Developing Fusarium head blight resistant wheat. Gary J. Muehlbauer University of Minnesota
|
|
|
- Thomas Horton
- 6 years ago
- Views:
Transcription
1 Developing Fusarium head blight resistant wheat Gary J. Muehlbauer University of Minnesota
2 Wheat Type II R FHB resistance Wheat susceptible Barley
3 Trichothecenes are virulence factors on wheat Deoxynivalenol (DON) Tri5 mutant knockout in trichodiene synthase resulting in trichothecene nonproducing Fusarium Proctor et al., 1995
4 Arabidopsis UDP-glucosyltransferase provides resistance to DON Deoxynivalenol DON-3-O-glucoside GENT 2x35S C-Myc-DOGT1 Poppenberger et al., 2003 J. Biol. Chem.
5 Fhb1 cosegregates with increased DONglucoside to DON ratio Wheat Type II R Wheat susceptible UDP glucosyltransferase activity converts DON to DON-3-glucoside Deoxynivalenol DON-3-O-glucoside Lemmens et al., 2005 MPMI
6 Disease severity is greater in barley inoculated with a wildtype strain of Fusarium graminearum Disease severity: Wildtype strain = /- 2.5 Tri5 mutant strain = /- 7.9 Boddu et al., 2007 MPMI
7 Barley and wheat respond differentially to infection and trichothecene accumulation Trichothecene accumulation Tissue necrosis wheat barley Tissue bleaching Limited tissue bleaching S R Spread of disease symptoms Limited or no spread of disease symptoms Little or no spread of disease symptoms Is the different response between barley and wheat due to the ability to detoxify trichothecenes?
![DON is transported to acropetal and basipetal florets in barley [DON] analysis 1, 12, 24, 48 hai](/docs-images/79/79264264/images/8-1.jpg "[DON] analysis 1, 6, 12, 24, 48, 72 hai [DON] analysis 1, 12, 24, 48 hai Gardiner et al.")
8 DON is transported to acropetal and basipetal florets in barley [DON] analysis 1, 12, 24, 48 hai [DON] analysis 1, 6, 12, 24, 48, 72 hai [DON] analysis 1, 12, 24, 48 hai Gardiner et al., 2010 MPMI
9 DON is converted to DON-3-O-glucoside (D3G) in barley DON/D3G analysis 1, 3, 5, 7, 10, 14, 21 dai Gardiner et al., 2010 MPMI
10 Identify barley genes that respond to in planta trichothecene accumulation and DON treatment Identify differentially expressed genes Tri5 mutant and wildtype inoculation Trichothecene responsive genes DON and water treatment Boddu et al., 2007 MPMI Gardiner et al., 2010 MPMI Identify differentially expressed genes
11 DON application and in planta trichothecene accumulation induced barley genes Cytochrome P450s Cysteine synthase (enzyme for biosynthesis of glutathione) Glutathione-S-transferases NF-X1 transcriptional repressor of trichotheceneinduced defense responses (Asano et al., 2007) WRKY, NBS-LRR, etc. upregulated in T2 toxin (Type A trichothecene) treated NF-X1 Arabidopsis mutants Glucosyltransferases (DON to DON-3-O-glucoside) Transporters (MATE, ABC) Transcription factors Gardiner et al., 2010 MPMI
12 Barley UDP-glucosyltransferase (HvUGT13248) converts DON to DON-3- O-glucoside (D3G) Schweiger et al., 2010 MPMI
13 Transgenic Arabidopsis carrying a barley UDPglucosyltransferase (HvUGT13248) exhibits resistance to DON 2X35S HvUGT13248-Flg Hyg r Shin et al., 2012 J. Exp. Bot.
14 Transgenic Arabidopsis carrying a barley UDP-glucosyltransferase (HvUGT13248) conjugates DON to D3G Shin et al., 2012 J. Exp. Bot.
