Supporting Information
|
|
- Judith Watts
- 5 years ago
- Views:
Transcription
1 Supporting Information Song et al /pnas SI Materials and Methods In Vivo Dislodgment Assays. In vivo dislodgement experiments were performed as previously described (1) using function blocking antibodies to integrins β1 (Ha 2/5 or 9EG7), β3 (2C9.G2), α6 (GoH3), α4 (PS/2), anti leukocyte function associated antigen (LFA)-1 (M17/4), or laminin α5 (2). Six hours after i.v. injection of μg specific antibodies (either alone or in various combinations) or isotype control Igs, whole blood was collected and spleens were harvested. As LFA-1/intracellular adhesion molecule (ICAM)-1 have been shown to act synergistically with α4β1/vascular cell adhesion molecule (VCAM)-1 to mediate binding of marginal zone (MZ) B cells to the MZ (1), integrin β2-null mice (provided by K. Scharfetter-Kochanek, Department of Dermatology and Allergic Diseases, Ulm University, Ulm, Germany) (3) were also used to eliminate LFA-1/ICAM-1 effects. When injected alone or in combination, antibodies to integrins β1 (Ha 2/5, 9EG7), β3 (2C9.G2), α6 (GoH3), and α4 (PS/2) had little or no effect in WT mice (Table S1). Only anti-integrin α4 plus anti LFA-1 (M17/4), or anti-integrin α4 injected into the integrin β2-null mice resulted in a displacement of MZ B cells from the MZ to the circulation (Table S1). Flow Cytometry for Transitional B-Cell Populations. Bone marrow and spleens of the conditional lama5 / and Itga6 / bone marrow chimeric mice were analyzed by flow cytometry: isolated bone marrow cells were stained with a mixture of anti-cd19, anti-aa4.1, and anti-igm, the CD19 + cells were gated, and proportions of pro- and pre-b cells (AA4.1 + IgM ), immature B cells (AA4.1 + IgM + ), and recirculating B cells (AA4.1 IgM ) were measured. Isolated splenic cells were stained with anti- CD19, anti-aa4.1, and anti-cd23, the CD19 + AA4.1 + immature B cells were gated, and proportions of newly formed T1 transistional B cells (CD23 ) and T2+T3 (CD23 + ) transistional B cells were measured. Measurement of Reticular Fiber Diameters. Spleens were frozen in TissueTek (Miles Laboratories) in isopentane at 70 C. Fivemicrometer cryostat sections were fixed for 10 min in 20 C methanol. Immunofluorescence staining was carried out as described previously (2) using the anti-laminin a5 antibody (504). Sections were examined using a Zeiss AxioImager microscope equipped with epifluorescent optics and documented using a Hamamatsu ORCA ER camera or with a Zeiss confocal laser scanning system LSM 700. Volocity software was used to trace and quantify (fluorescence intensity) laminin α5 staining for reticular fiber diameter measurements. Spleens from at least 10 animals were examined; 5 10 sections per animal and two to five areas per section were examined. Statistical Analyses. The data were analyzed by a paired sign t test or Student t test. All P values of 0.05 or less were considered statistically significant. 1. Lu TT, Cyster JG (2002) Integrin-mediated long-term B cell retention in the splenic marginal zone. Science 297(5580): Sorokin LM, et al. (1997) Developmental regulation of the laminin alpha5 chain suggests a role in epithelial and endothelial cell maturation. Dev Biol 189(2): Scharffetter-Kochanek K, et al. (1998) Spontaneous skin ulceration and defective T cell function in CD18 null mice. J Exp Med 188(1): of14
2 Fig. S1. Biochemical and morphological characterization of the reticular fibers of the splenic MZ, red pulp (RP), and B-cell area of the white pulp (WP). (A) Comparison of the immunofluorescent staining patterns for the basement membrane proteins, collagen type IV, perlecan, and laminin α5. Magnification: 100. (B) Immunofluorescent staining for laminin α5 shows differences in the reticular fiber diameters in the WP, MZ, and RP. Magnification: 200. Boxed areas are shown at a higher magnification to the right. Magnification: 400. (C) Image analysis of laminin α5 immunofluorescent staining intensity across the line shown permitted measurement of reticular fiber diameters. (D) Quantification of fiber diameters in the WP, MZ, and RP. Data shown are mean values ± SEM from at least 10 animals; 5 10 sections per animal and two to five areas per section were examined. 2 of 14
3 Fig. S2. Immunofluorescence staining of adult spleen sections from C57BL/6, CD19 /, and agrin / mice for laminin α5, IgM, and IgD showing reduced laminin α5 localization in the MZ of CD19 / only and associated reduction in the IgM high /IgD low MZ B-cell population. Staining of serial sections shows no differences in agrin expression in the CD19 / mice compared with C57BL/6 controls; VCAM-1 and ICAM-1 distribution does not differ between the three strains. WP, white pulp. Magnification: 150, except agrin, of14
4 Fig. S3. Laminin α5 conditional KO mouse: (A) Targeting strategy for generation of floxed laminin α5 gene, showing insertion of loxp sites flanking the exons encoding domains VI, V, and IV of laminin α5; exons appear as green boxes. (B) Southern blot analyses of transfected ES cell clones. (C) Immunofluorescence analysis of laminin α5 conditional KO mice generated by crossing laminin α5 floxed mouse with Tie-2-cre mice. Skin sections from the ears of a KO and a WT littermate were doubled stained with anti-laminin α5 chain (green) and anti-platelet endothelial cell adhesion molecule (PECAM) antibodies (red) showing specific deletion of laminin α5 from the endothelial basement membranes, i.e., there is no colocalization of laminin α5 and PECAM staining in the KO animals. Laminin α5, however, remains in basement membranes of the epidermis and the smooth muscle layer of larger blood vessels of KO mice. Magnification: 75 (top panels); 100 (bottom panels). 4of14
