, 4D, and 7A (Bai et al. 2011), and the genes associated with tolerance to low phosphorus stress on chromosome 2A (Zheng et al. 2013). In addition to above mentioned material, other intracultivaral substitution lines were also used in locating gens in wheat. For examples, employing CS (recipient)/cappelle Desprez (donor) substitution lines, the genes controlling argine accumulation in wheat plants under osmotic stress were assigned on chromosomes 5A and 7A (Galiba et al. 1993), and the genes controlling relative water content (RWC), excised leaf water loss rate (RWL), and drought susceptibility index (DSI) on chromosomes 1A, 5A, 7A, 4B, 5B, 1D, and 5D (Farshadfar et al. 1995). Investigation applying CS (recipient)/hope (donor) substitutions under drought conditions indicated that chromosomes 4B, 5A and 5D carry proline accumulation associated genes, while chromosome 6B and 6D contain proline biosynthesis inhibiting related genes (Yang et al. 1998). All wheat intracultivaral substitution lines were developed using the corresponding mono-telocentric lines of CS as starting material. For the substitution lines with background of CS, mono-telocentric lines of CS were used as the recurrent parents to be crossed with a donor variety. For the substitution lines with background of other wheat cultivar, mono-telocentric lines of CS were used to develop mono-telocentric lines of other cultivar first by crossing and backcrossing. In each hybrid generation selection was made for monosomic individuals for use as pollen parents in the next backcrossing cycle with the mono-telocentric recipient lines. After a minimum of six backcrosses, the monosomics were self-pollinated and plants with 42 chromosomes were selected in which the targeted chromosome pairs were derived from the donor variety (Law et al. 1987; Yen and Baenziger 1992; Kocsy et al. 2004). Because of frequent chromosome crossover in the crossing and backcrossing hybrids,

3 chromosome fragments from donor or bridge parent are expected to be retained in the final background of recipient parent. By applying wheat intracultivaral substitution lines to locate some target genes on chromosomes, the substitution lines should be the complete same to their recipient cultivar in genetics except the replacement chromosome in each line. In this case, some important genes can be located onto chromosome correctly, and wheat breeding program can be accelerated. Otherwise, the mapping of some wheat genes is not précised and convinced by this strategy. Therefore, it is very important to confirm wheat substitution lines between two varieties, especially the quite often used intracultivaral substitution lines of WI and CNN, by proteomics and genetics methods. In order to detect if chromosome fragments of CS are present in the intracultivaral substitution lines, the WI and CNN substitution lines were tested by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS), and simple sequence repeat (SSR) markers in this study. The obtaining results will provide useful information for the correct use of the wheat substitution lines between the two varieties and convinced locations of some important genes in common wheat. 