Title: Functional analysis of the novel TBX5 c.1333delc mutation resulting in an extended TBX5 protein
|
|
- Gertrude Melton
- 6 years ago
- Views:
Transcription
1 Author's response to reviews Title: Functional analysis of the novel TBX5 c.1333delc mutation resulting in an extended TBX5 protein Authors: Johann Bohm Wolfram Heinritz Mihailo Vujic Britt-Marie Ekman-Joelsson Juergen Kohlhase Ursula Froster Version: 2 Date: 21 April 2008 Author's response to reviews: see over
2 BMC Medical Genetics Illkirch, 21st of April, 2008 MS: Functional analysis of the novel TBX5 c.1333delc mutation resulting in an extended TBX5 protein Dear Madam, Dear Sir, thank your for considering our manuscript for publication in BMC Medical Genetics. We have carefully read the reviewers reports and we would like to respond to the concerns. Reviewer Malcolm Logan 1) p9 In transfection experiments the tagged proteins are visible as dot-like structures in the nucleus. While the co-localization with SALL4 looks convincing, is it true to say this shows the distribution corresponds to its location of biological function. We are looking at overexpression here in a (kidney-derived) tissue culture cell. This cell line does not represent an endogenous environment. It has not been shown how appropriate or otherwise this cell line is to analyze Tbx5 localisation/activity. I think statements regarding positional determination could be removed. We agree with Mr. Logan. The cell culture model used for our experiments does not represent an in vivo study. It is therefore speculative to talk about positional determination biological role of overexpressed proteins in COS7 cells. However, Fan et al. (2003) and others have used this procedure to analyze the impact of TBX5 mutations. Nevertheless we have replaced positional determination by intranuclear distribution 2) p12 Altered protein configuration or stearic hindrance effects on NLS are not directly tested. We agree with Mister Logan. Indeed Fan et al. (2003b) compared the predicted structure of TBX5 mutants to wild-type TBX5 by creating a model of the DNA-binding domain of TBX5 based on the crystal structure of TBX3. However, Fan and colleagues tested missense mutations within the DNA-binding domain. The mutation described in our manuscript is completely different. It would be highly speculative to predict the influence of the additional amino acids on the structure of the protein. By testing the nuclear localization we can assume that the gross protein structure is conserved and that the NLS is apparently not masked. However, we modified the sentence to clarify this point:
3 It is conceivable that an altered protein configuration or steric hindrance may silence the activity of the NLS motifs. We therefore wanted to analyze the intracellular distribution of the mutated TBX5 protein 3) p10 the mutation..abrogates activation of the ANF promoter p11. was severely affected as compared to wild-type. The mutant form of the protein is completely dead in the luciferase assay. We agree with Mister Logan. This sentence has been corrected in the manuscript to was not functional as compared to the wild type protein 4) Minor points It could be helpful to have a diagram to show the site of and how this missense mutation is predicted to lead to the addition of additional residues. We have added a diagram as supplementary figure p9 The functional domain of TBX5 is a T-Box motif. Surely this refers to just one of the functional domains of the protein. We agree with Mister Logan. This sentence has been corrected to An important functional domain of TBX5 is the T-Box motif p12 prolonged protein. change to elongated We have replaced prolonged by elongated. p12 For specific organs like heart and upper limbs, the nuclear localization of TBX5 during development is essential. Since Tbx5 is a transcription factor its nuclear localization will be essential wherever the protein is required to act as a transcription factor. We agree with Mister Logan. This sentence has been replaced by For the development of specific organs like heart and upper limbs, TBX5 is an essential transcription factor. P11.It is not clear what p.h445fsx136 refers to p = protein, H445 = histidine 445, fs = frameshift, X136 = additional 136 amino acids. We have put the abbreviation in brackets. It might now be clear that is refers to c1333delc. Reviewer Benoit Bruneau 1) while the mutant TBX5 plasmid does not activate ANF under the single condition tested, a range of amounts of transfected plasmid should be attempted to indicate if this is simply a dosage effect.