5 Fig. S4. Double immunofluorescent staining for laminin α5 and VE-cadherin (A) or laminin α5 and PDGF-receptor-β (PDGFrecβ) (B), showing the expression of the endothelial cell marker, VE-cadherin, in the marginal zone stromal cells and in the sinus lining vessels and the expression of perivascular cell marker, PDGFrecβ, at the marginal sinus and in the RP. (C) Double immunofluorescent staining for another endothelial cells marker, mouse endothelial cell antigen (MECA)-32, and mucosal addressin cell adhesion molecule (MAdCAM) as a marker of the sinus lining cells, shows MECA32 on sinus lining vessels and RP vessels, but also on MZ stromal cells. Boxed areas are shown at high magnification to the right. Magnification: 100 (A C); 400 (boxed areas). 5of14
6 Fig. S5. Immunofluorescence and quantification of flow cytometry analyses of spleens of conditional Lama5 / mice and WT littermates. (A) Immunofluorescence staining of adult spleen sections from conditional Lama5 / mice and WT littermates; WP, white pulp. Magnification: 150. Stainings for ICAM-1 and VCAM-1 were performed on spleen sections from mice injected with anti-integrin α4 plus anti leukocyte function associated antigen(lfa)-1 to displace MZ B cells. (B) Quantification of flow cytometry data shows no difference in numbers of total B220+ B cells, MOMA-1+ sinus lining macrophages, and ERTR9+ MZ macrophages; data shown are means ± SEM from three experiments with n = 5 in each experiment. (C) Representative flow cytometry for CD19+ B cells and CD21highCD23low MZ B cells in the blood of Lama5 / mice and WT littermates showing no differences. 6 of 14
7 Fig. S6. Representative flow cytometry of immature B cells in the bone marrow (BM) (A) and transitional B-cell populations (T1, T2, T3) in the spleen (B) of adult conditional Lama5 / mice and WT littermates. Quantification of T1, T2, and T3 populations are shown in the bar graphs. Data shown are mean values ± SEM from at least three separate experiments with n = 6 for each treatment in each experiment. **P < 0.01; ***P < of14
8 Fig. S7. (A) Representative flow cytometry of cell surface integrin expression on MZ B cells (black) and follicular (FO) B cells (red), with antibody isotype controls shown in green and yellow, respectively. (B) In vitro adhesion of MZ and FO B cells to VCAM-1, laminin 511/521, or laminin α5 domain IVa (all 30 μm) in the presence or absence of function blocking antibodies to integrins α4 (PS/2), α6 (GoH3), β1 (Ha2/5), β3 (2C9.G2), or cyclic-rgd or RGE (control pep) peptides. Hamster IgG is an isotype control for anti-integrin β1 and β3 antibodies; rat IgG is an isotype control for anti-integrin α4 and α6 antibodies; 100% is binding in the presence of isotype control antibody. Adhesion data shown are mean values ± SEM from at least three separate experiments with n = 6 for each treatment in each experiment. *P < 0.05; **P < of14
9 Fig. S8. (A) Quantification of flow cytometry analysis of host (CD ) and donor (CD ) NF B cells (CD19 + CD21 low CD23 low ) and FO B cells (CD19 + CD23 high / CD21 low ) in the spleens of WT and Lama5 / mice at 16 h after i.v. transfer of donor cells. Transfers were performed in the presence or absence of integrin α6 blocking antibody (GoH3). Data shown are mean values ± SEM from at three separate experiments with n = 3 for each treatment in each experiment. ***P < (B) 5 /6 -carboxytetramethylrhodamine (TAMRA)-labeled NF B cells were injected i.v. into WT or Lama5 / recipients and spleens were analyzed at 16 h after injection. Immunofluorescent staining for laminin α5 reveals that in WT mice, TAMRA + NF B cells localize in the MZ (double arrows) but also in the follicle and in the RP, whereas in the Lama5 / mice TAMRA + NF B cells home predominantly to the follicle. Magnification: 100. Bar graph shows quantification of the ratio of MZ/ FO localized TAMRA + cells. Data are means ± SEM from two experiments with four mice in each category. **P < of14
10 Fig. S9. Representative flow cytometry of immature B cells in the bone marrow (BM) (A) and transitional B-cell populations (T1, T2, T3) in the spleen (B) of adult conditional Itga6 / mice and WT littermates. Quantification of T1, T2, and T3 populations are shown in the bar graphs. Data shown are mean values ± SEM from at least three separate experiments with n = 6 for each treatment in each experiment. **P < of 14
11 Fig. S10. Competitive bone marrow reconstitution studies were performed with a 1:1 ratio of CD WT: CD Itga6 / bone marrow cells injected i.v. into WT irradiated mice and subsequent analysis of CD (WT) or CD45.1 (Itga6 / ) cells in pro-pre (B220 + IgM AA4.1 + ), immature (B220 + IgM + AA4.1 + ), and recirculating (B220 + IgM + AA4.1 ) B-cell compartments (A) and CD11b + myeloid cells (B), showing a comparable development of WT and Itga6 / B cells and myeloid cells. Data shown are one representative example. 11 of 14
12 Fig. S11. (A) Qualitative RT-PCR (qrt-pcr) for antiapoptotic (Bcl-XL, Bcl-2) and proapoptoic (Bim) genes in NF, MZ, and FO B cells in the spleens of Lama5 / mice. Data shown are fold differences from WT mice, n = 3 experiments, with triplicates in each. (B) qrt-pcr for Deltex-1 (Dtx-1) in NF, MZ, and FO B cells sorted from the spleens of Lama5 / mice, showing up-regulation in NF B cells. Data shown are fold differences from WT mice, n = 3 experiments. (C) Forward scatter (FSC) of sorted NF, MZ, and FO B cells from the spleens of Lama5 / mice reveals a population of small Deltex-1 negative NF B cells and larger cells of similar to mature MZ B cells that are Deltex-1 positive. Bar graph shows fold differences compared with FO B cells, n = 3 experiments, with triplicates in each. *P < 0.05; **P < of 14
