RNA polymerase II precursor mrna (hnrna) introns introns U1RNP. splicing

Size: px
Start display at page:

Download "RNA polymerase II precursor mrna (hnrna) introns introns U1RNP. splicing"

Transcription

1 DNA RNA polymerase II precursor mrna (hnrna) introns introns U2RNP splicing mrna U1RNP U5RNP U4/U6RNP splicing The genetic information of DNA is transcribed to precursor mrna (heterogeneous nuclear RNA, hnrna). The small nuclear RNAs (small nuclear RNA, snrna) such as U1, U2, U4/U6 and U5 RNA are involved in the splicing of hnrna. These RNAs are complexed with proteins to form ribonucleoproteins (RNPs). Anti-U1RNP antibody U1 RNA Sm B B' D E F G C A RNP photo21 ignificance Coarse speckled (larger granular) nuclear pattern with no nucleolar and cytoplasmic staining. The chromosomal regions do not stain in mitotic cells. 3 kinds of polypeptides bound to U1 RNA; U1RNP-68kD, U1RNP-A(34kD), U1RNP-C(23kD) DID, ELISA, WB, Immunoprecipitation, CLEIA The presence of the antibodies to U1RNP constitute one of major diagnostic criteria for MCTD. References 15, 16 14

2 Anti-Sm antibody photo 22 AF/CDC-5* Coarse speckled staining similar to those of anti-u1rnp antibody. U1, U2, U4/U6 and U5 RNA-bound proteins with 5 kinds of epitopes, B'/B(29kD/28kD), D(16kD), E(12kD), F(11kD) and G(10kD). The main epitopes comprise B'/B and D polypeptides. Antibodies to E-F-G complex as dominant epitopes are also reported. DID, ELISA, WB, Immunoprecipitation, CLEIA Marker antibody for SLE. The presence of anti-sm antibody is included in the criteria for the classification of SLE by the American College of Rheumatology. References 17 Anti-U2RNP antibody / Anti-U1U2RNP antibody Coarse speckled nuclear staining similar to those of anti-u1rnp antibody. U2RNA-bound proteins with 2 kinds of epitopes on A'(32kD) and B"(28.5kD). Immunoprecipitation Polymyositis/scleroderma overlap syndrome References 3, 15, 16 photo 23 SLE: systemic lupus erythematosus, SSc: systemic sclerosis, MCTD: mixed connective tissue disease, SS: Sjögren's syndrome, PM/DM: polymyositis/dermatomyositis, RA: rheumatoid arthritis, PBC: primary biliary cirrhosis, AIH: autoimmune hepatitis 15

3 Anti-hnRNP antibody photo 24 Large speckled (granular) nucleoplasmic staining with no chromosomal fluorescence in mitotic cells. The antibodies frequently coexist with anti-u1rnp and anti-sm antibodies, and give coarse speckled patterns. hnrna bound proteins-a/b, A1, A2, C, I ELISA, WB These antibodies were first reported in patients with MCTD. Antibodies to the A/ B polypeptides and those to the A1 and A2 polypeptides occur in SLE and rheumatoid arthritis, respectively. Recently, antihnrnp-i antibodies with weak nuclear staining specific for scleroderma and antihnrnp-c antibodies with speckled nuclear staining in scleroderma were reported. References 18, 19, 20, 21 Anti-SS-A/Ro antibody Y-RNA Ro 60 kd Ro 52 kd SS-A/Ro SS-B/La La photo 2 F/CDC-7* Fine speckled nuclear staining observed in acetone-fixed slides, but not in alcohol-fixed ones. The chromosomal region shows no fluorescence in mitotic cells. Y1-Y5RNA-bound proteins (52kD, 60kD) DID, ELISA, WB, Immunoprecipitation, CLEIA These antibodies occur most frequently in patients with SS, and those with SLE. Sometimes found in patients with rheumatoid arthritis, myositis or scleroderma. The presence of the antibodies in the mother is associated with neonatal lupus and congenital heart block. The presence of anti-ss-a antibodies constitutes one of the diagnostic criterion of SS in Europe. References 22 16

4 Anti-SS-B/La antibody photo 26 AF/CDC-2* Fine dense speckled nuclear staining is observed in interphase cells with no chromosomal fluorescence in mitotic cells. 48 kd SS-B/La protein, a termination factor for RNA polymerase III transcription DID, ELISA, WB, Immunoprecipitation, CLEIA The antibodies are found in patients with SS and SLE. As with anti-ss-a antibodies, the presence of these antibodies is associated with neonatal lupus and congenital heart block. The antibodies were reported to be frequently positive in patients with recurrent annular erythema. The presence of anti- SS-B antibodies constitutes one of the diagnostic criterion of SS in Europe. References 23 Anti-p80 coilin antibody Granular or few nuclear dots staining**, 0 to 6 dots (ave. 2 dots) per nucleus fluorescence. The distinct large dotty fluorescence can be seen in cells during S and G2 phases, and mitotic cells show no staining. photo 27 p80 coilin, the 80kD protein composing the coiled body in nucleoplasm. WB These antibodies occur in some patients with SS and those with primary biliary cirrhosis. References 24, 25 SLE: systemic lupus erythematosus, SSc: systemic sclerosis, MCTD: mixed connective tissue disease, SS: Sjögren's syndrome, PM/DM: polymyositis/dermatomyositis, RA: rheumatoid arthritis, PBC: primary biliary cirrhosis, AIH: autoimmune hepatitis 17