4 We agree with Mister Bruneau. We have therefore tested the activation of the ANF promoter by rising amounts of the TBX5wt and TBXmut constructs. We do not observe any change in luciferase activity. A dosage effect can therefore be ruled out. We have added this observation in the manuscript: An increased amount of transfected TBX5mut plasmid did not induce luciferase activity, ruling out a dosage effect. 2) transactivation with partners of Tbx5, including Nkx2-5, Gata4, and Sall4 (and combinations of these) should be performed to determine if this mutation affects thee interactions. And 3) Co-immunoprecipitations between TBX5 and the above-mentioned factors should be done to determine if the elongated protein can still associate with these partner proteins. We partially agree with Mister Bruneau. Indeed, it would be interesting to analyze the detailed characteristics of the elongated TBX5 protein including co-immunoprecipitations and transactivation of the ANF promoter with known interaction partners. It would also be interesting to test the activation of the known target gene FGF10. We have carried out the transactivation experiments with SALL4. We do not see any difference between wild type and mutated TBX5, suggesting that the interaction of SALL4 and TBX5 is not affected by the mutation. We did not include these results in the manuscript as other transactivation and interaction experiments (as proposed by Mister Bruneau) would be necessary. However, these experiments are very time-consuming and would go beyond the scope of this project. We have identified an unusual mutation in a patient with classical Holt-Oram syndrome. As the frameshift mutation presumably encompasses NMD, we assume that the protein is present and we speculate that it is somehow misfolded. Therefore the experiments we carried out are straight forward and sufficient with respect to our aim: we clearly show a loss of function of the elongated protein. 4) Minor points Reference #1: the word "corrected" is not part of the title, but indicates that the title was corrected from a previously incorrect title; please remove this word. The reference has been corrected. Reference to the T-box sites in the ANF promoter should include Bruneau et al 2001, in which the functionality of three such sites was demonstrated. We have included this reference.
5 Reviewer Philippe Debeer An extra figure with an XRay and/or clinical pictures would be interesting for readers who are not familiar with the syndrome. We have added an X-Ray and a clinical picture of the patient (fig 1). Additional comments 1) The experiments proposed by the reviewers were performed in cooperation with the PhD student Alexander Craig at the Institute of Human Genetics in Freiburg, Germany. Please note the modified authors list. 2) All experiments have been carried out in the cell culture model. Therefore we do not have a specific approval of an ethics committee. However, all kind of cell culture experiments with the cells mentioned in the manuscript have generally been approved by the ethics committee of the Freiburg University. 3) We have obtained informed consent including publication of the case report. For any questions please contact Britt-Marie Ekman-Joelsson or Wolfram Heinritz. 4) We have modified the manuscript style in accordance to the example shown on We are highly interested in publishing our manuscript in BMC Medical Genetics and we would be pleased to hear that our comments and corrections meet the journal s and the reviewers expectations. If you have any further queries please do not hesitate to contact us. Best regards, Johann Böhm
The Two-Hybrid System
Encyclopedic Reference of Genomics and Proteomics in Molecular Medicine The Two-Hybrid System Carolina Vollert & Peter Uetz Institut für Genetik Forschungszentrum Karlsruhe PO Box 3640 D-76021 Karlsruhe
More informationIn addition, 10 reference probes are included in this probemix, detecting several different autosomal chromosomal locations.
SALSA MLPA probemix P179-B1 Limb Malformations-1 Lot B1-1014, B1-0611. As compared to the previous lot A2 (lot A2-0311), one GLI3 and three ROR2 probes have been replaced. Four extra GLI3 probes and one
More information12 Interaction of Genes
12 Interaction of Genes Yeast genetics has been particularly amenable for identifying and characterizing gene products that directly or indirectly interact with each other, especially when two mutations
More informationActivation of a Floral Homeotic Gene in Arabidopsis
Activation of a Floral Homeotic Gene in Arabidopsis Busch, M.A., Bomblies, K., Weigel, D. kuleuven-kortrijk.be Simon Olthof Louie Christodoulidis 1 In Arabidopsis flowers, appearance is based, in part,
More informationFIGURE LEGENDS, ONLINE SUPPLEMENT
Online Supplement: Sierra O and Towler DA: Runx2 Transactivation Mediated by MINT, the Msx2- Interacting Nuclear Target, Requires Homeodomain Interacting Protein Kinase 3 ME-10-0029_v2 FIGURE LEGENDS,
More informationBiol 321 Spring 2013 Quiz 4 25 pts NAME
Biol 321 Spring 2013 Quiz 4 25 pts NAME 1. (3 pts.) a. What is the name of this compound? BE EXPLICIT deoxyribose 5 b. Number the carbons on this structure: 4 1 3 2 2. (4 pts.) Circle True or False. If
More informationProtein Synthesis: From Gene RNA Protein Trait
Protein Synthesis: From Gene RNA Protein Trait Human Genome The human genome contains about genes. Each gene is a of DNA (sequence of nitrogen bases) contained within each chromosome. Each chromosome contains
More informationSupplementary Materials for
advances.sciencemag.org/cgi/content/full/4/9/eaat5401/dc1 Supplementary Materials for GLK-IKKβ signaling induces dimerization and translocation of the AhR-RORγt complex in IL-17A induction and autoimmune
More informationBundle 5 Test Review
Bundle 5 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? _Nucleic
More informationNature Structural & Molecular Biology: doi: /nsmb.1583
Acetylation by GCN5 regulates CDC6 phosphorylation in the S-phase of the cell cycle Roberta Paolinelli 1,2, Ramiro Mendoza-Maldonado 2, Anna Cereseto 1 and Mauro Giacca 2 1 Molecular Biology Laboratory,
More informationNature Methods: doi: /nmeth Supplementary Figure 1. Schematics of SAM, dcas9-suntag and dcas9-vpr.
