CLASS 3.5: 03/29/07 EUKARYOTIC TRANSCRIPTION I: PROMOTERS AND ENHANCERS
|
|
- Noreen Jackson
- 6 years ago
- Views:
Transcription
1 CLASS 3.5: 03/29/07 EUKARYOTIC TRANSCRIPTION I: PROMOTERS AND ENHANCERS A. Promoters and Polymerases (RNA pols): 1. General characteristics - Initiation of transcription requires a. Transcription factors (TF) = - TFs may be proteins that: i. Recognize ii. Recognize iii. Recognize iv. Are incorporated b. Prokaryotic promoters - Recall that RNA pol binds - May need ancillary factors c. Eukaryotic promoters - Promoter is defined - These are recognized by - TFs required - RNA pol binds to startpoint, - RNA pol does not 1
2 d. Eukaryotic RNA polymerases - Divided into 3 classes i. RNA pol I = ii. RNA pol II = iii. RNA pol III = e. Enhancers - Promoter elements must - Enhancers = - Enhancers are often - Often are more densely - Proteins bound to enhancers - Difference between - Some sequence elements 2
3 2. Eukaryotic RNA Polymerases a. Have different locations in the cell i. Nucleolus = - site of ii. Nucleoplasm = - site for hnrna - site for iii. Mitochondria and chloroplasts - have - similar to b. Overall structure - Large - Each contains c. Specific subunits i. Some are homologous to ii. Some are iii. Carboxy-terminal domain (CTD) - found in - has Multiple repeats (26-50) of a consensus sequence = - CTD becomes 3
4 d. Sensitivity to poisons i. RNA pol II ii. RNA pol I iii. RNA pol III 3. Promoters for RNA pol I - Only 1 type of promoter - Makes most of the rrna - 5S rrna - RNA pol I exists as - Recruited as a. RNA Pol I promoter regions i. Core promoter - surrounds - most of region is - has conserved ii. Upstream promoter element (UPE) - extends from - also b. RNA Pol I ancillary factors i. Upstream Binding Factor (UBF) - needed for - binds - wraps DNA 360 so that 4
5 ii. SL1 - recruited to - responsible for ensuring that - has 4 subunits; 4. Promoters for RNA pol III a. Type of promoters i. Type 1 - has 2 short conserved sequences - TF III C and TF III A - TF III B (with positioning factor) - RNA pol - transcribes 5
6 ii. Type 2 - has 2 short conserved sequences - TF III C binds - TF III B (with positioning factor) - RNA pol - used to iii. Type III - found - look like - initiation can - initiation greatly increased by - used by 6
7 5. Promoters for RNA pol II - RNA pol II = - Basal factors (TF II X) = a. Core promoter - Shortest sequence in which - Minimum sequence needed - Functions only - Need additional factors - Components of the core promoter i. Startpoint - no - tendency for - called initiator sequence (InR) = ii. TATA box - located - core sequence = - TATA usually - TATA almost identical to - are some promoters 7
8 iii. DPE (downstream promoter element) - usually found - located - has - Core promoter either b. Core promoter binding proteins i. Positioning factor (TBP) - found in - TF II D has - TBP has saddle that - distorted TATA with TBP allows - in promoters without TATA, 8
9 ii. Basal apparatus binding factors - initiation requires - TF II A can - TF II B binds - TF II B determines - basal factor complex - RNA pol is now positioned, 9
10 iii. TF II H - TF II H has - TF II H associates - CTD tail must be a) clear promoter b) release some transcription factors c) recruit capping enzyme d) recruit SCAFs = e) recruit components of 10
11 - TFIIH has roles in - RNA pol stalls - RNA pol can use 11
12 iv. Activators - efficiency and specificity of how - activators are proteins - TATA sequence important for - activators influence the - types of activator sequences a) CAAT box - often - can be - can function b) GC box - often - consensus ~ - common to find - can be present - activator components of promoters have - no common element - fact that some can work in either direction suggests 12