5 Anti-Sp100 antibodies photo 28 Granular or multiple (1 to 24) nuclear dots staining**. Sp100 protein. Multiple nuclear dots staining is also observed by the antibodies to promyelocytic leukemia (PML) protein, NDP53 (a binding protein to PML oncogenic domain including Sp100). WB These antibodies occur in some patients with PBC. References 26, 27, 28 ** Since the numbers of staining dots seen in few nuclear dots and multiple nuclear dots patterns overlap each other, it is sometimes difficult to distinguish these patterns. These patterns are often called granular or nuclear dots patterns. 18

immuno concepts Immuno Concepts is proud to announce that when present the characteristic SS-A/Ro pattern detected by the HEp-2000 substrate

immuno concepts Immuno Concepts is proud to announce that when present the characteristic SS-A/Ro pattern detected by the HEp-2000 substrate immuno concepts Immuno Concepts is proud to announce that when present the characteristic SS-A/Ro pattern detected by the HEp-2000 substrate is now considered confirmatory for the presence of antibodies

More information

ANA and Antibody Series

ANA and Antibody Series ANA and Antibody Series How to Do Scleroderma ANA and Antibody Testing Correctly (A Practical Guide for Clinicians) Background When a clinician has a reason to suspect that a patient may have an autoimmune

More information

Carmen Gelpí Elena Pérez Cristina Roldan

Carmen Gelpí Elena Pérez Cristina Roldan Autoimmun Highlights (2014) 5:47 54 DOI 10.1007/s13317-014-0059-x REVIEW ARTICLE Efficiency of a solid-phase chemiluminescence immunoassay for detection of antinuclear and cytoplasmic autoantibodies compared

More information

ANA Diagnostics Using Indirect Immunofluorescence

ANA Diagnostics Using Indirect Immunofluorescence ANA Diagnostics Using Indirect Immunofluorescence EUROIMMUN D-23560 Luebeck (Germany) Seekamp 31 Tel +49 45158550 Fax 5855591 E-mail euroimmun@euroimmun.de Table of contents Autoantibodies against cell

More information

Right and wrong in antinuclear antibody tests. Timo Walle HUSLAB, Department of Immunology

Right and wrong in antinuclear antibody tests. Timo Walle HUSLAB, Department of Immunology Right and wrong in antinuclear antibody tests Timo Walle HUSLAB, Department of Immunology Antinuclear antibodies (ANA) Autoantibodies reacting with nuclear antigens Nucleoplasm Nuclear membrane Nucleoli

More information

Detection of Anti-SSA Antibodies by Indirect Immunofluorescence

Detection of Anti-SSA Antibodies by Indirect Immunofluorescence Clinical Chemistry 50:12 2361 2369 (2004) Clinical Immunology Detection of Anti-SSA Antibodies by Indirect Immunofluorescence Xavier Bossuyt, 1* Johan Frans, 1 Ann Hendrickx, 1 Godelieve Godefridis, 1

More information

SAMPLE I/LA02-A2. Archived Document

SAMPLE I/LA02-A2. Archived Document Archived Document This archived document is no longer being reviewed through the CLSI Consensus Document Development Process. However, this document is technically valid as of September 2016. Because of

More information

INTERPRETIVE INFORMATION: Jo-1 Antibody, IgG 29 AU/mL or less...negative AU/mL...Equivocal 41 AU/mL or greater...positive

INTERPRETIVE INFORMATION: Jo-1 Antibody, IgG 29 AU/mL or less...negative AU/mL...Equivocal 41 AU/mL or greater...positive Client: Example Client ABC123 123 Test Drive Salt Lake City, UT 84108 UNITED STATES Physician: Doctor, Example DOB Unknown Gender: Unknown Collection Date: 00/00/0000 00:00 Myositis Extended Panel ARUP

More information

Transcription in Eukaryotes

Transcription in Eukaryotes Transcription in Eukaryotes Biology I Hayder A Giha Transcription Transcription is a DNA-directed synthesis of RNA, which is the first step in gene expression. Gene expression, is transformation of the

More information

Transcription is the first stage of gene expression

Transcription is the first stage of gene expression Transcription is the first stage of gene expression RNA synthesis is catalyzed by RNA polymerase, which pries the DNA strands apart and hooks together the RNA nucleotides The RNA is complementary to the

More information

Comparison of assay systems for detecting

Comparison of assay systems for detecting J Clin Pathol 1991;44:685-689 Department of Medicine, Divisions of Rheumatology and Clinical Immunology, Hospital for Joint Diseases Orthopaedic Institute, New York University Medical Center, 301 East

More information

Detection and identification of antinuclear antibodies (ANA) in a large and consecutive cohort of serum samples referred for ANA testing