Supplementary Figure 1 Schematics of SAM, dcas9-suntag and dcas9-vpr. (a) Schematics of SAM. SAM consists of two chimeric proteins, dcas9 fused with VP64 and MS2-coat protein fused with p65 and HSF1 activator
More informationMOLECULAR BIOLOGY OF EUKARYOTES 2016 SYLLABUS
03-442 Lectures: MWF 9:30-10:20 a.m. Doherty Hall 2105 03-742 Advanced Discussion Section: Time and place to be announced Probably Mon 4-6 p.m. or 6-8p.m.? Once we establish who is taking the advanced
More information8/21/2014. From Gene to Protein
From Gene to Protein Chapter 17 Objectives Describe the contributions made by Garrod, Beadle, and Tatum to our understanding of the relationship between genes and enzymes Briefly explain how information
More informationRayBio Human GATA-3 Transcription Factor Activity Assay Kit
RayBio Human GATA-3 Transcription Factor Activity Assay Kit Catalog #: TFEH-GATA3 User Manual Mar 13, 2017 3607 Parkway Lane, Suite 200 Norcross, GA 30092 Tel: 1-888-494-8555 (Toll Free) or 770-729-2992,
More informationMethods and Materials
SUMMARY OF PH.D. THESIS Molecular biological and genetic study of the sumoylation of Drosophila melanogaster p53 Pardi Norbert Supervisor: Dr. Boros Imre Doctoral School of Biology University of Szeged
More informationAdditional Practice Problems for Reading Period
BS 50 Genetics and Genomics Reading Period Additional Practice Problems for Reading Period Question 1. In patients with a particular type of leukemia, their leukemic B lymphocytes display a translocation
More informationCell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan).
1 2 3 4 5 6 7 8 Supplemental Materials and Methods Cell proliferation assay Cell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan). GCs were plated at 96-well
More informationtranscription and the promoter occupancy of Smad proteins. (A) HepG2 cells were co-transfected with the wwp-luc reporter, and FLAG-tagged FHL1,
Supplementary Data Supplementary Figure Legends Supplementary Figure 1 FHL-mediated TGFβ-responsive reporter transcription and the promoter occupancy of Smad proteins. (A) HepG2 cells were co-transfected
More informationChimp Sequence Annotation: Region 2_3
Chimp Sequence Annotation: Region 2_3 Jeff Howenstein March 30, 2007 BIO434W Genomics 1 Introduction We received region 2_3 of the ChimpChunk sequence, and the first step we performed was to run RepeatMasker
More informationTITLE: Elucidating Mechanisms of Farnesyltransferase Inhibitor Action and Resistance in Breast Cancer by Bioluminescence Imaging
AD Award Number: W81XWH-07-1-0426 TITLE: Elucidating Mechanisms of Farnesyltransferase Inhibitor Action and Resistance in Breast Cancer by Bioluminescence Imaging PRINCIPAL INVESTIGATOR: David Piwnica-Worms,
More informationMolecular Genetics of Disease and the Human Genome Project
9 Molecular Genetics of Disease and the Human Genome Project Fig. 1. The 23 chromosomes in the human genome. There are 22 autosomes (chromosomes 1 to 22) and two sex chromosomes (X and Y). Females inherit
More informationMCB 102 University of California, Berkeley August 11 13, Problem Set 8
MCB 102 University of California, Berkeley August 11 13, 2009 Isabelle Philipp Handout Problem Set 8 The answer key will be posted by Tuesday August 11. Try to solve the problem sets always first without
More informationPeer Review Report for /tpc
The Transcription Factors TCP4 and PIF3 Antagonistically Regulate Organ-specific Light Induction of SAUR Genes to Modulate Cotyledon Opening During De-etiolation in Arabidopsis Jie Dong, Ning Sun, Jing
More informationSarker et al. Supplementary Material. Subcellular Fractionation
Supplementary Material Subcellular Fractionation Transfected 293T cells were harvested with phosphate buffered saline (PBS) and centrifuged at 2000 rpm (500g) for 3 min. The pellet was washed, re-centrifuged
More informationWhat is a chromosome and where is it located and what does it
What is a chromosome and where is it located and what does it do? A general overview for neophytes A chromosome is one of the components of the cell inside the nucleus which codes for proteins and controls
More informationBIOLOGY 205 Midterm II - 19 February Each of the following statements are correct regarding Eukaryotic genes and genomes EXCEPT?