13 Fig. S12. NF and MZ B cells before and after 48-h culture in the presence of medium, laminin 511 (LM 511), LM 511 plus B cell activating factor (BAFF), and BAFF alone. (Left) Flow cytometry shows the CD21/ CD1d profile of the cells before culture. (Right) Flow cytometry shows the proportions of surviving 7AAD neg cells after 48-h culture. Data shown are one representative experiment of three independent experiments performed. Fig. S13. Representative flow cytometry of sorted CD19 + CD21 low CD23 low NF B cells after 48-h culture in the presence of BAFF, laminin 511, agrin, or different combinations thereof, in the presence or absence of GoH3. Bar graphs show quantitative data from all experiments performed; n = 3 experiments, with triplicates in each; *P < 0.05, **P < 0.01, ***P < of 14
14 Table S1. Mouse strain injected Summary of in vivo MZ B-cell dislodgement experiments Antigen specificity of injected antibody/antibodies Displacement of MZ B cells from spleen* Displacement of MZ B cells to circulation WT LFA-1 No No Integrin α4 No No LFA-1 and α4β1 Yes Yes Integrin β1 No No Integrin β3 No No Integrins β1 and β3 No No Integrin β1/β3/lfa-1 No No Integrins α6 and α4 No No Integrins α6 and β3 No No Integrins α6, β3, and LFA-1 No No Laminin α5 No No Laminin α5 and LFA-1 No No Laminin α5 and integrin α4 No No Integrin β2 / α4β1 Yes Yes Integrin β1 No No Integrin β3 No No Integrins β1 and β3 No No Integrin α6 No No Integrins α6, β1, and β3 No No *Normal % MZ B cells in spleen is 5 6%. MZ B cells are normally not found in the circulation. All experiments involved at least six mice per treatment per experiment, and each experiment was repeated at least three times. 14 of 14
Supplementary Figure S1
Supplementary Figure S1 Supplementary Figure S1. CD11b expression on different B cell subsets in anti-snrnp Ig Tg mice. (a) Highly purified follicular (FO) and marginal zone (MZ) B cells were sorted from
More informationNature Immunology: doi: /ni.3101
Supplementary Figure 1 Generation of Plvap / mice. (a) Schematic presentation of the targeting construct as well as the wild-type and targeted Plvap alleles]. PuroR, puromycin resistance. The location
More informationNature Immunology: doi: /ni.3694
Supplementary Figure 1 Expression of Bhlhe41 and Bhlhe40 in B cell development and mature B cell subsets. (a) Scatter plot showing differential expression of genes between splenic B-1a cells and follicular
More informationSupplementary Figure 1: Analysis of monocyte subsets and lineage relationships. (a) Gating strategy for definition of MDP and cmop populations in BM
Supplementary Figure 1: Analysis of monocyte subsets and lineage relationships. (a) Gating strategy for definition of MDP and cmop populations in BM of Cx3cr1 GFP/+ mice related to Fig. 1a. MDP was defined
More informationRevised: RG-RV2 by Fukuhara et al.
Supplemental Figure 1 The generation of Spns2 conditional knockout mice. (A) Schematic representation of the wild type Spns2 locus (Spns2 + ), the targeted allele, the floxed allele (Spns2 f ) and the
More informationTitle: Stromal Cell Subsets Directing Neonatal Spleen Regeneration
Title: Stromal Cell Subsets Directing Neonatal Spleen Regeneration Authors: Jonathan K.H. Tan and Takeshi Watanabe SUPPLEMENTAL INFORMATION Supplemental Tables 1-4 Supplemental Figure 1 Table S1. Marker
More information(A-B) P2ry14 expression was assessed by (A) genotyping (upper arrow: WT; lower
Supplementary Figures S1. (A-B) P2ry14 expression was assessed by (A) genotyping (upper arrow: ; lower arrow: KO) and (B) q-pcr analysis with Lin- cells, The white vertical line in panel A indicates that
More informationSupplementary Table-1: List of genes that were identically matched between the ST2 and
Supplementary data Supplementary Table-1: List of genes that were identically matched between the ST2 and ST3. Supplementary Table-2: List of genes that were differentially expressed in GD2 + cells compared
More informationSupplemental figure 1: Phenotype of IMC and MDSC after purification. A. Gating
Supplemental Figure Legend: Supplemental figure 1: Phenotype of IMC and MDSC after purification. A. Gating strategy for mouse MDSC. CD11b + Ly6C high Ly6G - cells are defined as M-MDSC. CD11b + Ly6C low
More informationReceptor Revision Diminishes the Autoreactive B Cell Response after Antigen. PNA Tet. Day 8. Day 16
Receptor Revision Diminishes the Autoreactive Cell Response after Antigen Activation Ying-Hua Wang and etty Diamond Supplemental data: PNA Tet 5 8 11 16 Supplemental Figure 1: Kinetic analysis of tetramer-binding
More informationMultiple layers of B cell memory with different effector functions. Ismail Dogan, Barbara Bertocci, Valérie Vilmont, Frédéric Delbos,
Multiple layers of B cell memory with different effector functions Ismail Dogan, Barbara Bertocci, Valérie Vilmont, Frédéric Delbos, Jérome Mégret, Sébastien Storck, Claude-Agnès Reynaud & Jean-Claude
More informationSupplemental Figure 1
Supplemental Figure 1 Supplemental figure 1. Generation of gene targeted mice expressing an anti-id BCR. (A,B) Generation of the VDJ aid H KI mouse. (A) Targeting Construct. Top: Targeting construct for
More informationSupplementary Methods
Supplementary Methods Reverse transcribed Quantitative PCR. Total RNA was isolated from bone marrow derived macrophages using RNeasy Mini Kit (Qiagen), DNase-treated (Promega RQ1), and reverse transcribed
More informationbronchial epithelial cells (I). Bronchi are outlined with dashed line. Scale bars = 25 µm, if not
Supplemental Figure S1: ronchial epithelial cell polarity and integrity is maintained in bronchi. (A-E) Staining for selected markers of bronchial cell differentiation and intracellular compartments is
More informationNature Immunology: doi: /ni Supplementary Figure 1
Supplementary Figure 1 BALB/c LYVE1-deficient mice exhibited reduced lymphatic trafficking of all DC subsets after oxazolone-induced sensitization. (a) Schematic overview of the mouse skin oxazolone contact
More informationSupplementary Figure 1. Xbp1 deficiency does not alter hematopoietic cellularity.