2. Results 2.1. Main agronomic traits of WI and CNN substitution lines All substitution lines and their two parents were sowed in Beijing, in early Ocotober and harvested in middle June. At maturity, all material appeared light black glume in spikes. The whole growth period for all material was 246 days except WI (CNN3D) that was 2 days longer (Table 1). The average height of 20 substitution lines ranged from (WI(CNN4D)) to cm (WI(CNN7B)), while their recipient and donor parents were cm (WI) and 94.3 cm (CNN), respectively. Spike length for the substitution lines was from 9.1 cm (WI(CNN2D)) to 11.0 cm (WI(CNN6A)), with 11.1 cm (WI) and 8.6 cm (CNN) for their two parents. Spike number per plant for the substitution lines was from 6.7 (WI(CNN1B)) to 12.5 (WI(CNN4B)), with 13.3 and 16.7 for WI and CNN, respectively kernel weight for the substitution lines ranged from g (WI(CNN6B)) to g (WI(CNN5D)) while and g for WI and CNN, respectively. Results indicated that most substitution lines were similar to the recipient cultivar WI in plant height except three lines of WI(CNN5D), WI(CNN6A), and WI(CNN7B) which were higher than WI. Their spikes in length were between WI and CNN, and growth period was the same to both parents except a late maturity line of WI(CNN3D). However, the spike number per plant of the substitution lines was less than that of their two parents, and the 1000-grain weight of them were higher than their two parents. It was postulated that these strange changes in agronomic traits might be caused by the genetic substances from the bridge parent of CS except gene interaction between WI and CNN Composition analysis of high molecular weight glutenin subunits (HMW-GS) in the substitution lines To investigate the differences among the substitution lines in storage protein, glutenin was extracted from the grains of the materials and analyzed by SDS-PAGE first. The substitution line WI(CNN5B) showed a different HMW-GS constitution from their parents and other 19 substitution lines, because it displayed one extra HMW-GS band that expressed in the standard variety of CS (Fig. 1). To further investigate the difference in HMW-GS composition among the recipient parent WI, the donor parent CNN, substitution line WI(CNN5B) and CS, the running time of SDS-PAGE was increased. Constitutions of HMW-GS and low molecular weight glutenin subunits (LMW-GS) in the four materials could be seen clearly (Fig. 2). For Glu-D1, the electrophoretic

4 mobility of the x-type subunits in CNN was the same as that of the 1Dx2 in CS, while the electrophoretic mobility of the x-type subunits in WI and WI (CNN5B) were slightly faster than that of 1Dx2. Therefore, the Glu-D1 subunits in WI and WI(CNN5B) were 1Dx5+1Dy10, while in CNN and CS were 1Dx2+1Dy12. For Glu-B1, WI and CNN showed the same constitution of HMW-GS (1Bx7+1By9), while WI(CNN5B) and CS appeared 1Bx7+1By8 (Fig. 2). In addition, WI(CNN5B) also exhibited similar pattern to its recipient cultivar of WI in the area of low molecular weight storage proteins (Fig. 2). It was confirmed that WI(CNN5B) and WI displayed the same glutenin constitutions except Glu-B1 locus. The HMW-GS constitutions in CNN, WI, and WI(CNN5B) were further confirmed by MALDI-TOF-MS analysis (Fig. 3). The deduced molecular mass of 1Ax2* was Da, which was well corresponded to the results from MALDI-TOF-MS (Fig. 3-A and C). It was proved that WI(CNN5B) and WI contained 1Ax2* on the locus of Glu-A1. The deduced molecular mass of related HMW-GS and the MALDI-TOF-MS determined mass of the HMW-GS in CNN, WI, and WI(CNN5B) were summarized in Table 2. In conclusion, the constitutions of HMW-GS were 1Bx7+1By9 and 1Dx2+1Dy12 in CNN, 1Ax2*, 1Bx7+1By9, and 1Dx5+1Dy10 in WI, 1Ax2*, 1Bx7+1By8, and 1Dx5+1Dy10 in WI(CNN5B). Moreover, WI(CNN5B) was the same to its recipient cultivar of WI in the pattern of LMW-GS (Fig. 2). Thereby, we assumed that the 1Bx7+1By8 in