BIOLOGY 205 Midterm II - 19 February 1999 Name Multiple choice questions 4 points each (Best 12 out of 13). 1. Each of the following statements are correct regarding Eukaryotic genes and genomes EXCEPT?
More informationDNA RNA Protein Trait Protein Synthesis (Gene Expression) Notes Proteins (Review) Proteins make up all living materials
DNA RNA Protein Trait Protein Synthesis (Gene Expression) Notes Proteins (Review) Proteins make up all living materials Proteins are composed of amino acids there are 20 different amino acids Different
More informationASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG
Supplemental Materials and Methods Plasmids: the following plasmids were used in the supplementary data: pwzl-myc- Lats2 (Aylon et al, 2006), pretrosuper-vector and pretrosuper-shp53 (generous gift of
More informationMammalian EGF receptor activation by the rhomboid protease RHBDL2
Manuscript EMBOR-2011-34771 Mammalian EGF receptor activation by the rhomboid protease RHBDL2 Colin Adrain, Kvido Strisovsky, Markus Zettl, Landian Hu, Marius K. Lemberg, Matthew Freeman Corresponding
More information3.1 The Role of the Enzymatic Activity of Sir2 for Efficient. The Sir proteins are recruited to DNA by site-specific DNA-binding proteins and
35 3 RESULTS 3.1 The Role of the Enzymatic Activity of Sir2 for Efficient Association of the SIR Complex with DNA The Sir proteins are recruited to DNA by site-specific DNA-binding proteins and subsequently
More informationActivation of a Floral Homeotic Gene in Arabidopsis
Activation of a Floral Homeotic Gene in Arabidopsis By Maximiliam A. Busch, Kirsten Bomblies, and Detlef Weigel Presentation by Lis Garrett and Andrea Stevenson http://ucsdnews.ucsd.edu/archive/graphics/images/image5.jpg
More informationSupplementary Information
Supplementary Information Sam68 modulates the promoter specificity of NF-κB and mediates expression of CD25 in activated T cells Kai Fu 1, 6, Xin Sun 1, 6, Wenxin Zheng 1, 6, Eric M. Wier 1, Andrea Hodgson
More informationsupplementary information
DOI: 10.1038/ncb2116 Figure S1 CDK phosphorylation of EZH2 in cells. (a) Comparison of candidate CDK phosphorylation sites on EZH2 with known CDK substrates by multiple sequence alignments. (b) CDK1 and
More informationFigure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or
Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or absence of the acetyltransferase CBP and acetylated TDP-43
More informationSupplementary Figure 1 Collision-induced dissociation (CID) mass spectra of peptides from PPK1, PPK2, PPK3 and PPK4 respectively.