15 Arabidopsis carrying HvUGT13248 confers resistance to 3,15-NIV
16 Transgenic Arabidopsis carrying HvUGT13248 do not exhibit morphological changes Shin et al., 2012 J. Exp. Bot.
17 Wheat transformation KpnI HindIII RB HvUGT13248 Flg Ubi1 pro. 35s pro. npt II LB 1452bp
18 Verification of transgenic plants BW BW DNA blot BW Protein blot
19 Transgenic wheat expressing HvUGT13248 confers Type II resistance Bobwhite background CB037 Background (collaboration with Tom Clemente)
20 Transgenic wheat expressing HvUGT13248 confers resistance in the field Genotype FHB Inc. (%) FHB Sev. (%) Wheaton Roblin Sumai Rollag Alsen * Wheaton (non) Bobwhite # ** # ** # * 14.56** # * # * 9.82*** #18 50*** 5.01*** #19 65* 10.53*** # *** # ** 6.70*** Collaboration with Ruth Dill-Macky
21 Transgenic wheat expressing HvUGT13248 confers reduced FHB severity in the field Collaboration with Ruth Dill-Macky
22 DON Does HvUGT13248 catalyze DON to D3G conjugation in wheat? Day After Inoculation Metabolite extraction LC-MS/MS Collaboration with Franz Berthiller
23 HvUGT13248 catalyzes DON to D3G Bobwhite HvUGT13248 transgenic plants Concentration of DON and D3G per spike (nmol) DON D3G Concentration of DON and D3G per spike (nmol) DON D3G 0 1 dai 3 dai 7 dai 14 dai 21 dai 0 1 dai 3 dai 7 dai 14 dai 21 dai DON D3G Collaboration with Franz Berthiller
24 Molar ratio of D3G to DON BW HvUGT dai 3 dai 7 dai 14 dai 21 dai Collaboration with Franz Berthiller
25 Summary Barley transports DON and converts DON to DON-3-O-glucoside HvUGT13248 confers resistance to DON in yeast HvUGT13248 confers resistance to DON and NIV in Arabidopsis HvUGT13248 converts DON to D3G Transgenic wheat carrying HvUGT13248 confers Type II resistance in the greenhouse and resistance in the field
26 Acknowledgements Muehlbauer lab Hatice Bilgic Jayanand Boddu Seungho Cho Stephanie Gardiner Shane Heinen Anna Hofstad Yadong Huang Haiyan Jia Warren Kruger Xin Li Sanghyun Shin University of Nebraska Tom Clemente U. of Minnesota Vienna U. of Technology Jim Anderson Christian Hametner Ruth Dill-Macky Yanhong Dong Kevin Smith Brian Steffenson USDA-ARS, Peoria, IL Susan McCormick University of Natural Resources and Life Sciences, Austria Gerhard Adam Paula Kovalsky Paris Wolfgang Schweiger Juan Antonio Torres-Acosta Marc Lemmens Franz Berthiller
Functional identification of the wheat gene enhancing mycotoxin detoxification of the major Fusarium resistance QTL Fhb1
Functional identification of the wheat gene enhancing mycotoxin detoxification of the major Fusarium resistance QTL Fhb1 Barbara Steiner, Simone Zimmerl, Marc Lemmens, Gerhard Adam, Bradley Till, Wolfgang
Cloning and Characterization of a Novel UDP-Glycosyltransferase Gene Induced by DON from Wheat
Cloning and Characterization of a Novel UDP-Glycosyltransferase Gene Induced by DON from Wheat MA Xin *, DU Xu-ye *, LIU Guo-juan, YANG Zai-dong, HOU Wen-qian, WANG Hong-wei, FENG De-shun, LI An-fei and
Altered Gene Expression Profiles of Wheat Genotypes against Fusarium Head Blight
Toxins 2015, 7, 604-620; doi:10.3390/toxins7020604 Article OPEN ACCESS toxins ISSN 2072-6651 www.mdpi.com/journal/toxins Altered Gene Expression Profiles of Wheat Genotypes against Fusarium Head Blight
Current Knowledge on the Genetics of Fusarium Head Blight Resistance in Wheat - Implications for Resistance Breeding
Current Knowledge on the Genetics of Fusarium Head Blight Resistance in Wheat - Implications for Resistance Breeding Hermann Buerstmayr, Barbara Steiner, Marc Lemmens BOKU-University of Natural Resources
Novel Genes of Fusarium graminearum That Negatively Regulate Deoxynivalenol Production and Virulence
MPMI Vol. 22, No. 12, 2009, pp. 1588 1600. doi:10.1094 / MPMI -22-12-1588. 2009 The American Phytopathological Society e-xtra* Novel Genes of Fusarium graminearum That Negatively Regulate Deoxynivalenol
Light Influences How the Fungal Toxin Deoxynivalenol Affects Plant Cell Death and Defense Responses
Light Influences How the Fungal Toxin Deoxynivalenol Affects Plant Cell Death and Defense Responses The Harvard community has made this article openly available. Please share how this access benefits you.