Detection and identification of antinuclear antibodies (ANA) in a large and consecutive cohort of serum samples referred for ANA testing Ann Rheum Dis 2001;60:1131 1136 1131 Department of Rheumatology, Ghent University Hospital, Belgium I Peene EMVeys F De Keyser Innogenetics NV, Ghent, Belgium L Meheus Correspondence to: Dr F De Keyser,

More information

Computational Biology I LSM5191 (2003/4)

Computational Biology I LSM5191 (2003/4) Computational Biology I LSM5191 (2003/4) Aylwin Ng, D.Phil Lecture Notes: Transcriptome: Molecular Biology of Gene Expression I Flow of information: DNA to polypeptide DNA Start Exon1 Intron Exon2 Termination

More information

BIO 311C Spring Lecture 36 Wednesday 28 Apr.

BIO 311C Spring Lecture 36 Wednesday 28 Apr. BIO 311C Spring 2010 1 Lecture 36 Wednesday 28 Apr. Synthesis of a Polypeptide Chain 5 direction of ribosome movement along the mrna 3 ribosome mrna NH 2 polypeptide chain direction of mrna movement through

More information

Transcription. DNA to RNA

Transcription. DNA to RNA Transcription from DNA to RNA The Central Dogma of Molecular Biology replication DNA RNA Protein transcription translation Why call it transcription and translation? transcription is such a direct copy

More information

Molecular Cell Biology - Problem Drill 08: Transcription, Translation and the Genetic Code

Molecular Cell Biology - Problem Drill 08: Transcription, Translation and the Genetic Code Molecular Cell Biology - Problem Drill 08: Transcription, Translation and the Genetic Code Question No. 1 of 10 1. Which of the following statements about how genes function is correct? Question #1 (A)

More information

Lesson Overview. Fermentation 13.1 RNA

Lesson Overview. Fermentation 13.1 RNA 13.1 RNA The Role of RNA Genes contain coded DNA instructions that tell cells how to build proteins. The first step in decoding these genetic instructions is to copy part of the base sequence from DNA

More information

Interpath Laboratory, Inc. Test File Update

Interpath Laboratory, Inc. Test File Update As an Interpath customer who receives electronic results or sends electronic orders you may need to be notified when we update our Service Manual. Although we try to keep these changes to a minimum, laboratory

More information

وراثة األحياء الدقيقة Microbial Genetics

وراثة األحياء الدقيقة Microbial Genetics وراثة األحياء الدقيقة Microbial Genetics د. تركي محمد الداود مكتب 2 ب 45 أساسيات في علم الوراثة Fundamentals of Genetics Lecture 4 Physical Chemistry of Nucleic Acids DNA and RNA molecules can appear in

More information

Bio-Rad Laboratories BIOPLEX 2200 SYSTEM. BioPlex 2200 ANA Screen with MDSS. The first and only fully-automated, multiplexed ANA Screen

Bio-Rad Laboratories BIOPLEX 2200 SYSTEM. BioPlex 2200 ANA Screen with MDSS. The first and only fully-automated, multiplexed ANA Screen Bio-Rad Laboratories BIOPLEX 2200 SYSTEM BioPlex 2200 ANA Screen with MDSS The first and only fully-automated, multiplexed ANA Screen Bio-Rad Laboratories BIOPLEX 2200 SYSTEM Like no other The BioPlex

More information

Regulation of bacterial gene expression

Regulation of bacterial gene expression Regulation of bacterial gene expression Gene Expression Gene Expression: RNA and protein synthesis DNA ----------> RNA ----------> Protein transcription translation! DNA replication only occurs in cells

More information

The Structure of RNA. The Central Dogma

The Structure of RNA. The Central Dogma 12-3 12-3 RNA and Protein Synthesis The Structure of RNA The Central Dogma Phenotype A gene is a SEQUENCE of DNA that codes for a protein (or functional RNA). Phenotype is the individual s observable trait

More information

Make the protein through the genetic dogma process.

Make the protein through the genetic dogma process. Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino

More information

Fermentation. Lesson Overview. Lesson Overview 13.1 RNA

Fermentation. Lesson Overview. Lesson Overview 13.1 RNA 13.1 RNA THINK ABOUT IT DNA is the genetic material of cells. The sequence of nucleotide bases in the strands of DNA carries some sort of code. In order for that code to work, the cell must be able to

More information

The U1-snRNP complex: structural properties relating to autoimmune pathogenesis in rheumatic diseases

The U1-snRNP complex: structural properties relating to autoimmune pathogenesis in rheumatic diseases Nicole H. Kattah Michael G. Kattah Paul J. Utz The U1-snRNP complex: structural properties relating to autoimmune pathogenesis in rheumatic diseases Authors address Nicole H. Kattah 1, Michael G. Kattah

More information

NOVA Lite HEp-2 External EB Kits For In Vitro Diagnostic Use

NOVA Lite HEp-2 External EB Kits For In Vitro Diagnostic Use NOVA Lite HEp-2 External EB Kits For In Vitro Diagnostic Use Product Code: 704230, 704235 CLIA Complexity: High Intended Use This product (kit or substrate slides) is intended for use in the screening