Supplementary Figure 1 lision-induced dissociation (CID) mass spectra of peptides from PPK1, PPK, PPK3 and PPK respectively. % of nuclei with signal / field a 5 c ppif3:gus pppk1:gus 0 35 30 5 0 15 10
More information4/3/2013. DNA Synthesis Replication of Bacterial DNA Replication of Bacterial DNA
4/3/03 3 4 5 6 7 8 9 0 Chapter 8 Microbial Genetics Terminology Genetics: The study of what genes are, how they carry information, how information is expressed, and how genes are replicated Gene: A segment
More informationSUPPLEMENTARY INFORMATION
doi:.38/nature899 Supplementary Figure Suzuki et al. a c p7 -/- / WT ratio (+)/(-) p7 -/- / WT ratio Log X 3. Fold change by treatment ( (+)/(-)) Log X.5 3-3. -. b Fold change by treatment ( (+)/(-)) 8
More informationSupplementary data. sienigma. F-Enigma F-EnigmaSM. a-p53
Supplementary data Supplemental Figure 1 A sienigma #2 sienigma sicontrol a-enigma - + ++ - - - - - - + ++ - - - - - - ++ B sienigma F-Enigma F-EnigmaSM a-flag HLK3 cells - - - + ++ + ++ - + - + + - -
More information7.012 Exam Two KEY
7.012 Exam wo KEY -- 2006 Exam starts at 10:05 am and ends at 10:55 am. here are 9 pages including this cover page & the genetic code. Please write your name on each page. Only writing on the FRON of every
More informationImpact of Retinoic acid induced-1 (Rai1) on Regulators of Metabolism and Adipogenesis
Impact of Retinoic acid induced-1 (Rai1) on Regulators of Metabolism and Adipogenesis The mammalian system undergoes ~24 hour cycles known as circadian rhythms that temporally orchestrate metabolism, behavior,
More informationProtein Synthesis ~Biology AP~
Protein Synthesis ~Biology AP~ A Meridian Study Guide by David Guan, Jennifer Zheng [Edited by Lei Gong] Introduction: - DNA and RNA are essential for life because they code for enzymes, which regulate
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3240 Supplementary Figure 1 GBM cell lines display similar levels of p100 to p52 processing but respond differentially to TWEAK-induced TERT expression according to TERT promoter mutation
More informationBiol 321 Winter 2010 Take-home Assignment aka Quiz #4 40 pts total
Biol 321 Winter 2010 Take-home Assignment aka Quiz #4 40 pts total This assignment is due on Friday Feb 26 at 8:30am. No assignments will be accepted after this deadline Please read carefully through this
More informationYour first goal is to determine the order of assembly of the 3 DNA polymerases during initiation.
MIT Department of Biology 7.28, Spring 2005 - Molecular Biology 1 Question 1 You are studying the mechanism of DNA polymerase loading at eukaryotic DNA replication origins. Unlike the situation in bacteria,
More information7.012 Problem Set 5. Question 1
Name Section 7.012 Problem Set 5 Question 1 While studying the problem of infertility, you attempt to isolate a hypothetical rabbit gene that accounts for the prolific reproduction of rabbits. After much
More informationPractice Problems 5. Location of LSA-GFP fluorescence
Life Sciences 1a Practice Problems 5 1. Soluble proteins that are normally secreted from the cell into the extracellular environment must go through a series of steps referred to as the secretory pathway.
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature13127 Factors to consider in assessing candidate pathogenic mutations in presumed monogenic conditions The questions itemized below expand upon the definitions in Table 1 and are provided
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full//59/ra7/dc1 Supplementary Materials for Dok-7 ctivates the Muscle Receptor Kinase MuSK and Shapes Synapse Formation kane Inoue, Kiyoko Setoguchi, Yosuke Matsubara,
More informationDead end1 is an essential partner of NANOS2 for selective binding of target RNAs in male germ cell development
Manuscript EMBO-2015-40828 Dead end1 is an essential partner of NANOS2 for selective binding of target RNAs in male germ cell development Atsushi Suzuki, Yuki Niimi, Kaori Shinmyozu, Zhi Zhou, Makoto Kiso,
More informationSaccharomyces cerevisiae. haploid =
In this lecture we are going to consider experiments on yeast, a very useful organism for genetic study. Yeast is more properly known as Saccharomyces cerevisiae, which is the single-celled microbe used
More informationSUPPLEMENTARY INFORMATION. Supplementary Figures 1-8
SUPPLEMENTARY INFORMATION Supplementary Figures 1-8 Supplementary Figure 1. TFAM residues contacting the DNA minor groove (A) TFAM contacts on nonspecific DNA. Leu58, Ile81, Asn163, Pro178, and Leu182
More informationCHapter 14. From DNA to Protein
CHapter 14 From DNA to Protein How? DNA to RNA to Protein to Trait Types of RNA 1. Messenger RNA: carries protein code or transcript 2. Ribosomal RNA: part of ribosomes 3. Transfer RNA: delivers amino
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature11070 Supplementary Figure 1 Purification of FLAG-tagged proteins. a, Purification of FLAG-RNF12 by FLAG-affinity from nuclear extracts of wild-type (WT) and two FLAG- RNF12 transgenic
More informationFig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.
Fig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.SCUBE2, E-cadherin.Myc, or HA.p120-catenin was transfected in a combination
More informationPartial list of differentially expressed genes from cdna microarray, comparing MUC18-
Supplemental Figure legends Table-1 Partial list of differentially expressed genes from cdna microarray, comparing MUC18- silenced and NT-transduced A375SM cells. Supplemental Figure 1 Effect of MUC-18
More informationi. This type of DNA damage will result in (circle all correct answers) b. a transversion mutation
Biol 321 Winter 2010 Quiz 5 40 points NAME ANSWERS IN RED COMMENTS IN BLUE 1. (2 pts.) Recall the article entitled: Human Genetic Variation By each statement circle True/False/Not addressed in the paper.