WI (CNN5B) might translocate from CS Detection of WI (CNN5B) substitution line by related SSR markers It was well known that all HMW-GS encoding genes in wheat were located on the long arm of group one chromosome, and 1Bx7+1By8 or 1Bx7+1By9 was on 1BL (Payne 1987). Both parents of WI(CNN5B) carried 1Bx7+1By9 on 1BL, but the HMW-GS composition of WI(CNN5B) was 1Bx7+1By8 on 1BL, which was the same to that of its bridge parent CS. In order to further explore the derivation of 1Bx7+1By8 in WI(CNN5B), 6 SSR markers on 5B chromosome and 15 SSR markers on 1B chromosome were selected to detect WI(CNN5B) (Table 3), its two parents and two other chromosome substitution lines of WI(CNN5A) and WI(CNN5D) in the same homoeologous group as well as the bridge parent CS. Except cfd48 on 1BL, other 20 SSR markers on 5BL, 5BS, 1BL, and 1BS amplified the similar products among the six materials (Fig. 4). By using cfd48, four materials showed identical amplification pattern except WI(CNN5B) and CS, which gave similar polymorphic amplicon, (Fig. 4). Results indicated that the 1Bx7+1By8 in WI(CNN5B) was translocated from CS, or the chromosome fragment on 1BL in CS carrying 1Bx7+1By8 and cfd48 marker was retained in the background of WI when WI (1B) monosomics was developed using CS (1B) monosomics as bridge material to be crossed and backcrossed with WI. 3. Discussion Wheat substitution lines between two common wheat varieties have been widely used for gene location of controlling some important agronomic traits in the past twenty years around (Zemetra and Morris 1988; Berke et al. 1992a, b; Yen and Baenziger 1994; Shah et al. 1999; Campbell et al. 2003; Bai et al. 2007; Baenziger et al. 2011; Zheng et al. 2011, 2013). For this purpose, the substitution line should be the same to the receptor parent in genetics except the chromosome of interesting. However, the mono-telocentric lines of CS were used to create the mono-telocentric lines with the background of different varieties before the development of intracultivar substitution lines (Law et al. 1987). For the development of intracultivar substitution lines, the mono-telocentric lines of receptor need to be crossed with the donor line and then background with itself (Law et al. 1987; Kocsy et

5 al. 2004). During the crossing and backcrossing progress, a lot of translocations might have occurred between the varieties employed. In this case, chromosome fragments of donor variety or CS might retain in each substitution line except the chromosome of interest from donor line. In this study, it was confirmed that the 1BL segment of CS carrying 1Bx7+1By8 did retain in the substitution line of WI (CNN5B) (Figs. 1, 2, 3, 4). This research also found that some substitution lines between WI and CNN were different from receptor parent WI and donor parent CNN in some main agronomic traits such as plant height, growth period and grain weight. On the contrary, they were inclined to bridge material CS in those agronomic traits (Table 1). This result suggested that small chromosome pieces of CS might exist in other substitution lines. It is inferred that chromosome fragments of CNN except the substituting chromosomes might also exist in some of the intracultivaral substitution lines. This situation will result in the inaccuracy of gene location. Therefore, the intracultivaral substitution lines used for genetic analysis need to be carefully identified by molecular markers. A high-density microsatellite consensus map for bread wheat was successfully constructed (Somers et al. 2004), and