13 B. Enhancers: 1. General characteristics - Promoters - Many cases activity of promoter - Characteristics distinguishing enhancers from promoters a. Position relative - promoters are - enhancer can be - can be b. Enhancers can - can be 2. Enhancer sequence elements - Tend to be - Many are - May differ from - Cooperative binding leads Example: binding of nonhistone protein (HMGI-Y) - Not like the mix and match promoters = - Proteins bound to enhancers - Create surface for 13
14 3. How enhancers work a. The distinction between i. Both have ability ii. Both are iii. Some are found iv. Some promoter elements b. Essential roles of enhancers - Increase the concentration of - Experiments have demonstrated that - Enhancer bound to proteins can - If close to 2 promoters, - Sometimes an insulator (DNA sequence that binds other proteins) can 14
15 4. CpG islands are regulatory targets a. General considerations - Recall that methylation of DNA - Methylation close to promoter - Demethylation would be required - CpG islands are - CpG islands are All housekeeping genes that are constitutively expressed Find CpG islands on b. Mechanisms by which CpG islands affect transcription i. Methylation for binding site of ii. Methylation may cause explains why active genes often 15
Chapter 24: Promoters and Enhancers
Chapter 24: Promoters and Enhancers A typical gene transcribed by RNA polymerase II has a promoter that usually extends upstream from the site where transcription is initiated the (#1) of transcription
More informationEukaryotic & Prokaryotic Transcription. RNA polymerases
Eukaryotic & Prokaryotic Transcription RNA polymerases RNA Polymerases A. E. coli RNA polymerase 1. core enzyme = ββ'(α)2 has catalytic activity but cannot recognize start site of transcription ~500,000
More informationTranscription. Manzur Ali PP, DBT,M.E.S College,Marampally
Transcription Manzur Ali PP, DBT,M.E.S College,Marampally manzursir@gmail.com RNA transcription is actively regulated Not all DNA is transcribed in a given cell (less than 50% even in prokaryotes) For
More informationTranscription in Eukaryotes
Transcription in Eukaryotes Biology I Hayder A Giha Transcription Transcription is a DNA-directed synthesis of RNA, which is the first step in gene expression. Gene expression, is transformation of the
More informationM1 - Biochemistry. Nucleic Acid Structure II/Transcription I
M1 - Biochemistry Nucleic Acid Structure II/Transcription I PH Ratz, PhD (Resources: Lehninger et al., 5th ed., Chapters 8, 24 & 26) 1 Nucleic Acid Structure II/Transcription I Learning Objectives: 1.
More informationSIBC504: TRANSCRIPTION & RNA PROCESSING Assistant Professor Dr. Chatchawan Srisawat
SIBC504: TRANSCRIPTION & RNA PROCESSING Assistant Professor Dr. Chatchawan Srisawat TRANSCRIPTION: AN OVERVIEW Transcription: the synthesis of a single-stranded RNA from a doublestranded DNA template.
More informationLecture 11. Initiation of RNA Pol II transcription. Transcription Initiation Complex
Lecture 11 *Eukaryotic Transcription Gene Organization RNA Processing 5 cap 3 polyadenylation splicing Translation Initiation of RNA Pol II transcription Consensus sequence of promoter TATA Transcription
More informationDNA Prokaryote Transcription Steps (updated February 2013)
URS AACTGT ATATTA - 35-10 transcription Pribnow Box discriminator +1 AGGAGGT TTA TCCTCCA ATT Gene C TGA TAG ACT ATC rho or GC hairpin loop transcription termination DNA Prokaryote Transcription Steps (updated
More informationGENETICS - CLUTCH CH.10 TRANSCRIPTION.
!! www.clutchprep.com CONCEPT: OVERVIEW OF TRANSCRIPTION Transcription is the process of using DNA as a template to RNA RNA polymerase is the enzyme that transcribes DNA - There are many different types
More informationChromatographic Separation of the three forms of RNA Polymerase II.
Chromatographic Separation of the three forms of RNA Polymerase II. α-amanitin α-amanitin bound to Pol II Function of the three enzymes. Yeast Pol II. RNA Polymerase Subunit Structures 10-7 Subunit structure.