More informationName: Date: IF YOU GOT BELOW A 70% RETAKING THE TEST IS MANDATORY.
IF YOU GOT BELOW A 70% RETAKING THE TEST IS MANDATORY. 1. What is a mutation? Any change in a DNA sequence 2. Name and describe the two categories types of gene mutations. Point: substitution, one nucleotide
More informationThe yeast two-hybrid assay
Master program Molecular and Cellular Life Sciences Block 1: Intracellular membrane processes 11th October 2011 The yeast two-hybrid assay Fulvio Reggiori Department of Cell Biology, UMC Utrecht For what
More informationUnit 2: Metabolism and Survival Sub-Topic (2.7) Genetic Control of Metabolism (2.8) Ethical considerations in the use of microorganisms
Unit 2: Metabolism and Survival Sub-Topic (2.7) Genetic Control of Metabolism (2.8) Ethical considerations in the use of microorganisms Duncanrig Secondary JHM&MHC 2015 Page 1 of 18 On completion of this
More informationRevision Checklist for Science Signaling Research Manuscripts: Data Requirements and Style Guidelines
Revision Checklist for Science Signaling Research Manuscripts: Data Requirements and Style Guidelines Further information can be found at: http://stke.sciencemag.org/sites/default/files/researcharticlerevmsinstructions_0.pdf.
More informationCh 12.DNA and RNA.Biology.Landis
Identity Section 12 1 DNA (pages 287 294) This section tells about the experiments that helped scientists discover the relationship between genes and DNA. It also describes the chemical structure of the
More informationGriffith and Transformation (pages ) 1. What hypothesis did Griffith form from the results of his experiments?
Section 12 1 DNA (pages 287 294) This section tells about the experiments that helped scientists discover the relationship between genes and DNA. It also describes the chemical structure of the DNA molecule.
More informationBundle 6 Test Review
Bundle 6 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? Deoxyribonucleic
More informationC) Based on your knowledge of transcription, what factors do you expect to ultimately identify? (1 point)
Question 1 Unlike bacterial RNA polymerase, eukaryotic RNA polymerases need additional assistance in finding a promoter and transcription start site. You wish to reconstitute accurate transcription by
More informationMethoden zur Analyse von Transkriptionsfaktoren. Seminar: BCII, Lausen
Methoden zur Analyse von Transkriptionsfaktoren Seminar: BCII, Lausen Gene expression: from transcription to translation Orphanides G, Reinberg D.Cell. 2002 Feb 22;108(4):439-51. Schematic of a gene regulatory
More information1 R01 AI VMD HALFORD, W
1 R01 AI104935-01 2 VMD 1R01AI104935-01 ILLIAM CRITIQUE 1: Significance: 5 Investigator(s): 2 Innovation: 5 Approach: 8 Environment: 2 Overall Impact: This application proposes to develop a recombinant
More informationHershey and Chase. The accumulation of evidence: Key Experiments in the Discovery of DNA: Griffith s Transformation Experiment (1928)
Today: Key Experiments in the Discovery of DNA: Griffith s Transformation Experiment (1928) Reviewing Mitosis/ Exploring the Function of Taxol Structure and Function of DNA! What do we learn about the
More informationBISHOPAgEd.Weebly.com. Weeks: Dates: 1/18-1/29 Unit: RNA &Protein Synthesis. Monday Tuesday Wednesday Thursday Friday. FFA Meeting 6pm 27 E
Ms. King BISHOPAgEd.Weebly.com Name: Period: Weeks: 21-22 Dates: 1/18-1/29 Unit: RNA &Protein Synthesis Monday Tuesday Wednesday Thursday Friday 18 NO School 19 E 20 O RNA Part 1 FFA Meeting 6pm 21 E 22
More informationSUPPLEMENTARY INFORMATION
doi: 10.1038/nature06721 SUPPLEMENTARY INFORMATION. Supplemental Figure Legends Supplemental Figure 1 The distribution of hatx-1[82q] in Cos7 cells. Cos7 cells are co-transfected with hatx-1[82q]-gfp (green)
More informationUse of Minigenes in a Diagnostic Laboratory. Allan Richards. Cambridge
Use of Minigenes in a Diagnostic Laboratory Allan Richards Cambridge Minigene Analysis Minigenes are used to assess the effect of sequence variants on the processing of pre-mrna into the final message
More informationC A T T A G C nitrogenous complimentary G T A A T C G to each other
Name DNA RNA Review Worksheet Date 1. What does DNA stand for? Deoxyribonucleic acid 2. What is DNA s primary function? - Provides a pattern for protein manufacture - Provides a pattern for replication
More informationReviewers' comments: Reviewer #1 (Remarks to the Author):
Reviewers' comments: Reviewer #1 (Remarks to the Author): The authors explored selective BET bromodomain inhibition as a potential antifungal target. The investigators used complementary genetic, pharmacologic,
More information2. From the first paragraph in this section, find three ways in which RNA differs from DNA.