Supplementary Figure 1 Xbp1 deficiency does not alter hematopoietic cellularity. Absolute number of leukocytes obtained from bone marrow (BM, 2 tibias and 2 femurs per mouse) of Xbp1 f/f and Xbp1 Vav1
More informationNature Biotechnology: doi: /nbt.4086
Ag (-) anti-cd3 p815 p815-hcd2 Ag (-) anti-cd3 p815 p815-hcd2 Ag (-) anti-cd3 p815 p815-hcd2 Ag (-) anti-cd3 p815 p815-hcd2 Ag (-) anti-cd3 p815 p815-hcd2 Ag (-) anti-cd3 p815 p815-hcd2 Ag (-) anti-cd3
More informationKazuki N. Sugahara, Tambet Teesalu, Priya Prakash Karmali, Venkata Ramana Kotamraju, Lilach
Cancer Cell, Volume 16 Supplemental Data Tissue-Penetrating Delivery of Compounds and Nanoparticles into Tumors Kazuki N. Sugahara, Tambet Teesalu, Priya Prakash Karmali, Venkata Ramana Kotamraju, Lilach
More information1 Name. 1. (3 pts) What is apoptosis and how does it differ from necrosis? Which is more likely to trigger inflammation?
1 Name MCB 150 Midterm Eam #1 (100 points total) Please write your full name on each page of the eam!! The eam consists of 17 questions (6 pages). Each has a different point count as indicated. Please
More informationPei et al. Supplementary Figure S1
Pei et al. Supplementary Figure S1 C H-CUL9: + + + + + Myc-ROC1: - - + + + U2OS/pcDN3 U2OS/H-CUL9 U2OS/ + H-CUL9 IP: -H -myc input -H -myc 1 2 3 4 5 H-CUL9 Myc-ROC1 -H -H -H -H H-CUL9: wt RR myc-roc1:
More informationNature Medicine: doi: /nm.4169
Supplementary Fig.1. EC-specific deletion of Ccm3 by Cdh5-CreERT2. a. mt/mg reporter mice were bred with Cdh5CreERT2 deleter mice followed by tamoxifen feeding from P1 to P3. mg expression was specifically
More informationAspergillus fumigatus CalA binds to integrin α 5 β 1 and mediates host cell invasion
In the format provided by the authors and unedited. SUPPLEMENTARY INFORMATION ARTICLE NUMBER: 16211 DOI: 10.1038/NMICROBIOL.2016.211 Aspergillus fumigatus CalA binds to integrin α 5 β 1 and mediates host
More informationInterferon- -producing immature myeloid cells confer protection. against severe invasive group A Streptococcus infections. Supplementary Information
Supplementary Information Interferon- -producing immature myeloid cells confer protection against severe invasive group A Streptococcus infections Takayuki Matsumura, Manabu Ato, Tadayoshi Ikebe, Makoto
More informationSupplementary Figure 1 Generation of migg1-yf mice. (A) Targeting strategy. Upper panel: schematic organization of the murine ɣ1 immunoglobulin
Supplementary Figure 1 Generation of migg1-yf mice. (A) Targeting strategy. Upper panel: schematic organization of the murine ɣ1 immunoglobulin locus. The EcoRI restriction site between exons M1 and M2
More informationCancer cells that survive radiation therapy acquire HIF-1 activity and translocate toward tumor blood vessels Supplementary Information
Cancer cells that survive radiation therapy acquire HIF-1 activity and translocate toward tumor blood vessels Supplementary Information 1. Supplementary Figure S1-S10: Pages 2-11 2. Supplementary References:
More informationFlow cytometry Stained cells were analyzed and sorted by SORP FACS Aria (BD Biosciences).
Mice C57BL/6-Ly5.1 or -Ly5.2 congenic mice were used for LSK transduction and competitive repopulation assays. Animal care was in accordance with the guidelines of Keio University for animal and recombinant
More informationSupplemental Materials. Matrix Proteases Contribute to Progression of Pelvic Organ Prolapse in Mice and Humans
Supplemental Materials Matrix Proteases Contribute to Progression of Pelvic Organ Prolapse in Mice and Humans Madhusudhan Budatha, Shayzreen Roshanravan, Qian Zheng, Cecilia Weislander, Shelby L. Chapman,
More informationSupplementary Figure 1. Characterization of the POP2 transcriptional and post-transcriptional regulatory elements. (A) POP2 nucleotide sequence
1 5 6 7 8 9 10 11 1 1 1 Supplementary Figure 1. Characterization of the POP transcriptional and post-transcriptional regulatory elements. (A) POP nucleotide sequence depicting the consensus sequence for
More informationSupplementary Figure 1. Effect of FRC-specific ablation of Myd88 on PP and mln organization.