More informationTranscription Eukaryotic Cells
Transcription Eukaryotic Cells Packet #20 1 Introduction Transcription is the process in which genetic information, stored in a strand of DNA (gene), is copied into a strand of RNA. Protein-encoding genes
More informationDifferential Gene Expression
Biology 4361 Developmental Biology Differential Gene Expression September 28, 2006 Chromatin Structure ~140 bp ~60 bp Transcriptional Regulation: 1. Packing prevents access CH 3 2. Acetylation ( C O )
More informationTRANSCRIPTION AND PROCESSING OF RNA
TRANSCRIPTION AND PROCESSING OF RNA 1. The steps of gene expression. 2. General characterization of transcription: steps, components of transcription apparatus. 3. Transcription of eukaryotic structural
More informationDNA Transcription. Dr Aliwaini
DNA Transcription 1 DNA Transcription-Introduction The synthesis of an RNA molecule from DNA is called Transcription. All eukaryotic cells have five major classes of RNA: ribosomal RNA (rrna), messenger
More informationChapter 17 Lecture. Concepts of Genetics. Tenth Edition. Regulation of Gene Expression in Eukaryotes
Chapter 17 Lecture Concepts of Genetics Tenth Edition Regulation of Gene Expression in Eukaryotes Chapter Contents 17.1 Eukaryotic Gene Regulation Can Occur at Any of the Steps Leading from DNA to Protein
More informationMechanisms of Transcription. School of Life Science Shandong University
Mechanisms of Transcription School of Life Science Shandong University Ch 12: Mechanisms of Transcription 1. RNA polymerase and the transcription cycle 2. The transcription cycle in bacteria 3. Transcription
More informationComputational Biology I LSM5191 (2003/4)
Computational Biology I LSM5191 (2003/4) Aylwin Ng, D.Phil Lecture Notes: Transcriptome: Molecular Biology of Gene Expression I Flow of information: DNA to polypeptide DNA Start Exon1 Intron Exon2 Termination
More informationTranscription. By : Lucia Dhiantika Witasari M.Biotech., Apt
Transcription By : Lucia Dhiantika Witasari M.Biotech., Apt REGULATION OF GENE EXPRESSION 11/26/2010 2 RNA Messenger RNAs (mrnas) encode the amino acid sequence of one or more polypeptides specified by
More informationBiochemistry Eukaryotic Transcription
1 Description of Module Subject Name Paper Name Module Name/Title Dr. Vijaya Khader Dr. MC Varadaraj 2 1. Objectives 1. Understand and have an overview of eucaryotic transcriptional regulation. 2. Explain
More informationChapter 11. Transcription. The biochemistry and molecular biology department of CMU
Chapter 11 Transcription The biochemistry and molecular biology department of CMU Transcription The synthesis of RNA molecules using DNA strands as the templates so that the genetic information can be
More informationClasses of eukaryotic cellular RNAs
Classes of eukaryotic cellular RNAs ribosomal RNA (rrna) 18S (small subunit) 28S (large subunit) 5.8S (large subunit) 5S (large subunit) transfer RNA (trna) messenger RNA (mrna) heterogeneous nuclear RNA
More informationTranscription & post transcriptional modification
Transcription & post transcriptional modification Transcription The synthesis of RNA molecules using DNA strands as the templates so that the genetic information can be transferred from DNA to RNA Similarity
More informationDifferential Gene Expression
Biology 4361 Developmental Biology Differential Gene Expression June 19, 2008 Differential Gene Expression Overview Chromatin structure Gene anatomy RNA processing and protein production Initiating transcription:
More informationChapter 6: Transcription and RNA Processing in Eukaryotes
3. Basic Genetics Plant Molecular Biology Chapter 6: Transcription and RNA Processing in Eukaryotes - Genetic organization in eukaryote - Transcription in eukaryote - - RNA processing in eukaryote - Translation
More informationBIO 311C Spring Lecture 36 Wednesday 28 Apr.
BIO 311C Spring 2010 1 Lecture 36 Wednesday 28 Apr. Synthesis of a Polypeptide Chain 5 direction of ribosome movement along the mrna 3 ribosome mrna NH 2 polypeptide chain direction of mrna movement through
More informationEukaryotic Transcription
Eukaryotic Transcription I. Differences between eukaryotic versus prokaryotic transcription. II. (core vs holoenzyme): RNA polymerase II - Promotor elements. - General Pol II transcription factors (GTF).