Understanding the DON-Wheat Head Scab Connection. Don Hershman Extension Plant Pathologist University of Kentucky, Princeton, KY
Understanding the DON-Wheat Head Scab Connection Don Hershman Extension Plant Pathologist University of Kentucky, Princeton, KY Understanding the DON-Wheat Head Scab Connection and Impact of Corn Residue
Crop Rotation, Prosaro Fungicide and Cultivar as Management Tools to Control Disease on 2- and 6-Row Barley and Durum Wheat, Langdon, 2007
Crop Rotation, Prosaro Fungicide and Cultivar as Management Tools to Control Disease on 2- and 6-Row Barley and Durum Wheat, Langdon, 2007 Halley, S.*, McMullen M. P., Neate, S., Horsley, R., Smith, K.,
"An overview of wheat transformation at Kansas State University"
"An overview of wheat transformation at Kansas State University" Harold N. Trick Department of Plant Pathology, Kansas State University Manhattan, Kansas, USA Why Transform Wheat? Trait introduction for
The demonstration that wild-type T-DNA coding region can be replaced by any DNA sequence without any effect on its transfer from A.
The demonstration that wild-type T-DNA coding region can be replaced by any DNA sequence without any effect on its transfer from A. tumefaciens to the plant inspired the promise that A. tumefaciens might
Infection patterns in barley and wheat spikes inoculated with wild-type and trichodiene synthase gene disrupted Fusarium graminearum
Infection patterns in barley and wheat spikes inoculated with wild-type and trichodiene synthase gene disrupted Fusarium graminearum Carin Jansen*, Diter von Wettstein, Wilhelm Schäfer, Karl-Heinz Kogel*,
Lecture 3 Mutagens and Mutagenesis. 1. Mutagens A. Physical and Chemical mutagens B. Transposons and retrotransposons C. T-DNA
Lecture 3 Mutagens and Mutagenesis 1. Mutagens A. Physical and Chemical mutagens B. Transposons and retrotransposons C. T-DNA 2. Mutagenesis A. Screen B. Selection C. Lethal mutations Read: 508-514 Figs:
2014 Wheat, Barley and Oat Variety Performance in Minnesota - Preliminary Report
04 Wheat, Barley and Oat Variety Performance in Minnesota - Preliminary Report The 04 growing season was in many ways a carbon copy of the 03 season. Overall, the spring wheat pleasantly surprised most
What the Genome of Raffaelea lauricola Can Tell Us About Laurel Wilt
What the Genome of Raffaelea lauricola Can Tell Us About Laurel Wilt Laurel Wilt Summit November 3-4, 2016 Dr. Jeffrey Rollins Associate Professor Plant Pathology Department University of Florida Gainesville,
A Partial Chromosomal Deletion Caused by Random Plasmid Integration Resulted in a Reduced Virulence Phenotype in Fusarium graminearum
MPMI Vol. 23, No. 8, 2010, pp. 1083 1096. doi:10.1094 / MPMI -23-8-1083. 2010 The American Phytopathological Society e-xtra* A Partial Chromosomal Deletion Caused by Random Plasmid Integration Resulted
Cisgenics, Intragenics and Site-specific Mutagenesis
Cisgenics, Intragenics and Site-specific Mutagenesis K. Veluthambi School of Biotechnology Madurai Kamaraj University kveluthambi@rediffmail.com South Asia Biosafety Conference September 18-19, 2013 1
University of Missouri, Agricultural Experiment Station College of Agriculture, Food, and Natural Resources Columbia, Missouri
University of Missouri, Agricultural Experiment Station College of Agriculture, Food, and Natural Resources Columbia, Missouri Release of Truman Soft Red Winter Wheat The University of Missouri Agricultural
The Fusarium mycotoxin deoxynivalenol elicits hydrogen peroxide production, programmed cell death and defence responses in wheat.