provided a powerful tool for tracing genes of interest and discriminating different wheat lines. For example, a dwarfing somatic variation wheat line was identified to be the same to its mother variety in genetic background by using 44 SSR markers located on 42 chromosome arms (Wang et al. 2013). Different extent of polymorphism among various group 3 chromosomal regions as well as among the homoeologs was found in CNN, WI, and a substitution line of CNN containing chromosome 3A from WI(CNN (WI3A)) revealed with 142 RFLP probes and 55 SSR markers (Dilbirligi et al. 2004). Furthermore, the chromosome 3A of WI can be separated from the corresponding chromosome of CNN by using 22 alleles obtaining from SSR analysis (Mahmood et al. 2004). These studies suggest that SSR markers linked to agronomical important traits on different chromosomes are valuable asset for evaluating genetic similarity of wheat materials. In this study, the 1Bx7+1By8 in WI (CNN5B) was confirmed to be translocated from CS by the SSR marker of cfd48 marker. It was also suggested that the 1Bx7+1By8 at the Glu-B1 locus in WI(CNN5B) and CS was closely linked with cfd48 marker. 4. Materials and methods 4.1. Plant materials Twenty common wheat intracultivaral substitution lines between recipient cultivar Wichita (WI) and donor cultivar Cheyenne (CNN), and the two parents were kindly provided by Duane Wilson at Department in Plant Pathology at Kansas State University. The wheat line Chinese Spring (CS) used as control was obtained from the National Crop Germplasm Bank at the Institute of Crop Science (ICS), Chinese Academy of Agricultural Sciences (CAAS) Agronomic traits investigation The 20 substitution lines, recipient cultivar WI and donor cultivar CNN were planted at the experimental station of ICS-CAAS in autumn. Seedling date, heading date and maturity date of all wheat lines were collected during growth period. Ten plants were selected randomly from each line at maturity for measuring other phenotypic data including plant height, spike length, spikes per plant and 1000 kernel weight. Average value of each agronomic trait was calculated Proteinin extraction and analysis Wheat glutenins were extracted from the 23 plant lines with extraction buffer that consists of 50% C 3 H 8 O [isopropanol] with 80 mmol L -1 Tris-HCl, ph 8.0), 1% dithiothreitol (DTT) and 1.4% 4-vinylpyridine (v/v)

6 according to the procedure outlined in Yan et al. (2003). Proteins were separated using sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) procedure on Bio-Rad PROTEAN II XL equipment based on a previously described method (Yan et al. 2003) with 12% gel and electrophoresed at 15 ma per gel for 30 min and then 20 ma per gel for 2 h. Matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS) identification was performed following the protocol described by Gao et al. (2009) with some modifications. MALDI mass spectra were obtained by using AXIMA-CFRTM Plus MS apparatus MALDI-TOF mass spectrometer (SM, Shimadzu Biotech Corporation, Kyoto, Japan). Sinapinic acid (SA, a-cyano-4-hydroxycinnamic acid) was employed for protein analysis. Calibration was carried out using with standard sample Albumin-Aldrase at masses of and Da Genomic DNA extraction and molecular markers Genomic DNA was extracted from young seedlings using the modified cetyltrimethyl ammonium bromide (CTAB) method (Bassam et al. 1991). Twenty-one simple sequence repeat (SSR) markers on chromosomes 5B and 1B were used to identify the differences between the lines (Table 3) (Somers et