More informationFermentation. Lesson Overview. Lesson Overview 13.1 RNA
13.1 RNA THINK ABOUT IT DNA is the genetic material of cells. The sequence of nucleotide bases in the strands of DNA carries some sort of code. In order for that code to work, the cell must be able to
More informationGenomics and Gene Recognition Genes and Blue Genes
Genomics and Gene Recognition Genes and Blue Genes November 3, 2004 Eukaryotic Gene Structure eukaryotic genomes are considerably more complex than those of prokaryotes eukaryotic cells have organelles
More information(c) 2014 Dr. Alice Heicklen & Dr. Deborah Mowshowitz, Columbia University, New York, NY. Last update 02/26/ :57 PM
C2006/F2402 '14 OUTLINE OF LECTURE #11 (c) 2014 Dr. Alice Heicklen & Dr. Deborah Mowshowitz, Columbia University, New York, NY. Last update 02/26/2014 12:57 PM Handouts: 10C -- Typical Eukaryotic Gene,
More informationWe can now identify three major pathways of information flow in the cell (in replication, information passes from one DNA molecule to other DNA
1 We can now identify three major pathways of information flow in the cell (in replication, information passes from one DNA molecule to other DNA molecules; in transcription, information passes from DNA
More information3'A C G A C C A G T A A A 5'
AP Biology Chapter 14 Reading Guide Gene Expression: From Gene to Protein Overview 1. What is gene expression? Concept 14.1 Genes specify proteins via transcription and translation Basic Principles of
More informationTranscription Regulation And Gene Expression in Eukaryotes FS 2016 Graduate Course G2 P Matthias and RG Clerc Pharmazentrum Hörsaal 2 16h15-18h00
Transcription Regulation And Gene Expression in Eukaryotes FS 2016 Graduate Course G2 P Matthias and RG Clerc Pharmazentrum Hörsaal 2 16h15-18h00 The general problem RG Clerc March 2, 2016 RNA Transcription
More informationTranscription and Post Transcript Modification
Transcription and Post Transcript Modification You Should Be Able To 1. Describe transcription. 2. Compare and contrast eukaryotic + prokaryotic transcription. 3. Explain mrna processing in eukaryotes.
More informationTranscription factors
Atlas of Genetics and Cytogenetics in Oncology and Haematology Transcription factors I Introduction * II Initiation of transcription III Transcription factors family pdf version I Introduction III.1 Helix-Turn-Helix
More informationBIOCHEMISTRY REVIEW. Overview of Biomolecules. Chapter 12 Transcription
BIOCHEMISTRY REVIEW Overview of Biomolecules Chapter 12 Transcription 2 3 4 5 Are You Getting It?? Which are general characteristics of transcription? (multiple answers) a) An entire DNA molecule is transcribed
More information30 Gene expression: Transcription
30 Gene expression: Transcription Gene structure. o Exons coding region of DNA. o Introns non-coding region of DNA. o Introns are interspersed between exons of a single gene. o Promoter region helps enzymes
More informationDifferential Gene Expression
Developmental Biology Biology 4361 Differential Gene Expression October 13, 2005 core transcription initiation site 5 promoter 3 TATAT +1 upstream downstream Basal transcription factors (eukaryotes) TFIID
More informationBis2A 12.2 Eukaryotic Transcription
OpenStax-CNX module: m56061 1 Bis2A 12.2 Eukaryotic Transcription Mitch Singer Based on Eukaryotic Transcription by OpenStax College This work is produced by OpenStax-CNX and licensed under the Creative
More informationB. Incorrect! Centromeric DNA is largely heterochromatin, which is inactive DNA.