Griffith Research Online https://research-repository.griffith.edu.au The Fusarium mycotoxin deoxynivalenol elicits hydrogen peroxide production, programmed cell death and defence responses in wheat. Author
Practicality of Managing Mycotoxins in our Grain System. Grain Farmers of Ontario
Practicality of Managing Mycotoxins in our Grain System Grain Farmers of Ontario Grain Farmers of Ontario Our Vision: To drive the Ontario grain industry to become a global leader Our Mission: To develop
Crop Rotation, Prosaro Fungicide, Seed Treatment and Cultivar as Management Tools to Control Disease on 2-Row Barley, Langdon, 2009
Crop Rotation, Prosaro Fungicide, Seed Treatment and Cultivar as Management Tools to Control Disease on 2-Row Barley, Langdon, 2009 Halley, S.*, Crop Protection Scientist, McMullen, M., Extension Plant
Transgenic and genomics-assisted breeding approaches to improve durable fungal disease resistance in wheat
Transgenic and genomics-assisted breeding approaches to improve durable fungal disease resistance in wheat Beat Keller, bkeller@botinst.uzh.ch University of Zurich, Switzerland Conference «Novel approaches
On-Farm Cropping Trials Northwest & West Central Minnesota and 2016 Minnesota Wheat Research Review
On-Farm Cropping Trials Northwest & West Central Minnesota and 2016 Minnesota Wheat Research Review MDA Funding provided through Agricultural Growth, Research and Innovation (MDA-AGRI) Program Page 1 2016
A Study of Fusarium graminearum Virulence Factors A DISSERTATION SUBMITTED TO THE FACULTY OF THE GRADUATE SCHOOL OF THE UNIVERSITY OF MINNESOTA BY
A Study of Fusarium graminearum Virulence Factors A DISSERTATION SUBMITTED TO THE FACULTY OF THE GRADUATE SCHOOL OF THE UNIVERSITY OF MINNESOTA BY Jon R. Menke IN PARTIAL FULFILLMENT OF THE REQUIREMENTS
QUESTIONS 16 THROUGH 30 FROM EXAM 3 OF FALL, 2010
BISC403 Genetic and Evolutionary Biology Spring, 2011 April 19, 2011 Summary of requirements for Exam 3 (to be given on April 26 plus third exam from fall, 2010) The primary responsibility is for any topic
The Molecular Basis of Bacterial Innate Immunity in Arabidopsis thaliana
The Molecular Basis of Bacterial Innate Immunity in Arabidopsis thaliana Brian Staskawicz Department of Plant and Microbial Biology University of California, Berkeley Rice Model Plant-Pathogen Systems
2054, Chap. 13, page 1
2054, Chap. 13, page 1 I. Microbial Recombination and Plasmids (Chapter 13) A. recombination = process of combining genetic material from 2 organisms to produce a genotype different from either parent
Recovery Plan for Wheat Blast (caused by Magnaporthe oryzae Triticum pathotype)
Recovery Plan for Wheat Blast (caused by Magnaporthe oryzae Triticum pathotype) Contributors: William Bockus, Christian Cruz, Erick De Wolf, Jim Stack and Barbara Valent* (Kansas State University) Gary
Plant Cell, Tissue and Organ Culture
Supplementary materials for Plant Cell, Tissue and Organ Culture Article tile: Agrobacterium mediated Genetic Transformation of Miscanthus sinensis Authors: Ok-Jin Hwang 1, Mi-Ae Cho 1, Yun-Jeong Han 1,
Carlos Perez I am pursuing a Ph.D. degree in the Department of Plant Pathology at the University of Minnesota with Dr. Robert Blanchette.
Carlos Perez I am pursuing a Ph.D. degree in the Department of Plant Pathology at the University of Minnesota with Dr. Robert Blanchette. I am an Assistant Professor at the University of Uruguay (a small
Mapping a Type 1 FHB resistance on chromosome 4AS of Triticum macha and deployment in combination with two Type 2 resistances
Theor Appl Genet (2015) 128:1725 1738 DOI 10.1007/s00122-015-2542-9 ORIGINAL PAPER Mapping a Type 1 FHB resistance on chromosome 4AS of Triticum macha and deployment in combination with two Type 2 resistances
2013 Organic Spring Wheat Variety Trial
2013 Organic Spring Wheat Variety Trial Dr. Heather Darby, UVM Extension Agronomist Erica Cummings, Conner Burke, Hannah Harwood, and Susan Monahan UVM Extension Crops and Soils Technicians (802) 524-6501
Jonathon Smith Burt Bluhm Department of Plant Pathology University of Arkansas Division of Agriculture Zearalenone (e.g., DON) Aflatoxins O O OH CH 3
N 2 C 3 C 3 6/5/2014 Jonathon Smith Burt Bluhm Department of Plant Pathology University of Arkansas Division of Agriculture Fumonisins Zearalenone Trichothecenes (e.g., DN) Aflatoxins chratoxins Ergots