al. 2004). Polymerase chain reaction (PCR) amplifications were performed in a reaction volume of 20 μl containing 1 U long and accurate (LA) Taq polymerase (TaKaRa), 50 ng of genomic DNA, 2 μl 10 LA buffer I (MgCl 2 + plus), 0.2 mmol L -1 deoxyribonucleotide triphosphate, and 0.2 μmol L -1 of each primer. The reaction was performed in a PTC-100 (MJ Research) according to the following protocol: initial denaturation at 94 C for 4 min, cycled 35 times of 94 C for 30 s, 50 to 60 C for 30 s (the annealing temperatures were adjusted depending on the different primer pairs), and 72 C for 30 s, and a final extension at 72 C for 10 min. Acknowledgments This research was financially supported by grants in part from the National Natural Science Foundation of China ( and ). Authors are grateful to Dr. Li Jiarui at Bayer Cropscience, USA, for critical revision of this manuscript. References Bai Z Y, Li C D, Feng L X, Sun H C Chromosomal localization of genes associated with spikelet differentiation and drought tolerance in Chinese Spring (recipient)/synthetic 6x (donor). Scientia Agricultura Sinica, 40, (in Chinese) Bai Z Y, Li C D, Zhao J F, Wu T Y, Zheng J F, Bi C R The effect and preliminary analysis of chromosomal control on the chlorophyll fluorescence parameters of wheat substitution lines between synthetic hexaploid wheat and Chinese Spring under drought stress. Scientia Agricultura Sinica, 44, (in Chinese) Bassam B J, Caetano-Anolles G, Gresshoff P M Fast and sensitive silver staining of DNA in polyacrylamide gel. Analytical Biochemistry, 196, Bazenziger P S, Dweikat I, Gill K, Eskridge K, Berke K, Shah T, Campbell B D, Ali M L, Mengistu N, Mahmood A, Auvuchanon A, Yen Y, Rustgi S, Moreno-Sevilia B, Mujeeb-Kazi A, Morris M R Understanding grain yield: it is a journey, not a destination. Czech Journal of Genetics Plant Breeding, 47 (Special issue), S77-S84. Berke T G, Baenziger P S, Morris R. 1992a. Location of wheat quantitative trait loci affecting agronomic

7 performance of seven traits using reciprocal chromosome substitutions. Crop Science, 32, Berke T G, Baenziger P S, Morris R. 1992b. Locations of wheat quantitative trait loci affecting stability of six traits using reciprocal chromosome substitutions. Crop Science, 32, Campbell B T, Baenziger P S, Gill K S, Eskridge K M, Budak H, Erayman M, Dweikat I, Yen Y Identification of QTLs and environmental interactions associated with agronomic traits on chromosome 3A of wheat. Crop Science, 43, Chen F, Beecher B S, Morris C F Physical mapping and a new variant of Puroindoline b-2 genes in wheat. Theoretic Applied Genetics, 120, Dilbirligi M, Erayman M, Campbell B T, Randhawa H S, Baenziger P S, Dweikat I, Gill K S High-density mapping and comparative analysis of agronomically important traits on wheat chromosome 3A. Genomics, 88, Farshadfar E, Köszegi B, Tischner T, Sutka J Substitution analysis of drought tolerance in wheat (Triticum aestivum L.). Plant Breeding, 114, Galiba G, Koscy G, Kaur-Sawhney R, Sutka J, Galston A W Chromosomal localization of osmotic and salt stress-induced differential alterations in polyamine content in wheat. Plant Science, 92, Gao L, Wang A, Li X, Dong K, Wang K, Appels R, Ma W, Yan Y Wheat quality related differential expressions of albumins and globulins revealed by two-dimensional difference gel electrophoresis (2-D DIGE). Journal of Proteomics, 3, Kuspria J, Unrau J Genetic analyses of certain characters in common wheat using whole chromosome substitution lines. Canadian Journal of Plant Science, 37, Kocsy G, Szalai