MCAT Biology - Problem Drill 06: Molecular Biology of Eukaryotes Question No. 1 of 10 1. Which type of DNA would have the highest level of expression? Question #01 (A) Heterochromatin. (B) Centromeric
More informationTranscription is the first stage of gene expression
Transcription is the first stage of gene expression RNA synthesis is catalyzed by RNA polymerase, which pries the DNA strands apart and hooks together the RNA nucleotides The RNA is complementary to the
More informationTRANSCRIPTION COMPARISON OF DNA & RNA TRANSCRIPTION. Umm AL Qura University. Sugar Ribose Deoxyribose. Bases AUCG ATCG. Strand length Short Long
Umm AL Qura University TRANSCRIPTION Dr Neda Bogari TRANSCRIPTION COMPARISON OF DNA & RNA RNA DNA Sugar Ribose Deoxyribose Bases AUCG ATCG Strand length Short Long No. strands One Two Helix Single Double
More informationGene Expression: Transcription, Translation, RNAs and the Genetic Code
Lecture 28-29 Gene Expression: Transcription, Translation, RNAs and the Genetic Code Central dogma of molecular biology During transcription, the information in a DNA sequence (a gene) is copied into a
More informationLecture Summary: Regulation of transcription. General mechanisms-what are the major regulatory points?
BCH 401G Lecture 37 Andres Lecture Summary: Regulation of transcription. General mechanisms-what are the major regulatory points? RNA processing: Capping, polyadenylation, splicing. Why process mammalian
More informationChapter 3. DNA, RNA, and Protein Synthesis
Chapter 3. DNA, RNA, and Protein Synthesis 4. Transcription Gene Expression Regulatory region (promoter) 5 flanking region Upstream region Coding region 3 flanking region Downstream region Transcription
More informationThe RNA Polymerase II General Transcription Machinery Prof. Michael Hampsey
The RNA Polymerase II General Transcription Machinery Michael Hampsey, PhD Robert Wood Johnson Medical School Piscataway, New Jersey 1 Central Dogma of Molecular Biology DNA Stores genetic information
More informationHowever, only a fraction of these genes are transcribed in an individual cell at any given time.
All cells in an organism contain the same set of genes. However, only a fraction of these genes are transcribed in an individual cell at any given time. It is the pattern of gene expression that determines
More informationChapter 13. The Nucleus. The nucleus is the hallmark of eukaryotic cells; the very term eukaryotic means having a "true nucleus".
Chapter 13 The Nucleus The nucleus is the hallmark of eukaryotic cells; the very term eukaryotic means having a "true nucleus". Fig.13.1. The EM of the Nucleus of a Eukaryotic Cell 13.1. The Nuclear Envelope
More informationProofreading, post-replication modification of DNA. Mitesh Shrestha
Proofreading, post-replication modification of DNA Mitesh Shrestha Proofreading During DNA replication (copying), most DNA polymerases can check their work with each base that they add. This process is
More informationChapter 31. Transcription and RNA processing
Chapter 31 Transcription and RNA processing RNA polymerase (RNAP) E. coli promoters Components of E. coli RNA Polymerase Holoenzyme (α 2 ββ'ωσ) Structure of prokaryotic RNAP The closed and open state of
More informationBiological information flow
BCMB 3100 Chapters 36-38 Transcription & RNA Processing Definition of gene RNA Polymerase Gene coding vs template strand Promoter Transcription in E. coli Transcription factors mrna processing Biological
More informationMolecular Biology (BIOL 4320) Exam #1 March 12, 2002
Molecular Biology (BIOL 4320) Exam #1 March 12, 2002 Name KEY SS# This exam is worth a total of 100 points. The number of points each question is worth is shown in parentheses after the question number.
More informationProtein Synthesis Notes
Protein Synthesis Notes Protein Synthesis: Overview Transcription: synthesis of mrna under the direction of DNA. Translation: actual synthesis of a polypeptide under the direction of mrna. Transcription
More informationExpression of the genome. Books: 1. Molecular biology of the gene: Watson et al 2. Genetics: Peter J. Russell
Expression of the genome Books: 1. Molecular biology of the gene: Watson et al 2. Genetics: Peter J. Russell 1 Transcription 1. Francis Crick (1956) named the flow of information from DNA RNA protein the
More informationTranscription steps. Transcription steps. Eukaryote RNA processing
Transcription steps Initiation at 5 end of gene binding of RNA polymerase to promoter unwinding of DNA Elongation addition of nucleotides to 3 end rules of base pairing requires Mg 2+ energy from NTP substrates
More informationComplex Transcription Machinery
Complex Transcription Machinery Subunits of the Basal Txn Apparatus Stepwise Assembly of the Pre-initiation Complex Interplay of Activators, Co-regulators and RNA Polymerase at the Promoter Divide and
More informationChapter 3 Gene Function. Transcription Prokaroyotes Eukaryotes Transcript processing Proteins Translation Genetic nomenclature
Chapter 3 Gene Function Transcription Prokaroyotes Eukaryotes Transcript processing Proteins Translation Genetic nomenclature Transcription RNA composition ATP, GTP, UTP, CTP are substrates for RNA polymerase.