The involvement of Arabidopsis calmodulin in plant immunity against Pseudomonas syringae
University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Environmental Studies Undergraduate Student Theses Environmental Studies Program Spring 2017 The involvement of Arabidopsis
New tricks of an old enemy: isolates of Fusarium graminearum produce a type A trichothecene mycotoxin
bs_bs_banner Environmental Microbiology (2015) 17(8), 2588 2600 doi:10.1111/1462-2920.12718 New tricks of an old enemy: isolates of Fusarium graminearum produce a type A trichothecene mycotoxin Elisabeth
BIO1PS 2012 Plant Science Topic 4 Lectures 2 and 3 Introduction to Plant Biotechnology
BIO1PS 2012 Plant Science Topic 4 Lectures 2 and 3 Introduction to Plant Biotechnology Dr. Michael Emmerling Department of Botany Room 410 m.emmerling@latrobe.edu.au Some Key Words Agrobacterium Ti plasmid
Rust Resistance Gene Cloning
University of Minnesota Rust Resistance Gene Cloning perfect markers and cassette development Peter Dodds BGRI technical workshop March 2014 Outlook: R gene pyramids via GM gene cassettes Stacking of multiple
U. S. W H E A T & B A R L E Y S C A B I N I T I A T I V E. Fusarium Focus
U. S. W H E A T & B A R L E Y S C A B I N I T I A T I V E Fusarium Focus Volume 17 Issue 1 Winter 2017 2016 FHB Forum Draws 180+ More than 180 scientists, graduate students, growers and industry representatives
important leads to manipulating crops for improved disease resistance. R. Makandar and V. J. Nalam contributed equally to this work.
MPMI Vol. 28, No. 8, 2015, pp. 943 953. http://dx.doi.org/10.1094/mpmi-04-15-0079-r The Combined Action of ENHANCED DISEASE SUSCEPTIBILITY1, PHYTOALEXIN DEFICIENT4, and SENESCENCE-ASSOCIATED101 Promotes
Joint transcriptomic and metabolomic analyses reveal changes in the primary. metabolism and imbalances in the subgenome orchestration in the bread
G3: Genes Genomes Genetics Early Online, published on October 4, 2015 as doi:10.1534/g3.115.021550 Joint transcriptomic and metabolomic analyses reveal changes in the primary metabolism and imbalances
REGISTRATION DOCUMENT FOR RECOMBINANT DNA RESEARCH
EHRS Date Received: Reg. Doc. No.: REGISTRATION DOCUMENT FOR RECOMBINANT DNA RESEARCH Principal Investigator: Penn ID#: Position Title: School: Department: Mailing Address: Mail Code: Telephone: FAX: E-mail:
Prions Other molecules besides organelle DNA are inherited in non-mendelian patterns.
Prions Other molecules besides organelle DNA are inherited in non-mendelian patterns. Examples of non-mendelian patterns of inheritance extend beyond the inheritance of organelle DNA. Certain DNA and RNA
GTTCGGGTTCC TTTTGAGCAG
Supplementary Figures Splice variants of the SIP1 transcripts play a role in nodule organogenesis in Lotus japonicus. Wang C, Zhu H, Jin L, Chen T, Wang L, Kang H, Hong Z, Zhang Z. 5 UTR CDS 3 UTR TCTCAACCATCCTTTGTCTGCTTCCGCCGCATGGGTGAGGTCATTTTGTCTAGATGACGTGCAATTTACAATGA
CRISPR-mediated Genome Editing in Rice and Maize
CRISPR-mediated Genome Editing in Rice and Maize Bing Yang Department of Genetics, Development and Cell Biology Iowa State University byang@iastate.edu Nov. 30, 2017 A. Zinc finger nuclease B. TAL effector
MFS Transporters and GABA. Metabolism Are Involved in the Self-Defense Against DON in Fusarium graminearum
ORIGINAL RESEARCH published: 13 April 2018 doi: 10.3389/fpls.2018.00438 MFS Transporters and GABA Metabolism Are Involved in the Self-Defense Against DON in Fusarium graminearum Qinhu Wang 1, Daipeng Chen
The Arabidopsis Glucosyltransferase UGT76B1 Conjugates Isoleucic Acid and Modulates Plant Defense and Senescence C W OA
The Plant Cell, Vol. 23: 4124 4145, November 2011, www.plantcell.org ã 2011 American Society of Plant Biologists. All rights reserved. The Arabidopsis Glucosyltransferase UGT76B1 Conjugates Isoleucic Acid
RADJENDIRANE VENUGOPAL AND ANIL K. JAISWAL* MATERIALS AND METHODS
Proc. Natl. Acad. Sci. USA Vol. 93, pp. 14960 14965, December 1996 Pharmacology Nrf1 and Nrf2 positively and c-fos and Fra1 negatively regulate the human antioxidant response element-mediated expression
Optimization of 2D Gel Transblotting for Host Cell Protein Analysis