G, Sutka J, Paldi E, Galiba G Heat tolerance together with heat stress-induced changes in glutathione and hydroxymethylglutathione levels is affected by chromosome 5A of wheat. Plant Science, 166, Law C N, Snape J W, Worland A J Aneuploidity in wheat and its uses in genetic analysis. In: Lupton F G H ed., Wheat Breeding, University Press, Cambridge. pp Mahmood A, Baenziger P S, Budak H, Gill K S, Dweikat I The use of microsatellite markers for the detection of genetic similarity among winter bread wheat lines for chromosome 3A. Theoretic Applied Genetics, 109, Payne P I Genetics of wheat storage proteins and the effect of allelic variation on bread-making quality. Annual Review of Plant Physiology, 38, Shah M M, Baenziger P S, Yen Y, Gill K S, Moreno-Sevilla B, Haliloglu K. 1999a. Genetic analysis of agronomic traits controlled by wheat chromosome 3A. Crop Science, 39, Shah M M, Gill K S, Baenziger P S, Yen Y, Kaeppler S M, Ariyarathne H M. 1999b. Molecular mapping of loci for agronomic traits on chromosome 3A of bread wheat. Crop Science, 39, Shewry P R Wheat. Journal of Experimental Botany, 60, Somers D J, Isaac P, Edwards K A high-density microsatellite consensus map for bread wheat (Triticum aestivum L). Theoretic Applied Genetics, 109, Wang K, Lin Z S, Wang S L, Du L P, Li J R, Xu H J, Yan Y M, Ye X G Development, identification, and genetic analysis of a quantitative dwarfing somatic variation line in wheat (Triticum aestivum L.). Crop Science,

8 53, Yan Y, Hsam S L K, Yu S L K, Jiang Y, Ohtsuka I, Zeller F J HMW and LMW gluten in alleles among putative tetraploid and hexaploid T. spelta progenitors. Theoretic Applied Genetics, 107, Yang K, Chang X P, Hu R H, Jia J Z Chromosomal locations of genes association with proline accumulation under drought stress in wheat. Acta Agronomica Sinica, 27, Yen Y, Baenziger P S A better way to construct recombinant chromosome lines and their controls. Genome, 35, Yen Y, Baenziger P S Wheat chromosome 2D carries genes controlling the activity of two DNA-degrading enzymes. Theoretic Applied Genetics, 88, Zemetra R S, Morris R, Schmidt J W Gene locations for heading date using reciprocal chromosome substitutions in winter wheat. Crop Science, 26, Zemetra R S, Morris R Effects of an intercultivaral chromosome substitution on winterhadriness and vernalization in wheat. Genetics, 119, Zheng J F, Mi S Y, Jing J J, Bai Z Y, Li C D Principal component analysis and comprehensive evaluation on physiological traits of tolerance to low phosphorus stress in wheat substitution. Scientia Agricultura Sinica, 46, (in Chinese) Fig. 1 HMW-GS compositions in the intercultivaral substitution lines analyzed by SDS-PAGE. All the substitution lines (2, WI(CNN1A); 3, WI(CNN2A); 4, WI(CNN3A); 5, WI(CNN4A); 6, WI(CNN5A); 7, WI(CNN6A); 8, WI(CNN7A); 12, WI(CNN1B); 13, WI(CNN3B); 14, WI(CNN4B); 16, WI(CNN6B); 17, WI(CNN7B); 21, WI(CNN1D); 22, WI(CNN2D); 23, WI(CNN3D); 24, WI(CNN4D); 25, WI(CNN5D); 26, WI(CNN6D); 27, WI(CNN7D)) showed the same HMW-GS constitutions (1Ax2*, 1Bx7+1By9, 1Dx5+1Dy10) as their recipient parent WI (9, 18, 28) except substitution line WI(CNN5B) (15) with a different composition (1Ax2*, 1Bx7+1By8, 1Dx5+1Dy10). While, the HMW-GS constitutions were (1Bx7+1By8, 1Dx2+1Dy12) for CS (1, 11, 20), and