Name Chapter 17: From Gene to Protein Begin reading at page 328 Basic Principles of Transcription and Translation. Work on this chapter a single concept at a time, and expect to spend at least 6 hours
More informationSupplementary Information
Supplementary Information MED18 interaction with distinct transcription factors regulates plant immunity, flowering time and responses to hormones Supplementary Figure 1. Diagram showing T-DNA insertion
More informationSUPPLEMENTAL FIGURE LEGENDS. Figure S1: Homology alignment of DDR2 amino acid sequence. Shown are
SUPPLEMENTAL FIGURE LEGENDS Figure S1: Homology alignment of DDR2 amino acid sequence. Shown are the amino acid sequences of human DDR2, mouse DDR2 and the closest homologs in zebrafish and C. Elegans.
More informationProtein Synthesis Honors Biology
Protein Synthesis What do we know? Metabolism is controlled by enzymes enzymes are proteins DNA contains the genetic information to build proteins. DNA is only in the nucleus. Ribosomes are not. How then
More informationChapter 14: From DNA to Protein
Chapter 14: From DNA to Protein Steps from DNA to Proteins Same two steps produce all proteins: 1) DNA is transcribed to form RNA Occurs in the nucleus RNA moves into cytoplasm 2) RNA is translated in
More informationNature Genetics: doi: /ng.3556 INTEGRATED SUPPLEMENTARY FIGURE TEMPLATE. Supplementary Figure 1
INTEGRATED SUPPLEMENTARY FIGURE TEMPLATE Supplementary Figure 1 REF6 expression in transgenic lines. (a,b) Expression of REF6 in REF6-HA ref6 and REF6ΔZnF-HA ref6 plants detected by RT qpcr (a) and immunoblot
More informationChapter 8. Microbial Genetics. Lectures prepared by Christine L. Case. Copyright 2010 Pearson Education, Inc.
Chapter 8 Microbial Genetics Lectures prepared by Christine L. Case Structure and Function of Genetic Material Learning Objectives 8-1 Define genetics, genome, chromosome, gene, genetic code, genotype,
More informationThe Central Dogma. DNA makes RNA makes Proteins
The Central Dogma DNA makes RNA makes Proteins TRANSCRIPTION DNA RNA transcript RNA polymerase RNA PROCESSING Exon RNA transcript (pre-) Intron Aminoacyl-tRNA synthetase NUCLEUS CYTOPLASM FORMATION OF
More informationGenomics and Proteomics *
OpenStax-CNX module: m44558 1 Genomics and Proteomics * OpenStax This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 3.0 By the end of this section, you will
More informationSupplementary Figure 1. GST pull-down analysis of the interaction of GST-cIAP1 (A, B), GSTcIAP1
Legends Supplementary Figure 1. GST pull-down analysis of the interaction of GST- (A, B), GST mutants (B) or GST- (C) with indicated proteins. A, B, Cell lysate from untransfected HeLa cells were loaded
More informationConfirming the Phenotypes of E. coli Strains
Confirming the Phenotypes of E. coli Strains INTRODUCTION Before undertaking any experiments, we need to confirm that the phenotypes of the E. coli strains we intend to use in the planned experiments correspond
More informationCRE/CREB Reporter Assay Kit camp/pka Cell Signaling Pathway Catalog #: 60611
Data Sheet CRE/CREB Reporter Assay Kit camp/pka Cell Signaling Pathway Catalog #: 60611 Background The main role of the camp response element, or CRE, is mediating the effects of Protein Kinase A (PKA)
More informationMRC-Holland MLPA. Description version 15; 23 July 2015
SALSA MLPA probemix P125-B1 Mitochondria Lot B1-0312 B1-0609. Compared to the previous version of this product (lots A1-0606, A1-1105), four probes have been replaced and six extra mitochondrial probes
More informationTitle: Production and characterisation of monoclonal antibodies against RAI3 and its expression in human breast cancer
Author's response to reviews Title: Production and characterisation of monoclonal antibodies against RAI3 and its expression in human breast cancer Authors: Hannah Jörißen (hannah.joerissen@molbiotech.rwth-aachen.de)
More informationNature Genetics: doi: /ng Supplementary Figure 1. ChIP-seq genome browser views of BRM occupancy at previously identified BRM targets.