More information

Section 14.1 Structure of ribonucleic acid

Section 14.1 Structure of ribonucleic acid Section 14.1 Structure of ribonucleic acid The genetic code Sections of DNA are transcribed onto a single stranded molecule called RNA There are two types of RNA One type copies the genetic code and transfers

More information

6.C: Students will explain the purpose and process of transcription and translation using models of DNA and RNA

6.C: Students will explain the purpose and process of transcription and translation using models of DNA and RNA 6.C: Students will explain the purpose and process of transcription and translation using models of DNA and RNA DNA mrna Protein DNA is found in the nucleus, but making a protein occurs at the ribosome

More information

Key Area 1.3: Gene Expression

Key Area 1.3: Gene Expression Key Area 1.3: Gene Expression RNA There is a second type of nucleic acid in the cell, called RNA. RNA plays a vital role in the production of protein from the code in the DNA. What is gene expression?

More information

CLASS 3.5: 03/29/07 EUKARYOTIC TRANSCRIPTION I: PROMOTERS AND ENHANCERS

CLASS 3.5: 03/29/07 EUKARYOTIC TRANSCRIPTION I: PROMOTERS AND ENHANCERS CLASS 3.5: 03/29/07 EUKARYOTIC TRANSCRIPTION I: PROMOTERS AND ENHANCERS A. Promoters and Polymerases (RNA pols): 1. General characteristics - Initiation of transcription requires a. Transcription factors

More information

MOLECULAR GENETICS PROTEIN SYNTHESIS. Molecular Genetics Activity #2 page 1

MOLECULAR GENETICS PROTEIN SYNTHESIS. Molecular Genetics Activity #2 page 1 AP BIOLOGY MOLECULAR GENETICS ACTIVITY #2 NAME DATE HOUR PROTEIN SYNTHESIS Molecular Genetics Activity #2 page 1 GENETIC CODE PROTEIN SYNTHESIS OVERVIEW Molecular Genetics Activity #2 page 2 PROTEIN SYNTHESIS

More information

Review of Protein (one or more polypeptide) A polypeptide is a long chain of..

Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. Gene expression Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. In a protein, the sequence of amino acid determines its which determines the protein s A protein with an enzymatic

More information

RNA, & PROTEIN SYNTHESIS. 7 th Grade, Week 4, Day 1 Monday, July 15, 2013

RNA, & PROTEIN SYNTHESIS. 7 th Grade, Week 4, Day 1 Monday, July 15, 2013 RNA, & PROTEIN SYNTHESIS 7 th Grade, Week 4, Day 1 Monday, July 15, 2013 The Central Dogma RNA vs. DNA Ribonucleic Acid RNA is required for translation of genetic information stored in DNA into protein

More information

AUTOIMMUNE DISEASE ASSAYS

AUTOIMMUNE DISEASE ASSAYS product range 1 Corgenix PRODUCT RANGE 04-05 Antiphospholipid Syndrome Assays 06-10 AUTOIMMUNE DISEASE ASSAYS 11 Liver Disease Assays 11 Liver Fibrosis Markers 12 Cardiovascular Markers 12-13 Platelet

More information

Transcription Eukaryotic Cells

Transcription Eukaryotic Cells Transcription Eukaryotic Cells Packet #20 1 Introduction Transcription is the process in which genetic information, stored in a strand of DNA (gene), is copied into a strand of RNA. Protein-encoding genes

More information

BIOCHEMISTRY REVIEW. Overview of Biomolecules. Chapter 12 Transcription

BIOCHEMISTRY REVIEW. Overview of Biomolecules. Chapter 12 Transcription BIOCHEMISTRY REVIEW Overview of Biomolecules Chapter 12 Transcription 2 3 4 5 Are You Getting It?? Which are general characteristics of transcription? (multiple answers) a) An entire DNA molecule is transcribed

More information

Year III Pharm.D Dr. V. Chitra

Year III Pharm.D Dr. V. Chitra Year III Pharm.D Dr. V. Chitra 1 Genome entire genetic material of an individual Transcriptome set of transcribed sequences Proteome set of proteins encoded by the genome 2 Only one strand of DNA serves

More information

Text Reference, Campbell v.8, chapter 17 PROTEIN SYNTHESIS

Text Reference, Campbell v.8, chapter 17 PROTEIN SYNTHESIS AP BIOLOGY Text Reference, Campbell v.8, chapter 17 ACTIVITY 1.22 NAME DATE HOUR PROTEIN SYNTHESIS GENETIC CODE PROTEIN SYNTHESIS OVERVIEW PROTEIN SYNTHESIS TRANSCRIPTION PROTEIN SYNTHESIS TRANSLATION

More information

Videos. Lesson Overview. Fermentation

Videos. Lesson Overview. Fermentation Lesson Overview Fermentation Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast

More information

CLEP Biology - Problem Drill 11: Transcription, Translation and The Genetic Code

CLEP Biology - Problem Drill 11: Transcription, Translation and The Genetic Code CLEP Biology - Problem Drill 11: Transcription, Translation and The Genetic Code No. 1 of 10 1. Three types of RNA comprise the structural and functional core for protein synthesis, serving as a template

More information

CHAPTERS , 17: Eukaryotic Genetics

CHAPTERS , 17: Eukaryotic Genetics CHAPTERS 14.1 14.6, 17: Eukaryotic Genetics 1. Review the levels of DNA packing within the eukaryote nucleus. Label each level. (A similar diagram is on pg 188 of your textbook.) 2. How do the coding regions

More information

Themes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important!