Optimization of 2D Gel Transblotting for Host Cell Protein Analysis Jon Johansen, Matt Hoelter & Nancy Kendrick* Kendrick Labs Inc, Madison, WI www.kendricklabs.com Talk Outline Biologic drugs, recombinant
Lecture 25 (11/15/17)
Lecture 25 (11/15/17) Reading: Ch9; 328-332 Ch25; 990-995, 1005-1012 Problems: Ch9 (study-guide: applying); 1,2 Ch9 (study-guide: facts); 7,8 Ch25 (text); 1-3,5-7,9,10,13-15 Ch25 (study-guide: applying);
Development of Genomic Tools for RKN Resistance Breeding in Cotton
Development of Genomic Tools for RKN Resistance Breeding in Cotton Dr. Hongbin Zhang Department of Soil & Crop Sciences and Institute for Plant Genomics & Biotechnology Texas A&M University, College Station,
Plant Genome Modification Technologies and Applications Amitabh Mohanty DuPont Pioneer
Plant Genome Modification Technologies and Applications Amitabh Mohanty DuPont Pioneer International Conference on New Plant Breeding Molecular Technologies Technology Development And Regulation, Oct 9-,
USDA-ARS/ U.S. Wheat and Barley Scab Initiative FY16 Final Performance Report Due date: July 28, USWBSI Individual Project(s)
USDA-ARS/ U.S. Wheat and Barley Scab Initiative FY16 Final Performance Report Due date: July 28, 2017 Cover Page Principle Investigator (PI): Emmanuel Byamukama Institution: South Dakota State University
Fusarium head blight or scab, caused primarily by F. graminearum
Published August 10, 2015 RESEARCH Genome-wide Association Mapping of Fusarium Head Blight Resistance and Agromorphological Traits in Barley Landraces from Ethiopia and Eritrea Bullo Erena Mamo and Brian
State Key Laboratory of Crop Biology, College of Agronomy, Shandong Agricultural University, Tai an, Shandong , P.R.China
Journal of Integrative Agriculture Advanced Online Publication: 213 Doi: 1.116/S295-3119(13)657-5 Expression Comparisons of Pathogenesis-Related (PR) Genes in Wheat in Response to Infection/Infestation
Biological Warfare Defense at DARPA Program Overview
Biological Warfare Defense at DARPA Program Overview Stephen S. Morse, Ph.D. DARPA/ smorse@darpa.mil DARPA BWD Program (including novel or bioengineered pathogens) DARPA BWD Program (most current techniques
HI-Control BL21(DE3) & HI-Control 10G Chemically Competent Cells
HI-Control BL21(DE3) & HI-Control 10G Chemically Competent Cells FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE MA156 Rev.31OCT2016 Table of Contents Components & Storage Conditions... 3 HI-Control
2010 Organic Spring Wheat Variety Trial Results
2010 Organic Spring Wheat Trial Results photo by Will Brinton Dr. Ellen Mallory Thomas Molloy, Katherine McPhee 207-581-2942 ellen.mallory@maine.edu 2010 MAINE ORGANIC SPRING WHEAT VARIETY TRIAL RESULTS
BS 50 Genetics and Genomics Week of Nov 29
BS 50 Genetics and Genomics Week of Nov 29 Additional Practice Problems for Section Problem 1. A linear piece of DNA is digested with restriction enzymes EcoRI and HinDIII, and the products are separated
C-terminal Domain of StMYB1R-1 Functions as Transcriptional Activation
SUPPLEMENTAL RESULTS C-terminal Domain of StMYB1R-1 Functions as Transcriptional Activation To test whether StMYB1R-1 has transcriptional activity in yeast, we cloned the fulllength and its deletion forms
Transformation of Nicotiana tabacum cv. Samsun by the Coat Protein Gene of PVY NTN
Phyton (Austria) Special issue: "Plant Physiology" Vol. 39 Fasc. 3 (271M276) 3. 11. 1999 Transformation of Nicotiana tabacum cv. Samsun by the Coat Protein Gene of PVY NTN Darja STANIC, Borut STRUKELJ
Supporting Information
Supporting Information Yuan et al. 10.1073/pnas.0906869106 Fig. S1. Heat map showing that Populus ICS is coregulated with orthologs of Arabidopsis genes involved in PhQ biosynthesis and PSI function, but
Genome research in eukaryotes
Functional Genomics Genome and EST sequencing can tell us how many POTENTIAL genes are present in the genome Proteomics can tell us about proteins and their interactions The goal of functional genomics
Sample Question Paper Session Class XII Biotechnology (045) Marking Scheme
Sample Question Paper Session 2015-16 Class XII Biotechnology (045) Marking Scheme SECTION-A 1. Methylation Student will add a methyl group to one or two bases within the sequence recognized by enzyme.