Supplementary Figure 1 ChIP-seq genome browser views of BRM occupancy at previously identified BRM targets. Gene structures are shown underneath each panel. Supplementary Figure 2 pref6::ref6-gfp complements
More informationSupplementary Figure 1. α-synuclein is truncated in PD and LBD brains. Nature Structural & Molecular Biology: doi: /nsmb.
Supplementary Figure 1 α-synuclein is truncated in PD and LBD brains. (a) Specificity of anti-n103 antibody. Anti-N103 antibody was coated on an ELISA plate and different concentrations of full-length
More informationMRC-Holland MLPA. Description version 11; 20 November 2015
SALSA MLPA probemix P310-B2 TCOF1 Lot B2-0614, B2-0511. As compared to version B1 (lot B1-0110), the 88 and 96 nt control fragments have been replaced (QDX2). Treacher Collins-Franceschetti 1 syndrome
More information7.17: Writing Up Results and Creating Illustrations
7.17: Writing Up Results and Creating Illustrations A Results Exercise: Kansas and Pancakes Write a 5-sentence paragraph describing the results illustrated in this figure: - Describe the figure: highlights?
More informationRegulation of transcription by the MLL2 complex and MLL complex-associated AKAP95
Supplementary Information Regulation of transcription by the complex and MLL complex-associated Hao Jiang, Xiangdong Lu, Miho Shimada, Yali Dou, Zhanyun Tang, and Robert G. Roeder Input HeLa NE IP lot:
More informationI can explain the relationship among genes, chromosomes, and inherited traits. I can investigate the relationship among DNA, genes, and chromosomes.
Ch. 6 Lesson 3 Part 2 DNA I can explain the relationship among genes, chromosomes, and inherited traits. I can investigate the relationship among DNA, genes, and chromosomes. What Mastery looks Like WHAT
More informationData Sheet. CRE/CREB Reporter Assay Kit (camp/pka Cell Signaling Pathway) Catalog #: 60611
Data Sheet CRE/CREB Reporter Assay Kit (camp/pka Cell Signaling Pathway) Catalog #: 60611 Background The main role of the camp response element, or CRE, is mediating the effects of Protein Kinase A (PKA)
More informationDNA, RNA & Proteins Chapter 13
DNA, RNA & Proteins Chapter 13 DNA stands for. What is DNA? - The genetic information that controls the activity of a cell. - Located in the of every one of your cells. What is the structure of DNA like?
More informationNature Methods: doi: /nmeth Supplementary Figure 1. Construction of a sensitive TetR mediated auxotrophic off-switch.
Supplementary Figure 1 Construction of a sensitive TetR mediated auxotrophic off-switch. A Production of the Tet repressor in yeast when conjugated to either the LexA4 or LexA8 promoter DNA binding sequences.
More informationEukaryotic Gene Expression Prof. P. N. Rangarajan Department of Biochemistry Indian Institute of Science, Bangalore
Eukaryotic Gene Expression Prof. P. N. Rangarajan Department of Biochemistry Indian Institute of Science, Bangalore Module No. # 01 Lecture No. # 04 Gene Regulation in Eukaryotes: Proximal and Distal Promoter
More informationANSWERS TO Problem set questions from Exam 2 Unit Mutations, Bacterial Genetics, and Bacterial Gene Regulation
ANSWERS TO Problem set questions from Exam 2 Unit Mutations, Bacterial Genetics, and Bacterial Gene Regulation Central Dogma, Mutagens and Mutations 1. The three stop codons in the genetic code are 5 UAG3,
More informationTitle: Clinical factors associated with a Candida albicans Germ Tube Antibody (CAGTA) positive test in ICU patients
Author's response to reviews Title: Clinical factors associated with a Candida albicans Germ Tube Antibody (CAGTA) positive test in ICU patients Authors: Javier Pemán (peman_jav@gva.es) Rafael Zaragoza
More informationThe Nature of Genes. The Nature of Genes. Genes and How They Work. Chapter 15/16
Genes and How They Work Chapter 15/16 The Nature of Genes Beadle and Tatum proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes
More informationBLASTing through the kingdom of life
Information for teachers Description: In this activity, students copy unknown DNA sequences and use them to search GenBank, the main database of nucleotide sequences at the National Center for Biotechnology
More information