Supplementary Figure 1 Effect of FRC-specific ablation of Myd88 on PP and mln organization. (a) PP numbers in 8 10 week old Cre-negative littermate (Ctrl) and Myd88-cKO mice (n = 11 mice; each dot represents
More informationTitle. CitationThe Journal of clinical investigation, 124(5): Issue Date Doc URL. Type. Additional There Information
Title Laminins affect T cell trafficking and allograft fat Author(s)Warren, Kristi J.; Iwami, Daiki; Harris, Donald G.; CitationThe Journal of clinical investigation, 124(): 224- Issue Date 214--1 Doc
More informationSOM 1 *** *** *** * * n.s GFP + (NK 10 4 ) Naive DNFB OXA. Donor sensitization: Naive OXA DNFB 1,200 6,000 4,000
SOM 1 a n.s. 4. 3. GFP + (NK 1 4 ) 2. 1.. Naive DNFB OXA splenic NK hepatic NK b Donor sensitization: Naive OXA DNFB NK cells (% of CD45 + 1 5 ) 1,2 9 6 3 NK cells (% of CD45 + 1 5 ) 6, 4, 2, 24 48 72
More informationa Lamtor1 (gene) b Lamtor1 (mrna) c WT Lamtor1 Lamtor1 flox Lamtor2 A.U. p = LysM-Cre Lamtor3 Lamtor4 Lamtor5 BMDMs: Φ WT Φ KO β-actin WT BMDMs
a Lamtor (gene) b Lamtor (mrna) c BMDMs: Φ WT Φ KO Lamtor flox 8 bp LysM-Cre 93 bp..5 p =.4 WT BMDMs: Φ WT Φ KO Lamtor (protein) BMDMs: Φ WT Φ KO Lamtor 8 kda Lamtor 4 kda Lamtor3 4 kda Lamtor4 kda Lamtor5.5
More informationTable S1. List of antibodies used including isotype controls, biotinylated. secondaries, and fluorophore conjugated tertiary antibodies.
Table S1. List of antibodies used including isotype controls, biotinylated secondaries, and fluorophore conjugated tertiary antibodies. Antibody Description Distributor Catalogue number Working Concentration
More informationSUPPLEMENTARY INFORMATION
a before amputation regeneration regenerated limb DERMIS SKELETON MUSCLE SCHWANN CELLS EPIDERMIS DERMIS SKELETON MUSCLE SCHWANN CELLS EPIDERMIS developmental origin: lateral plate mesoderm presomitic mesoderm
More informationBeta3 integrin promotes long-lasting activation and polarization of Vascular Endothelial Growth Factor Receptor 2 by immobilized ligand
SUPPLEMENTAL FIGURES Beta3 integrin promotes long-lasting activation and polarization of Vascular Endothelial Growth Factor Receptor 2 by immobilized ligand C. Ravelli et al. FIGURE S. I Figure S. I: Gremlin
More informationSUPPLEMENTARY INFORMATION
VOLUME: 1 ARTICLE NUMBER: 0011 In the format provided by the authors and unedited. In situ Activation of Platelets with Checkpoint Inhibitors for Post-Surgical Cancer Immunotherapy Chao Wang 1, 2, Wujin
More informationSupplementary Figure 1. Generation of B2M -/- ESCs. Nature Biotechnology: doi: /nbt.3860
Supplementary Figure 1 Generation of B2M -/- ESCs. (a) Maps of the B2M alleles in cells with the indicated B2M genotypes. Probes and restriction enzymes used in Southern blots are indicated (H, Hind III;
More informationSupplementary Figure 1. Confirmation of sirna in PC3 and H1299 cells PC3 (a) and H1299 (b) cells were transfected with sirna oligonucleotides
Supplementary Figure 1. Confirmation of sirna in PC3 and H1299 cells PC3 (a) and H1299 (b) cells were transfected with sirna oligonucleotides targeting RCP (SMARTPool (RCP) or two individual oligos (RCP#1
More informationAdhesion molecules and cytokines
Adhesion molecules and cytokines Hycult Biotech is a leading world-class manufacturer of research reagents in the field of innate immunity. We are a specialized partner in the development and manufacturing
More information7-amino actinomycin D (7ADD) was added to all samples 10 minutes prior to analysis on the flow cytometer in order to gate 7AAD viable cells.
Antibody staining for Ho uptake analyses For HSC staining, 10 7 BM cells from Ho perfused mice were stained with biotinylated lineage antibodies (CD3, CD5, B220, CD11b, Gr-1, CD41, Ter119), anti Sca-1-PECY7,
More informationSupporting Information
Supporting Information Narni-Mancinelli et al. 10.1073/pnas.1112064108 SI Materials and Methods Cell Preparation. Mice were anesthetized and immediately perfused with PBS before organs were collected.
More informationWe designed the targeting vector in such a way that the first exon was flanked by two LoxP sites and
Mice We designed the targeting vector in such a way that the first exon was flanked by two LoxP sites and an Frt flanked neo cassette (Fig. S1A). Targeted BA1 (C57BL/6 129/SvEv) hybrid embryonic stem cells
More informationSUPPLEMENTAL MATERIAL. Supplemental Methods:
SUPPLEMENTAL MATERIAL Supplemental Methods: Immunoprecipitation- As we described but with some modifications [22]. As part of another ongoing project, lysate from human umbilical vein endothelial cells
More informationMa, et al. Supplemental Data
Ma, et al Supplemental Data Title: Calpain mediates pulmonary vascular remodeling in rodent models of pulmonary hypertension and its inhibition attenuates pathologic features of disease Authors: Wanli
More informationReal-time PCR. Total RNA was isolated from purified splenic or LP macrophages using
Supplementary Methods Real-time PCR. Total RNA was isolated from purified splenic or LP macrophages using the Qiagen RNeasy Mini Kit, according to the manufacturer s protocol with on-column DNase digestion
More informationFigure S1. Phenotypic characterization of transfected ECFC. (a) ECFC were transfected using a lentivirus with a vector encoding for either human EPO
Figure S1. Phenotypic characterization of transfected ECFC. (a) ECFC were transfected using a lentivirus with a vector encoding for either human EPO (epoecfc) or LacZ (laczecfc) under control of a cytomegalovirus
More informationAt E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in
Supplementary Materials and Methods Barrier function assays At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in acidic X-gal mix (100 mm phosphate buffer at ph4.3, 3 mm
More informationF4/80, CD11b, Gr-1, NK1.1, CD3, CD4, CD8 and CD19. A-antigen was detected with FITCconjugated
SDC MATERIALS AND METHODS Flow Cytometric Detection of A-Antigen Expression Single cell suspensions were prepared from bone marrow, lymph node and spleen. Peripheral blood was obtained and erythrocytes
More informationRegulation of Hematopoietic Stem Cells and their Bone Marrow Niches by the Coagulation System*.