Adding CRISPR to Your Bio-ARROW Protocol
Adding CRISPR to Your Bio-ARROW Protocol Table of Contents Work Covered by this Guidance Document... 2 Background... 2 VI. Materials and Activities... 3 VI. Materials and Activities - Recombinant Materials...
Recombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology.
PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R 8 Recombinant DNA Technology The Role of Recombinant DNA Technology in Biotechnology Biotechnology?
Cre Stoplight with Living Colors is a faster, brighter
Cre Stoplight with Living Colors is a faster, brighter reporter for Cre recombinase. Drago A Guggiana-Nilo 1, Anne Marie Quinn 2,Thomas E. Hughes 1 1 Department of Cell Biology and Neuroscience, Montana
Foliar Fungicide Use and Management in Field Crops
Foliar Fungicide Use and Management in Field Crops Alyssa Collins Director, PSU SE Research & Extension Center Assistant Professor, Department of Plant Pathology & Environmental Microbiology Resistance
Environmental Risk Assessment and Management of Living Modified Organisms(LMO)
Environmental Risk Assessment and Management of Living Modified Organisms(LMO) Hyen-Mi CHUNG, Director Environmental Biosafety Division, NIER Contents 1 Background : Biotechnology and LMO Risk Management
Genetic Engineering & Recombinant DNA
Genetic Engineering & Recombinant DNA Chapter 10 Copyright The McGraw-Hill Companies, Inc) Permission required for reproduction or display. Applications of Genetic Engineering Basic science vs. Applied
Optimizing Cereal Productivity using Seed Treatments & Fungicides
Optimizing Cereal Productivity using Seed Treatments & Fungicides Wheat U 2017 Paula Halabicki Technical Market Manager High Yields Are Not Accidents Potential Crop Yield Minimum or Limiting Factor Fertility
Gene Expression Analysis Superior Solutions for any Project
Gene Expression Analysis Superior Solutions for any Project Find Your Perfect Match ArrayXS Global Array-to-Go Focussed Comprehensive: detect the whole transcriptome reliably Certified: discover exceptional
Bayesian Variable Selection and Data Integration for Biological Regulatory Networks
Bayesian Variable Selection and Data Integration for Biological Regulatory Networks Shane T. Jensen Department of Statistics The Wharton School, University of Pennsylvania stjensen@wharton.upenn.edu Gary
Genome Sequence Assembly
Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:
GM (Genetically Modified) Plants. Background
1 GM (Genetically Modified) Plants Background Genetically modified crops (GM) have been used since 1996 in the U.S. GM crops contain foreign genetic material The DNA may be from another plant or from a
Safe Operating Procedure
Safe Operating Procedure RECOMBINANT OR SYNTHETIC NUCLEIC ACIDS IBC AND OTHER REVIEW REQUIREMENTS (For assistance, please contact EHS at (402) 472-4925, or visit our web site at http://ehs.unl.edu/) (Revised
Gary Ketner, PhD Johns Hopkins University. Treatment of Infectious Disease: Drugs and Drug Resistance
This work is licensed under a Creative Commons Attribution-NonCommercial-ShareAlike License. Your use of this material constitutes acceptance of that license and the conditions of use of materials on this
Enhancers mutations that make the original mutant phenotype more extreme. Suppressors mutations that make the original mutant phenotype less extreme
Interactomics and Proteomics 1. Interactomics The field of interactomics is concerned with interactions between genes or proteins. They can be genetic interactions, in which two genes are involved in the
Reading Lecture 3: 24-25, 45, Lecture 4: 66-71, Lecture 3. Vectors. Definition Properties Types. Transformation
Lecture 3 Reading Lecture 3: 24-25, 45, 55-66 Lecture 4: 66-71, 75-79 Vectors Definition Properties Types Transformation 56 VECTORS- Definition Vectors are carriers of a DNA fragment of interest Insert
Heme utilization in the Caenorhabditis elegans hypodermal cells is facilitated by hemeresponsive
Supplemental Data Heme utilization in the Caenorhabditis elegans hypodermal cells is facilitated by hemeresponsive gene-2 Caiyong Chen 1, Tamika K. Samuel 1, Michael Krause 2, Harry A. Dailey 3, and Iqbal
Nature Genetics: doi: /ng Supplementary Figure 1. Patient origin and clone type of the 474 genome-sequenced isolates of P. aeruginosa.