9 (1Bx7+1By9, 1Dx2+1Dy12) for the donor parent CNN (10, 19, 29) Dx2 1Bx7 1By8 1Dy12 1Ax2* 1Dx5 1Bx7 1By9 1Dy10 Fig. 2 Glutenin pattern in the substitution line WI(CNN5B) analyzed by SDS-PAGE. Samples 1 to 4 were standard cultivar CS (1), substitution line WI(CNN5B), donor parent CNN, and recipient parent WI, respectively. At Glu-B1 locus, WI and CNN had a HMW-GS constitution of 1Bx7+1By9, while WI(CNN5B) and CS had 1Bx7+1By8. For the low molecular weight storage proteins, WI(CNN5B) showed a similar pattern to its recipient cultivar of WI a b c Fig. 3 Molecular weight determination of HMW-GS by MALDI-TOF-MS. Molecular weights of the HMW-GS in donor parent CNN (A) were for , , , and Da, which were correspondent to 1Bx7, 1By9, 1Dx2, and 1Dy12, respectively. Molecular weights of the HMW-GS in recipient parent WI (B) were , , , , and Da, which were correspondent to 1Ax*, 1Bx7, 1By9, 1Dx5, and 1Dy10, respectively. Molecular weights of the HMW-GS in substitution line WI(CNN5B) (C) were , , , , and Da, which were correspondent to 1Ax*,

10 1Bx7, 1By8, 1Dx5, and 1Dy10, respectively Fig. 4 Molecular identification of WI(CNN5B) by SSR markers. Lane 1 was marker. Lanes 2 to 7 meant that WI(CNN5A), WI(CNN5B), WI(CNN5D), WI, CNN, and CS were detected by Barc188, respectively. Lanes 8 to 13 meant that WI(CNN5A), WI(CNN5B), WI(CNN5D), WI, CNN, and CS were detected by WMC766, respectively. Lanes 14 to 19 meant that WI(CNN5A), WI(CNN5B), WI(CNN5D), WI, CNN, and CS were detected by Barc81, respectively. Lanes 20 to 25 meant that WI(CNN5A), WI(CNN5B), WI(CNN5D), WI, CNN, and CS were detected by cfd48, respectively. Lanes 26 to 31 meant that WI(CNN5A), WI(CNN5B), WI(CNN5D), WI, CNN, and CS were detected by Xgwm374, By using cfd48, WI(CNN5B) and CS showed identical bands pattern, which were different from other four materials. Table 1 Several main agronomic traits of the substitution lines and their two parents Substitution line Spikes per Growth 1000 kernel Plant Spike plant period weight height (cm) length (cm) (day) (gram) Wichita (WI) Cheyenne (CNN) WI(CNN1A) WI(CNN 1B) WI(CNN 1D) WI(CNN 2A) WI(CNN 2D) WI(CNN 3A) WI(CNN 3B) WI(CNN 3D) WI(CNN 4A) WI(CNN 4B) WI(CNN 4D) WI(CNN 5A) WI(CNN 5B) WI(CNN 5D) WI(CNN 6A) WI(CNN 6B)

11 WI(CNN 6D) WI(CNN 7A) WI(CNN 7B) WI(CNN 7D) Table 2 The deduced molecular mass and the results of MALDI-TOF-MS Materials 1Ax2* 1Bx7 1By8 1By9 1Dx2 1Dx5 1Dy10 1Dy12 Deduced molecular mass WI CNN WI(CNN5B) Table 3 Microsatellite markers used in this study for the detection of the targeted chromosomes Marker Primer forward Primer reverse Chromosome Products (bp) Anneal temperature WMC798 GTGTGGTAGTGTAGCTGCCAAAAG GTTAGCATGGCACATAGAAGCAG 1BS WMC619 TTCCCTTTCCCCTCTTTCCG TACAATCGCCACGAGCACCT 1BS WMC128 CGGACAGCTACTGCTCTCCTTA CTGTTGCTTGCTCTGCACCCTT 1BS WMC626 AGCCCATAAACATCCAACACGG AGGTGGGCTTGGTTACGCTCTC 1BL WMC694 ATTTGCCCTTGTGAGCCGTT GACCTGGGTGGGACCCATTA 1BL WMC416 AGCCCTTTCTACCGTGTTTCTT TATGGTCGATGGACTGTCCCTA 1BL WMC134 CCAAGCTGTCTGACTGCCATAG AGTATAGACCTCTGGCTCACGG 1BL Xgwm153 GATCTCGTCACCCGGAATTC TGGTAGAGAAGGACGGAGAG 1BL Xgwm268 AGGGGATATGTTGTCACTCCA TTATGTGATTGCGTACGTACCC 1BL NA 55 WMC156 GCCTCTAGGGAGAAAACTAACA TCAAGATCATATCCTCCCCAAC 1BL Xgwm374 ATAGTGTGTTGCATGCTGTGTG TCTAATTAGCGTTGGCTGCC 1BL NA 60 cfd48 ATGGTTGATGGTGGGTGTTT ATGTATCGATGAAGGGCCAA 1BL Barc81 GCGCTAGTGACCAAGTTGTTATATGA GCGGTTCGGAAAGTGCTATTCTACAGTAA 1BL NA 52 WMC766 AGATGGAGGGGATATGTTGTCAC TCGTCCCTGCTCATGCTG 1BL Barc188 CGTGAGATCATGTTATCAGGACAAG GCGTTGAAAGGTGTTAGTGGGATGG 1BL NA 58 WMC682 GAGCGTGCGAAAAAACTGAAT TTCTATCGCACGCATCCAAA 5BS WMC740 CTTGGTTGCAGACGGGG GCTGGGTGCAATGCAGATAG 5BS Xgwm443 GGGTCTTCATCCGGAACTCT CCATGATTTATAAATTCCACC 5BS Xgwm408 TCGATTTATTTGGGCCACTG GTATAATTCGTTCACAGCACGC 5BL WMC745 AAACAGAGGAGGGGGAGAGC TAGACGATGCCAGCACGATG 5BL WMC235 ACTGTTCCTATCCGTGCACTGG GAGGCAAAGTTCTGGAGGTCTG 5BL