More informationTranscription. The sugar molecule found in RNA is ribose, rather than the deoxyribose found in DNA.
Transcription RNA (ribonucleic acid) is a key intermediary between a DNA sequence and a polypeptide. RNA is an informational polynucleotide similar to DNA, but it differs from DNA in three ways: RNA generally
More informationDifferential Gene Expression
Biology 4361 - Developmental Biology Differential Gene Expression June 18, 2009 Differential Gene Expression Overview Chromatin structure Gene anatomy RNA processing and protein production Initiating transcription:
More informationMolecular Cell Biology - Problem Drill 09: Gene Expression in Prokaryotes
Molecular Cell Biology - Problem Drill 09: Gene Expression in Prokaryotes Question No. 1 of 10 1. Which of the following statements about gene expression in prokaryotes is correct? Question #1 (A) In prokaryotes,
More informationSection C: The Control of Gene Expression
Section C: The Control of Gene Expression 1. Each cell of a multicellular eukaryote expresses only a small fraction of its genes 2. The control of gene expression can occur at any step in the pathway from
More informationBIOLOGY - CLUTCH CH.17 - GENE EXPRESSION.
!! www.clutchprep.com CONCEPT: GENES Beadle and Tatum develop the one gene one enzyme hypothesis through their work with Neurospora (bread mold). This idea was later revised as the one gene one polypeptide
More informationNucleotide Entry Port. Scaffold Subunits. Polymerase Activity β Sliding Clamp. Clamp Loader. Promoter Recognition
Nucleotide Entry ort α (2) Scaffold Subunits olymerase Activity Sliding Clamp σ Clamp Loader romoter Recognition -35-10 NNAAA AA T A TTTTNNAAAANNN TT T N N17 N6 α α α α α α α α α α α α α α +1 α α α α Subunit
More informationLecture 21 Regulation of transcription
Lecture 21 Regulation of transcription Key learning goals: Understand what a promoter sequence is Understand the role of sigma factors in prokaryotic RNAP initiation Understand what an open complex is,
More informationRNA POLYMERASE FUNCTIONS E-BOOK
08 March, 2018 RNA POLYMERASE 1 2 3 FUNCTIONS E-BOOK Document Filetype: PDF 431.06 KB 0 RNA POLYMERASE 1 2 3 FUNCTIONS E-BOOK It catalyzes the transcription of DNA to synthesize precursors of mrna and
More informationRNA Metabolism Chap 26, part I
RNA Metabolism Chap 26, part I mrna (selective and regulated) trna rrna other (specialized) RNAs (eukaryotes!!!) processing transcriptome (Surprisingly, much of your genome is transcribed!) RNA is the
More informationEukaryotic Gene Structure
Eukaryotic Gene Structure Terminology Genome entire genetic material of an individual Transcriptome set of transcribed sequences Proteome set of proteins encoded by the genome 2 Gene Basic physical and
More informationTranscription in Prokaryotes. Jörg Bungert, PhD Phone:
Transcription in Prokaryotes Jörg Bungert, PhD Phone: 352-273-8098 Email: jbungert@ufl.edu Objectives Understand the basic mechanism of transcription. Know the function of promoter elements and associating
More informationBiological information flow
BCMB 3100 Chapters 36-38 Transcription & RNA Processing Definition of gene RNA Polymerase Gene coding vs template strand Promoter Transcription in E. coli Transcription factors mrna processing Biological
More informationControl of Eukaryotic Genes. AP Biology
Control of Eukaryotic Genes The BIG Questions How are genes turned on & off in eukaryotes? How do cells with the same genes differentiate to perform completely different, specialized functions? Evolution
More informationLesson Overview. Fermentation 13.1 RNA
13.1 RNA The Role of RNA Genes contain coded DNA instructions that tell cells how to build proteins. The first step in decoding these genetic instructions is to copy part of the base sequence from DNA
More informationCELL BIOLOGY - CLUTCH CH. 7 - GENE EXPRESSION.