Themes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important! Themes: RNA is very versatile! RNA and RNA Processing Chapter 14 RNA-RNA interactions are very important! Prokaryotes and Eukaryotes have many important differences. Messenger RNA (mrna) Carries genetic

More information

Gene Expression: Transcription

Gene Expression: Transcription Gene Expression: Transcription The majority of genes are expressed as the proteins they encode. The process occurs in two steps: Transcription = DNA RNA Translation = RNA protein Taken together, they make

More information

DNA & Protein Synthesis. The source and the process!

DNA & Protein Synthesis. The source and the process! DNA & Protein Synthesis The source and the process! Agenda I. DNA and Genes II. Protein Synthesis III. The Genetic Code I. DNA & Genes: The beauty of DNA Remember: DNA is a macromolecule that stores information

More information

Videos. Bozeman Transcription and Translation: Drawing transcription and translation:

Videos. Bozeman Transcription and Translation:   Drawing transcription and translation: Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast RNA and DNA. 29b) I can explain

More information

DNA Function: Information Transmission

DNA Function: Information Transmission DNA Function: Information Transmission DNA is called the code of life. What does it code for? *the information ( code ) to make proteins! Why are proteins so important? Nearly every function of a living

More information

30 Gene expression: Transcription

30 Gene expression: Transcription 30 Gene expression: Transcription Gene structure. o Exons coding region of DNA. o Introns non-coding region of DNA. o Introns are interspersed between exons of a single gene. o Promoter region helps enzymes

More information

Mannen et al., http :// /cgi /content /full /jcb /DC1

Mannen et al., http ://  /cgi /content /full /jcb /DC1 Supplemental material JCB Mannen et al., http ://www.jcb.org /cgi /content /full /jcb.201601024 /DC1 THE JOURNAL OF CELL BIOLOGY Figure S1. Characterization of SNB components. (A) SNB localization of Venus-tagged

More information

Chapter 6: Transcription and RNA Processing in Eukaryotes

Chapter 6: Transcription and RNA Processing in Eukaryotes 3. Basic Genetics Plant Molecular Biology Chapter 6: Transcription and RNA Processing in Eukaryotes - Genetic organization in eukaryote - Transcription in eukaryote - - RNA processing in eukaryote - Translation

More information

Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall

Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 Essential Question What is transcription and translation and how do they take place? 3 of 39 12 3 RNA and Protein Synthesis Genes are coded

More information

Wednesday, November 22, 17. Exons and Introns

Wednesday, November 22, 17. Exons and Introns Exons and Introns Introns and Exons Exons: coded regions of DNA that get transcribed and translated into proteins make up 5% of the genome Introns and Exons Introns: non-coded regions of DNA Must be removed

More information

Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall

Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 12 3 RNA and Protein Synthesis Genes are coded DNA instructions that control the production of proteins. Genetic messages can be decoded by

More information

Gene Expression Transcription/Translation Protein Synthesis

Gene Expression Transcription/Translation Protein Synthesis Gene Expression Transcription/Translation Protein Synthesis 1. Describe how genetic information is transcribed into sequences of bases in RNA molecules and is finally translated into sequences of amino

More information

Chapter 12 Packet DNA 1. What did Griffith conclude from his experiment? 2. Describe the process of transformation.

Chapter 12 Packet DNA 1. What did Griffith conclude from his experiment? 2. Describe the process of transformation. Chapter 12 Packet DNA and RNA Name Period California State Standards covered by this chapter: Cell Biology 1. The fundamental life processes of plants and animals depend on a variety of chemical reactions

More information

Transcription and Post Transcript Modification

Transcription and Post Transcript Modification Transcription and Post Transcript Modification You Should Be Able To 1. Describe transcription. 2. Compare and contrast eukaryotic + prokaryotic transcription. 3. Explain mrna processing in eukaryotes.

More information

ANA Screen 8 ELISA KIT

ANA Screen 8 ELISA KIT ANA Screen 8 ELISA KIT Cat. No.:DEIA6289 Pkg.Size:96T Intended use ANA Screen 8 ELISA is for the qualitative screening of IgG antibodies against dsdna, RNP, Sm, SS-A/Ro, SS-B/La, Scl-70, CENP-B and Jo-1

More information

RNA Structure and the Versatility of RNA. Mitesh Shrestha

RNA Structure and the Versatility of RNA. Mitesh Shrestha RNA Structure and the Versatility of RNA Mitesh Shrestha Ribonucleic Acid (RNA) Nitrogenous Bases (Adenine, Uracil, Guanine, Cytosine) Ribose Sugar Ribonucleic Acid (RNA) Phosphate Group RNA world Hypothesis