Regulation of Hematopoietic Stem Cells and their Bone Marrow Niches by the Coagulation System*. * Via PAR-1 & CXCR4 upregulation, SDF-1 secretion and EPCR shedding. By Tsvee Lapidot, Ph.D. Weizmann Institute
More informationFigure S1. Schematic of myeloid lineage reporter mouse model used in this study.
Supplementary Figure Legends Figure S1. Schematic of myeloid lineage reporter mouse model used in this study. (A) The Lyzs-Cre mouse was crossed with Gt(ROSA)26Sor tm1(eyfp)cos/ J mice to label cells expressing
More informationSupplementary Figures and supplementary figure legends
Supplementary Figures and supplementary figure legends Figure S1. Effect of different percentage of FGF signaling knockdown on TGF signaling and EndMT marker gene expression. HUVECs were subjected to different
More informationBcl-2 family member Bcl-G is not a pro-apoptotic BH3-only protein
Bcl-2 family member Bcl-G is not a pro-apoptotic BH3-only protein Maybelline Giam 1,2, Toru Okamoto 1,2,3, Justine D. Mintern 1,2,4, Andreas Strasser 1,2 and Philippe Bouillet 1, 2 1 The Walter and Eliza
More informationSupplementary Materials for
advances.sciencemag.org/cgi/content/full/4/9/eaat5401/dc1 Supplementary Materials for GLK-IKKβ signaling induces dimerization and translocation of the AhR-RORγt complex in IL-17A induction and autoimmune
More informationQuantitative Imaging of Tumor Associated Macrophages and Their Response to Therapy Using 64Cu-Labeled Macrin
Supporting Information for Quantitative Imaging of Tumor Associated Macrophages and Their Response to Therapy Using 64Cu-Labeled Macrin Hye-Yeong Kim 1,2+, Ran Li 1+, Thomas S.C. Ng 1, Gabriel Courties
More informationGene Sequence Annealing Temperature. Actin 5 : 5 -CATCACTATTGGCAACGAGC-3 60 C 3 : 5 -ACGCAGCTCAGTAACAGTCC-3 PCR product: 410 bp
Supporting Materials and Methods RT-PCR RT-PCR was performed as described in ref. 1 using the following oligonucleotides and PCR conditions: 2 min at 95 C, (20 s at 95 C, 20 s at the annealing temp, and
More informationA Low salt diet. C Low salt diet + mf4-31c1 3. D High salt diet + mf4-31c1 3. B High salt diet
A Low salt diet GV [AU]:. [mmhg]: 0..... 09 9 7 B High salt diet GV [AU]:. [mmhg]: 7 8...0. 7.8 8.. 0 8 7 C Low salt diet + mf-c GV [AU]:. [mmhg]:.0.9 8.7.7. 7 8 0 D High salt diet + mf-c E Lymph capillary
More informationSupplementary Figure 1. Gating strategy for flow cytometry analysis of mouse aorta. Cell suspensions from mouse aorta digested with enzyme cocktail
Supplementary Figure 1. Gating strategy for flow cytometry analysis of mouse aorta. Cell suspensions from mouse aorta digested with enzyme cocktail were stained with propidium iodide (PI), anti-cd45 (FITC),
More informationFigure S1. Related to Figure 1, to show 3-D images of nerve/vessel patterning.
Supplemental Information Inventory of Supplemental Information Figure S1. Related to Figure 1, to show 3-D images of nerve/vessel patterning. Figure S2. Related to Figure 4, to validate Npn-1 signaling
More informationIsolation of mouse monocytes: Mouse monocytes were isolated using a modified
Supplemental Material Extended Methods Isolation of mouse monocytes: Mouse monocytes were isolated using a modified method described (1). Citrated mouse whole blood was mixed with equal volume of PBS,
More informationMyofibroblasts in kidney fibrosis. LeBleu et al.
Origin and Function of Myofibroblasts in Kidney Fibrosis Valerie S. LeBleu, Gangadhar Taduri, Joyce O Connell, Yingqi Teng, Vesselina G. Cooke, Craig Woda, Hikaru Sugimoto and Raghu Kalluri Supplementary
More informationSupplementary Fig. 5
Supplementary Fig. 5 Supplemental Figures legends Supplementary Figure 1 (A) Additional dot plots from CyTOF analysis from untreated group. (B) Gating strategy for assessment of CD11c + NK cells frequency
More informationSupplementary Table 1. PCR amplification conditions for each primer pair. Primer sequence
- 1 - Supplementary Tables Supplementary Table 1. PCR amplification conditions for each primer pair Primer sequence FN1 S - CAAAGCAAGCCCGGTTGT AS - CGCTCCCACTGTTGATTTATCTG ITGα2 S - TTAGGTTACTCTGTGGCTGCAATT
More informationSupplementary information
Supplementary information Epigenetic silencing of retinoblastoma gene regulates pathologic differentiation of myeloid cells in cancer Je-In Youn, Vinit Kumar, Michelle Collazo, Yulia Nefedova, Thomas Condamine,
More informationNo wash 2 Washes 2 Days ** ** IgG-bead phagocytosis (%)
Supplementary Figures Supplementary Figure 1. No wash 2 Washes 2 Days Tat Control ** ** 2 4 6 8 IgG-bead phagocytosis (%) Supplementary Figure 1. Reversibility of phagocytosis inhibition by Tat. Human
More informationimmunofluorescence. Name of antibodies Manufacturer Catalog Number Rabbit anti-pdyn Rabbit anti-kor-1
Supplemental Tables Table S1. List of primary antibodies used for immunohistochemistry, FACS, and immunofluorescence. Name of antibodies Manufacturer Catalog Number Rabbit anti-pdyn Bioss USA bs-13041r
More informationSupplementary Figure Legends
Supplementary Figure Legends Supplementary Fig. 1. The third PDZ domain of PAR-3 and the C-terminal PDZ domain binding motif of VE-cadherin mediate the recruitment of PAR-3 to cell-cell contacts in cells.