!! www.clutchprep.com CONCEPT: CONTROL OF GENE EXPRESSION BASICS Gene expression is the process through which cells selectively to express some genes and not others Every cell in an organism is a clone
More informationThe Genetic Code and Transcription. Chapter 12 Honors Genetics Ms. Susan Chabot
The Genetic Code and Transcription Chapter 12 Honors Genetics Ms. Susan Chabot TRANSCRIPTION Copy SAME language DNA to RNA Nucleic Acid to Nucleic Acid TRANSLATION Copy DIFFERENT language RNA to Amino
More informationThe 5' cap (red) is added before synthesis of the primary transcript is complete. A non coding sequence following the last exon is shown in orange.
RNA PROCESSING The 5' cap (red) is added before synthesis of the primary transcript is complete. A non coding sequence following the last exon is shown in orange. Splicing can occur either before or after
More informationThe Structure of RNA. The Central Dogma
12-3 12-3 RNA and Protein Synthesis The Structure of RNA The Central Dogma Phenotype A gene is a SEQUENCE of DNA that codes for a protein (or functional RNA). Phenotype is the individual s observable trait
More informationIN E. COLI WHAT IS THE FUNCTION OF DNA POLYMERASE III
10 January, 2018 IN E. COLI WHAT IS THE FUNCTION OF DNA POLYMERASE III Document Filetype: PDF 312 KB 0 IN E. COLI WHAT IS THE FUNCTION OF DNA POLYMERASE III The actual replication enzyme in E. Both will
More informationThe gene. Fig. 1. The general structure of gene
The gene is the basic unit of heredity and carries the genetic information for a given protein and/or RNA molecule. In biochemical terms a gene represents a fragment of deoxyribonucleic acid (DNA), which
More informationCHAPTERS , 17: Eukaryotic Genetics
CHAPTERS 14.1 14.6, 17: Eukaryotic Genetics 1. Review the levels of DNA packing within the eukaryote nucleus. Label each level. (A similar diagram is on pg 188 of your textbook.) 2. How do the coding regions
More informationFig Ch 17: From Gene to Protein
Fig. 17-1 Ch 17: From Gene to Protein Basic Principles of Transcription and Translation RNA is the intermediate between genes and the proteins for which they code Transcription is the synthesis of RNA
More informationVideos. Lesson Overview. Fermentation
Lesson Overview Fermentation Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast
More informationMake the protein through the genetic dogma process.
Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino
More informationI. Gene Expression Figure 1: Central Dogma of Molecular Biology
I. Gene Expression Figure 1: Central Dogma of Molecular Biology Central Dogma: Gene Expression: RNA Structure RNA nucleotides contain the pentose sugar Ribose instead of deoxyribose. Contain the bases
More informationChapter 13. From DNA to Protein
Chapter 13 From DNA to Protein Proteins All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequenceof a gene The Path From Genes to
More informationThemes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important!
Themes: RNA is very versatile! RNA and RNA Processing Chapter 14 RNA-RNA interactions are very important! Prokaryotes and Eukaryotes have many important differences. Messenger RNA (mrna) Carries genetic
More informationBiological information flow
BCMB 3100 Chapters 36-38 Transcription & RNA Processing Biological information flow Definition of gene RNA Polymerase Gene coding vs template strand Promoter Transcription in E. coli Transcription factors
More informationBEADLE & TATUM EXPERIMENT
FROM DNA TO PROTEINS: gene expression Chapter 14 LECTURE OBJECTIVES What Is the Evidence that Genes Code for Proteins? How Does Information Flow from Genes to Proteins? How Is the Information Content in
More informationGene Regulation Biology
Gene Regulation Biology Potential and Limitations of Cell Re-programming in Cancer Research Eric Blanc KCL April 13, 2010 Eric Blanc (KCL) Gene Regulation Biology April 13, 2010 1 / 21 Outline 1 The Central
More informationGene Expression and Heritable Phenotype. CBS520 Eric Nabity
Gene Expression and Heritable Phenotype CBS520 Eric Nabity DNA is Just the Beginning DNA was determined to be the genetic material, and the structure was identified as a (double stranded) double helix.