More information

Screening for IgG Antinuclear Autoantibodies by HEp-2 Indirect Fluorescent Antibody Assays and the Need for Standardization

Screening for IgG Antinuclear Autoantibodies by HEp-2 Indirect Fluorescent Antibody Assays and the Need for Standardization Immunopathology / HEp-2 Immunofluorescence Standardization Screening for IgG Antinuclear Autoantibodies by HEp-2 Indirect Fluorescent Antibody Assays and the Need for Standardization Susan S. Copple, MS,

More information

ENCODE DCC Antibody Validation Document

ENCODE DCC Antibody Validation Document ENCODE DCC Antibody Validation Document Date of Submission Name: Email: Lab Antibody Name: Target: Company/ Source: Catalog Number, database ID, laboratory Lot Number Antibody Description: Target Description:

More information

The Nature of Genes. The Nature of Genes. The Nature of Genes. The Nature of Genes. The Nature of Genes. The Genetic Code. Genes and How They Work

The Nature of Genes. The Nature of Genes. The Nature of Genes. The Nature of Genes. The Nature of Genes. The Genetic Code. Genes and How They Work Genes and How They Work Chapter 15 Early ideas to explain how genes work came from studying human diseases. Archibald Garrod studied alkaptonuria, 1902 Garrod recognized that the disease is inherited via

More information

Biology 3201 Genetics Unit #5

Biology 3201 Genetics Unit #5 Biology 3201 Genetics Unit #5 Protein Synthesis Protein Synthesis Protein synthesis: this is the process whereby instructions from DNA are used to create polypeptides that make up a protein. This process

More information

From Gene to Protein. Chapter 17

From Gene to Protein. Chapter 17 From Gene to Protein Chapter 17 What you need to know: The key terms: gene expression, transcription, and translation. The major events of transcription. How eukaryotic cells modify RNA after transcription.

More information

PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein

PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein This is also known as: The central dogma of molecular biology Protein Proteins are made

More information

DNA makes RNA makes Proteins. The Central Dogma

DNA makes RNA makes Proteins. The Central Dogma DNA makes RNA makes Proteins The Central Dogma TRANSCRIPTION DNA RNA transcript RNA polymerase RNA PROCESSING Exon RNA transcript (pre-mrna) Intron Aminoacyl-tRNA synthetase NUCLEUS CYTOPLASM FORMATION

More information

6.2 Chromatin is divided into euchromatin and heterochromatin

6.2 Chromatin is divided into euchromatin and heterochromatin 6.2 Chromatin is divided into euchromatin and heterochromatin Individual chromosomes can be seen only during mitosis. During interphase, the general mass of chromatin is in the form of euchromatin. Euchromatin

More information

Name Campbell Chapter 17 From Gene To Protein

Name Campbell Chapter 17 From Gene To Protein A.P. Biology Name Campbell Chapter 17 From Gene To Protein 325-331 The information in DNA is coded in a particular sequence of (nucleic acid monomers). This chapter is about how this sequence is expressed

More information

Quick Review of Protein Synthesis

Quick Review of Protein Synthesis Collin College BIOL. 2401 Quick Review of Protein Synthesis. Proteins and Protein Synthesis Proteins are the molecular units that do most of the work in a cell. They function as molecular catalysts, help

More information

The Flow of Genetic Information

The Flow of Genetic Information Chapter 17 The Flow of Genetic Information The DNA inherited by an organism leads to specific traits by dictating the synthesis of proteins and of RNA molecules involved in protein synthesis. Proteins

More information

RNA genes. Functional non-coding RNAs (ncrna) Jan 31 st 2018.

RNA genes. Functional non-coding RNAs (ncrna) Jan 31 st 2018. RNA genes Functional non-coding RNAs (ncrna) Jan 31 st 2018. After human genome sequencing it became obvious that human genome consists of many non-protein coding genes, genes that code for different RNAs

More information

Gene Expression: Transcription, Translation, RNAs and the Genetic Code

Gene Expression: Transcription, Translation, RNAs and the Genetic Code Lecture 28-29 Gene Expression: Transcription, Translation, RNAs and the Genetic Code Central dogma of molecular biology During transcription, the information in a DNA sequence (a gene) is copied into a

More information

Molecular Genetics of Disease and the Human Genome Project

Molecular Genetics of Disease and the Human Genome Project 9 Molecular Genetics of Disease and the Human Genome Project Fig. 1. The 23 chromosomes in the human genome. There are 22 autosomes (chromosomes 1 to 22) and two sex chromosomes (X and Y). Females inherit

More information

Genes and How They Work. Chapter 15

Genes and How They Work. Chapter 15 Genes and How They Work Chapter 15 The Nature of Genes They proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes The central

More information

PROTEIN SYNTHESIS WHAT IS IT? HOW DOES IT WORK?

PROTEIN SYNTHESIS WHAT IS IT? HOW DOES IT WORK? PROTEIN SYNTHESIS WHAT IS IT? HOW DOES IT WORK? Learning Outcomes All: Will be able to describe simple steps in protein synthesis: Transcription and Translation and be able to distinguish between them.