More informationTIB6 B16F1 LLC EL4. n=2 n=7 n=9 n=6
Shojaei et al., Supplemental Fig. 1 9 Mean Inhibition by anti-vegf (%) 7 5 3 1 TIB6 n=2 n=7 n=9 n=6 Supplemental Figure 1 Differential growth inhibition by anti-vegf treatment. The percent of tumor growth
More informationSupplementary Figure 1 Pfn1, but not other Pfn isoforms are expressed in
Supplementary Figure 1 Pfn1, but not other Pfn isoforms are expressed in platelets. (a) RT-PCR of Pfn isoforms in control mouse platelets, Pfn1 -/- platelets and control heart. Expected band size for Pfn1
More informationa KYSE270-CON KYSE270-Id1
a KYSE27-CON KYSE27- shcon shcon sh b Human Mouse CD31 Relative MVD 3.5 3 2.5 2 1.5 1.5 *** *** c KYSE15 KYSE27 sirna (nm) 5 1 Id2 Id2 sirna 5 1 sirna (nm) 5 1 Id2 sirna 5 1 Id2 [h] (pg per ml) d 3 2 1
More informationSupplementary Figures
Supplementary Figures Fig. S1. Specificity of perilipin antibody in SAT compared to various organs. (A) Images of SAT at E18.5 stained with perilipin and CD31 antibody. Scale bars: 100 μm. SAT stained
More informationSUPPLEMENTARY FIG. S2. Expression of single HLA loci in shns- and shb 2 m-transduced MKs. Expression of HLA class I antigens (HLA-ABC) as well as
Supplementary Data Supplementary Methods Flow cytometric analysis of HLA class I single locus expression Expression of single HLA loci (HLA-A and HLA-B) by shns- and shb 2 m-transduced megakaryocytes (MKs)
More informationTumour 2. Tumour 9. Tumour 25 Tumour 26. Tumour 27. t(6;16) doi: /nature06159 SUPPLEMENTARY INFORMATION Supplementary Figure 1
doi: 1.18/nature6159 SUPPLEMENTARY INFORMATION Supplementary Figure 1 Tumour Tumour 9 t(6;16) Tumour 5 Tumour 6 Tumour 7 www.nature.com/nature 1 doi: 1.18/nature6159 SUPPLEMENTARY INFORMATION Supplementary
More informationClustalW algorithm. The alignment statistics are 96.9% for both pairwise identity and percent identical sites.
Identity Human Mouse Supplemental Figure 1. Amino acid sequence alignment of -MyHC. The alignment was created using the ClustalW algorithm. The alignment statistics are 96.9% for both pairwise identity
More informationFlowcytometry-based purity analysis of peritoneal macrophage culture.
Liao et al., KLF4 regulates macrophage polarization Revision of Manuscript 45444-RG- Supplementary Figure Legends Figure S Flowcytometry-based purity analysis of peritoneal macrophage culture. Thioglycollate
More informationAdhesion molecules, cytokines & chemokines
Adhesion molecules, cytokines & chemokines Adhesion molecules and cytokines Hycult Biotech is a leading world-class manufacturer of research reagents in the field of innate immunity. We are a specialized
More informationAdditional analysissu
SSC-A FSC-A 65.6% FSC-H FSC-A 86.1% SSC-A 93.3% Viaprobe Additional analysissu Supplementary Figure S1. Gating strategy for flow cytometry Doublet cells were discriminated by FSC-A/SSC-A and FSC-A/FSC-H
More informationSupplementary Information (Ha, et. al) Supplementary Figures Supplementary Fig. S1
Supplementary Information (Ha, et. al) Supplementary Figures Supplementary Fig. S1 a His-ORMDL3 ~ 17 His-ORMDL3 GST-ORMDL3 - + - + IPTG GST-ORMDL3 ~ b Integrated Density (ORMDL3/ -actin) 0.4 0.3 0.2 0.1
More informationNature Biotechnology: doi: /nbt Supplementary Figure 1
Supplementary Figure 1 Schematic and results of screening the combinatorial antibody library for Sox2 replacement activity. A single batch of MEFs were plated and transduced with doxycycline inducible
More informationFigure legend. The expression of BAFF and its receptors in macrophages was detected at lesion areas of atherosclerosis and arthritis.
Data supplement #1 Figure legend. The expression of BAFF and its receptors in macrophages was detected at lesion areas of atherosclerosis and arthritis. A. Consecutive sections of an atherosclerotic plaque
More informationYalin Emre, Magali Irla, Isabelle Dunand- Sauthier, Romain Ballet, Mehdi Meguenani, Stephane Jemelin, Christian Vesin, Walter Reith and Beat A.
Supplementary information Thymic epithelial cell expansion through matricellular protein CYR61 boosts progenitor homing and T- cell output Yalin Emre, Magali Irla, Isabelle Dunand- Sauthier, Romain Ballet,
More informationContribution and Mobilization of Mesenchymal Stem Cells in a mouse model of carbon tetrachloride-induced liver fibrosis
Contribution and Mobilization of Mesenchymal Stem Cells in a mouse model of carbon tetrachloride-induced liver fibrosis Yan Liu 1,*, Zhipeng Han 1,*, Yingying Jing 1,*, Xue Yang 1, Shanshan Zhang 1, Chen
More informationSupplementary Data. Supplementary Table S1.
Supplementary Data Supplementary Table S1. Primer Sequences for Real-Time Reverse Transcription-Polymerase Chain Reaction Gene Forward 5?3 Reverse 3?5 Housekeeping gene 36B4 TCCAGGCTTTGGGCATCA CTTTATCAGCTGCACATCACTCAGA
More informationSupplementary Figure 1. TSA (10 nmol/l), non-class-selective HDAC inhibitor, potentiates
Supplementary Figure 1. TSA (10 nmol/l), non-class-selective HDAC inhibitor, potentiates vascular calcification (VC). (a) Von Kossa staining shows that TSA potentiated the Pi-induced VC. Scale bar, 100
More informationIn vitro cultures of bone marrow stromal cells and progenitor B cells can accurately recapitulate the normal steps of B cell development.