More informationDNA. Is a molecule that encodes the genetic instructions used in the development and functioning of all known living organisms and many viruses.
Is a molecule that encodes the genetic instructions used in the development and functioning of all known living organisms and many viruses. Genetic information is encoded as a sequence of nucleotides (guanine,
More informationChapter 17. From Gene to Protein
Chapter 17 From Gene to Protein One Gene One Enzyme Hypothesis Archibald Garrod 1 st to suggest that genes dictate phenotypes through enzymes that catalyze specific chemical reactions ; alkaptonuria Beadle
More informationFROM GENE TO PROTEIN. One Gene One Enzyme Hypothesis 3/12/2013. Basic Principles of Transcription & Translation
One Gene One Enzyme Hypothesis FROM GENE TO PROTEIN C H A P T E R 1 7 Archibald Garrod 1 st to suggest that genes dictate phenotypes through enzymes that catalyze specific chemical reactions ; alkaptonuria
More informationMolecular Cell Biology - Problem Drill 08: Transcription, Translation and the Genetic Code
Molecular Cell Biology - Problem Drill 08: Transcription, Translation and the Genetic Code Question No. 1 of 10 1. Which of the following statements about how genes function is correct? Question #1 (A)
More informationWednesday, November 22, 17. Exons and Introns
Exons and Introns Introns and Exons Exons: coded regions of DNA that get transcribed and translated into proteins make up 5% of the genome Introns and Exons Introns: non-coded regions of DNA Must be removed
More informationDIFFERENT ASPECTS OF GENE REGULATION
TARTU UNIVERSITY FACULTY OF BILOGY AND GEOGRAPHY DIFFERENT ASPECTS OF GENE REGULATION TARTU 2005 Sten Ilmjärv 2 TABLE OF CONTENT TABLE OF CONTENT...2 GLOSSARY...3 INTRODUCTION...4 1. THE GENE...5 2. GENE
More informationVideos. Bozeman Transcription and Translation: Drawing transcription and translation:
Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast RNA and DNA. 29b) I can explain
More informationChapter 17. From Gene to Protein. AP Biology
Chapter 17. From Gene to Protein Metabolism teaches us about genes Metabolic defects studying metabolic diseases suggested that genes specified proteins alkaptonuria (black urine from alkapton) PKU (phenylketonuria)
More informationBranches of Genetics
Branches of Genetics 1. Transmission genetics Classical genetics or Mendelian genetics 2. Molecular genetics chromosomes, DNA, regulation of gene expression recombinant DNA, biotechnology, bioinformatics,
More informationStructure/function relationship in DNA-binding proteins
PHRM 836 September 22, 2015 Structure/function relationship in DNA-binding proteins Devlin Chapter 8.8-9 u General description of transcription factors (TFs) u Sequence-specific interactions between DNA
More informationTranscription: Synthesis of RNA
Transcription: Synthesis of RNA The flow of information in the cells (the central dogma of molecular biology): Transcription = RNA synthesis on a DNA template. The mrna will provide the information for
More informationDegenerate site - twofold degenerate site - fourfold degenerate site
Genetic code Codon: triple base pairs defining each amino acid. Why genetic code is triple? double code represents 4 2 = 16 different information triple code: 4 3 = 64 (two much to represent 20 amino acids)
More informationRNA metabolism. DNA dependent synthesis of RNA RNA processing RNA dependent synthesis of RNA and DNA.
RNA metabolism DNA dependent synthesis of RNA RNA processing RNA dependent synthesis of RNA and DNA http://www.youtube.com/watch?v=ovc8nxobxmq DNA dependent synthesis of RNA : production of an RNA molecule
More information