More information

Molecular reclassification to find clinically useful biomarkers for systemic autoimmune diseases

Molecular reclassification to find clinically useful biomarkers for systemic autoimmune diseases IMI Periodic Report Template Molecular reclassification to find clinically useful biomarkers for systemic autoimmune diseases PRECISESADS 115565 Prof. Chris Chamberlain UCB Biopharma SPRL Allée de la Recherche,

More information

From RNA To Protein

From RNA To Protein From RNA To Protein 22-11-2016 Introduction mrna Processing heterogeneous nuclear RNA (hnrna) RNA that comprises transcripts of nuclear genes made by RNA polymerase II; it has a wide size distribution

More information

Control of Eukaryotic Gene Expression (Learning Objectives)

Control of Eukaryotic Gene Expression (Learning Objectives) Control of Eukaryotic Gene Expression (Learning Objectives) 1. Compare and contrast chromatin and chromosome: composition, proteins involved and level of packing. Explain the structure and function of

More information

BIOLOGY - CLUTCH CH.17 - GENE EXPRESSION.

BIOLOGY - CLUTCH CH.17 - GENE EXPRESSION. !! www.clutchprep.com CONCEPT: GENES Beadle and Tatum develop the one gene one enzyme hypothesis through their work with Neurospora (bread mold). This idea was later revised as the one gene one polypeptide

More information

Unit 1: DNA and the Genome. Sub-Topic (1.3) Gene Expression

Unit 1: DNA and the Genome. Sub-Topic (1.3) Gene Expression Unit 1: DNA and the Genome Sub-Topic (1.3) Gene Expression Unit 1: DNA and the Genome Sub-Topic (1.3) Gene Expression On completion of this subtopic I will be able to State the meanings of the terms genotype,

More information

Proteins and Protein Synthesis body structures, hormones, enzymes & antibodies amino acids sequence number DNA chemical code codon 'initiator'

Proteins and Protein Synthesis body structures, hormones, enzymes & antibodies amino acids sequence number DNA chemical code codon 'initiator' Proteins and Protein Synthesis - Proteins : large complex molecules that make up body structures, hormones, enzymes & antibodies : are composed of subunits called amino acids : there are 20 different amino

More information

Chapter 17. From Gene to Protein. Slide 1. Slide 2. Slide 3. Gene Expression. Which of the following is the best example of gene expression? Why?

Chapter 17. From Gene to Protein. Slide 1. Slide 2. Slide 3. Gene Expression. Which of the following is the best example of gene expression? Why? Slide 1 Chapter 17 From Gene to Protein PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from

More information

Hershey and Chase. The accumulation of evidence: Key Experiments in the Discovery of DNA: Griffith s Transformation Experiment (1928)

Hershey and Chase. The accumulation of evidence: Key Experiments in the Discovery of DNA: Griffith s Transformation Experiment (1928) Today: Key Experiments in the Discovery of DNA: Griffith s Transformation Experiment (1928) Reviewing Mitosis/ Exploring the Function of Taxol Structure and Function of DNA! What do we learn about the

More information

Bio 101 Sample questions: Chapter 10

Bio 101 Sample questions: Chapter 10 Bio 101 Sample questions: Chapter 10 1. Which of the following is NOT needed for DNA replication? A. nucleotides B. ribosomes C. Enzymes (like polymerases) D. DNA E. all of the above are needed 2 The information

More information

I. Gene Expression Figure 1: Central Dogma of Molecular Biology

I. Gene Expression Figure 1: Central Dogma of Molecular Biology I. Gene Expression Figure 1: Central Dogma of Molecular Biology Central Dogma: Gene Expression: RNA Structure RNA nucleotides contain the pentose sugar Ribose instead of deoxyribose. Contain the bases

More information

Cellular RNA-Protein Particles

Cellular RNA-Protein Particles Antibodies from Patients with Connective Tissue Diseases Bind Specific Subsets of Cellular RNA-Protein Particles JOHN A. HARDIN, DANIEL R. RAHN, CALVIN SHEN, MICHAEL R. LERNER, SANDRA L. WOLIN, MARGARET

More information

A. Incorrect! This feature does help with it suitability as genetic material.

A. Incorrect! This feature does help with it suitability as genetic material. College Biology - Problem Drill 08: Gene Structures and Functions No. 1 of 10 1. Which of the statements below is NOT true in explaining why DNA is a suitable genetic material? #01 (A) Its double helix

More information

Practical Evaluation of Methods for Detection and Specificity of Autoantibodies to Extractable Nuclear Antigens

Practical Evaluation of Methods for Detection and Specificity of Autoantibodies to Extractable Nuclear Antigens CLINICAL AND DIAGNOSTIC LABORATORY IMMUNOLOGY, Mar. 2004, p. 297 301 Vol. 11, No. 2 1071-412X/04/$08.00 0 DOI: 10.1128/CDLI.11.2.297 301.2004 Copyright 2004, American Society for Microbiology. All Rights

More information

Fig Ch 17: From Gene to Protein

Fig Ch 17: From Gene to Protein Fig. 17-1 Ch 17: From Gene to Protein Basic Principles of Transcription and Translation RNA is the intermediate between genes and the proteins for which they code Transcription is the synthesis of RNA