Regular Office Hours: Tuesdays 11-12 Extra office hours: Wed, Feb 7 12-1pm Thurs, Feb 8 11am-12 Fri, Feb 9 2-4pm I WILL NOT BE HOLDING OFFICE HOURS ON TUESDAY Feb 13!! Dina, Tim, and I encourage all confused
More informationB cell development The stages of B cell development
Regular Office Hours: Tuesdays 11-12 Extra office hours: Wed, Feb 7 12-1pm Thurs, Feb 8 11am-12 Fri, Feb 9 2-4pm I WILL NOT BE HOLDING OFFICE HOURS ON TUESDAY Feb 13!! Dina, Tim, and I encourage all confused
More informationSupplemental Information The Sensing of Environmental Stimuli by Follicular Dendritic Cells Promotes Immunoglobulin A Generation in the Gut
Immunity, Volume 33 Supplemental Information The Sensing of Environmental Stimuli by Follicular Dendritic Cells Promotes Immunoglobulin A Generation in the Gut Keiichiro Suzuki, Mikako Maruya, Shimpei
More informationSupplementary Figure 1. Reconstitution of human-acquired lymphoid system in
Supplementary Figure 1. Reconstitution of human-acquired lymphoid system in mouse NOD/SCID/Jak3 null mice were transplanted with human CD34 + hematopoietic stem cells. (Top) Four weeks after the transplantation
More informationisolated from ctr and pictreated mice. Activation of effector CD4 +
Supplementary Figure 1 Bystander inflammation conditioned T reg cells have normal functional suppressive activity and ex vivo phenotype. WT Balb/c mice were treated with polyi:c (pic) or PBS (ctr) via
More informationWT Day 90 after injections
Supplementary Figure 1 a Day 1 after injections Day 9 after injections Klf5 +/- Day 1 after injections Klf5 +/- Day 9 after injections BLM PBS b Day 1 after injections Dermal thickness (μm) 3 1 Day 9 after
More informationNature Immunology: doi: /ni Supplementary Figure 1. Zranb1 gene targeting.
Supplementary Figure 1 Zranb1 gene targeting. (a) Schematic picture of Zranb1 gene targeting using an FRT-LoxP vector, showing the first 6 exons of Zranb1 gene (exons 7-9 are not shown). Targeted mice
More information(B) Comparable expression of major integrin subunits and glycoproteins on the surface of resting WT and Lnk -/- platelets.
Supplemental Figure S1. Characteristics of Lnk -/- platelets. (A) Electron micrographs of resting platelets showing the normal intracellular structure of Lnk -/ platelets. Samples were fixed with 4% PFA
More informationAccelerating skin wound healing by M-CSF through generating SSEA-1 and -3 stem cells. in the injured sites
Accelerating skin wound healing by M-CSF through generating SSEA-1 and -3 stem cells in the injured sites Yunyuan Li, Reza Baradar Jalili, Aziz Ghahary Department of Surgery, University of British Columbia,
More informationSUPPLEMENTAL MATERIAL Homeobox NKX2-3 promotes marginal-zone lymphomagenesis by activating B-cell receptor signaling and shaping lymphocyte dynamics
SUPPLEMENTAL MATERIAL Homeobox NKX2-3 promotes marginal-zone lymphomagenesis by activating B-cell receptor signaling and shaping lymphocyte dynamics SUPPLEMENTARY FIGURES AND FIGURE LEGENDS Supplementary
More informationCD93 and dystroglycan cooperation in human endothelial cell adhesion and migration
/, Supplementary Advance Publications Materials 2016 CD93 and dystroglycan cooperation in human endothelial cell adhesion and migration Supplementary Materials Supplementary Figure S1: In ECs CD93 silencing
More informationSupplementary Figure 1
DOI: 1.138/ncb273 Supplementary Figure 1 a 1x DAPI field images 4x contoured cells 2µm 5µm b Tissue map Dot plot Histogram Y X antigen X DAPI antigen X Figure S1 Laser Scanning Cytometry of bone marrow
More informationpercentage of Nature Immunology: doi: /ni.3728 Supplementary Figure 1
Supplementary Figure 1 4 integrin expression in monocytes and macrophages from Cre + 4 f/f and Cre 4 f/f mice. a) Depicted is a representative histogram of flow cytometry analysis for α4 integrin expression
More informationGrb2 regulates B cell maturation, B cell memory responses and inhibits B cell Ca2+ signalling
Manuscript EMBO-2010-76615 Grb2 regulates B cell maturation, B cell memory responses and inhibits B cell Ca2+ signalling Jochen Ackermann, Daniel Radtke, Thomas Winkler, Lars Nitschke Corresponding author:
More informationSupplementary Information. Conversion of vascular endothelial cells into multipotent stem-like cells
Supplementary Information Conversion of vascular endothelial cells into multipotent stem-like cells Damian Medici 1, Eileen M. Shore 2,3,4, Vitali Y. Lounev 2,4, Frederick S. Kaplan 2,4,5, Raghu Kalluri
More informationSupplementary Figure 1. Isolation of GFPHigh cells.
Supplementary Figure 1. Isolation of GFP High cells. (A) Schematic diagram of cell isolation based on Wnt signaling activity. Colorectal cancer (CRC) cell lines were stably transduced with lentivirus encoding
More informationFigure S1. Specificity of polyclonal anti stabilin-1 and anti stabilin-2 antibodies Lysates of 293T cells transfected with empty vector, mouse
Figure S1. Specificity of polyclonal anti stabilin-1 and anti stabilin-2 antibodies Lysates of 293T cells transfected with empty vector, mouse stabilin-1, or mouse stabilin-2 were immunoblotted using anti
More information