More information

CH 17 :From Gene to Protein

CH 17 :From Gene to Protein CH 17 :From Gene to Protein Defining a gene gene gene Defining a gene is problematic because one gene can code for several protein products, some genes code only for RNA, two genes can overlap, and there

More information

Analyzed Fungi Neurospora crassa mutants. Mutants were UNABLE to grow without Arginine (an amino acid) Other biochemical experiments indicated:

Analyzed Fungi Neurospora crassa mutants. Mutants were UNABLE to grow without Arginine (an amino acid) Other biochemical experiments indicated: From Gene to Protein Beadle and Tatum Analyzed Fungi Neurospora crassa mutants Mutants were UNABLE to grow without Arginine (an amino acid) Other biochemical experiments indicated: Precursor Ornithine

More information

Subcellular distribution of Ro ribonucleoprotein complexes and their constituents

Subcellular distribution of Ro ribonucleoprotein complexes and their constituents Journal of Cell Science 106, 929-935 (1993) Printed in Great Britain The Company of Biologists Limited 1993 929 Subcellular distribution of Ro ribonucleoprotein complexes and their constituents Ron Peek*,

More information

DNA. Griffith s Transforming Principle Experiment 11/30/2006 DNA 2

DNA. Griffith s Transforming Principle Experiment 11/30/2006 DNA 2 DNA Griffith s Transforming Principle Experiment 11/30/2006 DNA 2 1 Avery, McCarty, & MacLeod 1944 Extended Griffith s work 16 years later Search for the transforming factor Live rough cells + Protein

More information

Transcription and Translation. DANILO V. ROGAYAN JR. Faculty, Department of Natural Sciences

Transcription and Translation. DANILO V. ROGAYAN JR. Faculty, Department of Natural Sciences Transcription and Translation DANILO V. ROGAYAN JR. Faculty, Department of Natural Sciences Protein Structure Made up of amino acids Polypeptide- string of amino acids 20 amino acids are arranged in different

More information

The Nature of Genes. The Nature of Genes. Genes and How They Work. Chapter 15/16

The Nature of Genes. The Nature of Genes. Genes and How They Work. Chapter 15/16 Genes and How They Work Chapter 15/16 The Nature of Genes Beadle and Tatum proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes

More information

Section C: The Control of Gene Expression

Section C: The Control of Gene Expression Section C: The Control of Gene Expression 1. Each cell of a multicellular eukaryote expresses only a small fraction of its genes 2. The control of gene expression can occur at any step in the pathway from

More information

A 52-kD PROTEIN IS A NOVEL COMPONENT OF THE SS-A/Ro ANTIGENIC PARTICLE

A 52-kD PROTEIN IS A NOVEL COMPONENT OF THE SS-A/Ro ANTIGENIC PARTICLE A 52-kD PROTEIN IS A NOVEL COMPONENT OF THE SS-A/Ro ANTIGENIC PARTICLE By ELDAD BEN-CHETRIT, EDWARD K. L. CHAN, KEVIN F. SULLIVAN, AND ENG M. TAN From the W. M. Keck Autoimmune Disease Center, Scripps

More information

The Genetic Code and Transcription. Chapter 12 Honors Genetics Ms. Susan Chabot

The Genetic Code and Transcription. Chapter 12 Honors Genetics Ms. Susan Chabot The Genetic Code and Transcription Chapter 12 Honors Genetics Ms. Susan Chabot TRANSCRIPTION Copy SAME language DNA to RNA Nucleic Acid to Nucleic Acid TRANSLATION Copy DIFFERENT language RNA to Amino

More information

Chapter 11. How Genes Are Controlled. Lectures by Edward J. Zalisko

Chapter 11. How Genes Are Controlled. Lectures by Edward J. Zalisko Chapter 11 How Genes Are Controlled PowerPoint Lectures for Campbell Essential Biology, Fifth Edition, and Campbell Essential Biology with Physiology, Fourth Edition Eric J. Simon, Jean L. Dickey, and

More information

GENE REGULATION. Gene regulation occurs at the level of transcription or production of mrna

GENE REGULATION. Gene regulation occurs at the level of transcription or production of mrna GENE REGULATION Virtually every cell in your body contains a complete set of genes But they are not all turned on in every tissue Each cell in your body expresses only a small subset of genes at any time

More information

Chapter 12. DNA TRANSCRIPTION and TRANSLATION

Chapter 12. DNA TRANSCRIPTION and TRANSLATION Chapter 12 DNA TRANSCRIPTION and TRANSLATION 12-3 RNA and Protein Synthesis WARM UP What are proteins? Where do they come from? From DNA to RNA to Protein DNA in our cells carry the instructions for making

More information

Classes of eukaryotic cellular RNAs

Classes of eukaryotic cellular RNAs Classes of eukaryotic cellular RNAs ribosomal RNA (rrna) 18S (small subunit) 28S (large subunit) 5.8S (large subunit) 5S (large subunit) transfer RNA (trna) messenger RNA (mrna) heterogeneous nuclear RNA

More information