Supplementary Figure 1 Patient origin and clone type of the 474 genome-sequenced isolates of P. aeruginosa. Numbers in white squares denote the number of isolates of the respective clone type that have
Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling
Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Glendining KA 1, Markie D 2, Gardner RJM 4, Franz EA 3, Robertson SP 4, Jasoni CL 1 Supplementary
NLR-Associating Transcription Factor bhlh84 and Its Paralogs Function Redundantly in Plant Immunity
NLR-Associating Transcription Factor bhlh84 and Its Paralogs Function Redundantly in Plant Immunity Fang Xu 1,2, Paul Kapos 1, Yu Ti Cheng 1, Meng Li 2, Yuelin Zhang 2,3, Xin Li 1,2 * 1 Michael Smith Laboratories,
Supplemental Data. Lee et al. Plant Cell. (2010) /tpc Supplemental Figure 1. Protein and Gene Structures of DWA1 and DWA2.
Supplemental Figure 1. Protein and Gene Structures of DWA1 and DWA2. (A) Protein structures of DWA1 and DWA2. WD40 region was determined based on the NCBI conserved domain databases (B, C) Schematic representation
DO NOT OPEN UNTIL TOLD TO START
DO NOT OPEN UNTIL TOLD TO START BIO 312, Section 1, Spring 2011 February 21, 2011 Exam 1 Name (print neatly) Instructor 7 digit student ID INSTRUCTIONS: 1. There are 11 pages to the exam. Make sure you
Supplementary information, Figure S1
Supplementary information, Figure S1 (A) Schematic diagram of the sgrna and hspcas9 expression cassettes in a single binary vector designed for Agrobacterium-mediated stable transformation of Arabidopsis
Gene editing in cereals
University of Minnesota Gene editing in cereals Mick Ayliffe The importance of cereals in Australian agriculture VALUE OF AGRICULTURAL COMMODITIES PRODUCED IN Australia (year ended 30 June 2016) Gene editing
Your Gene GGT Term_T7 ATG. Protease Cleavage Site. Name Affinity Tag Protease Cleavage Site Qty Storage. pd454-fh8 FH8 PCS_TEV 10Rx -20
IP-Free E. coli Inducible Expression Vectors E. coli expression vectors are available with the following promoters: T5 or T7 (IPTG-inducible), rhabad (rhamnose-inducible), ara (arabinose and IPTG-inducible)
Problem Set 4
7.016- Problem Set 4 Question 1 Arginine biosynthesis is an example of multi-step biochemical pathway where each step is catalyzed by a specific enzyme (E1, E2 and E3) as is outlined below. E1 E2 E3 A
The Mosaic Nature of Genomes
The Mosaic Nature of Genomes n DNA sequence is not static Mutations of single bases Large deletions Large insertions of sequence n Transferred from other species n New functions useful in particular situations
Highly efficient genome engineering in flowering plants ~ Development of a rapid method to knockout genes in Arabidopsis thaliana ~
Highly efficient genome engineering in flowering plants ~ Development of a rapid method to knockout genes in Arabidopsis thaliana ~ December 5, 2016 Plant biologists at ITbM, Nagoya University have developed
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Genome-scale engineering of Saccharomyces cerevisiae with single nucleotide precision Zehua Bao, 1 Mohammad HamediRad, 2 Pu Xue, 2 Han Xiao, 1,7 Ipek Tasan, 3 Ran Chao, 2 Jing
Breeding resistant cultivars to reduce mycotoxin risks in oats. International Oat Conference St Petersburg July 13, 2016
Breeding resistant cultivars to reduce mycotoxin risks in oats International Oat Conference St Petersburg July 13, 2016 A collaborative research effort Trond Buraas Lars Reitan Åsmund Bjørnstad Selamawit
Registration Document For Biohazards
Protocol #: Registration Document For Biohazards All applicants are required to complete the following sections: Principal Investigator Information Location of Study Section A: General Administrative Information
1. DNA replication. (a) Why is DNA replication an essential process?
ame Section 7.014 Problem Set 3 Please print out this problem set and record your answers on the printed copy. Answers to this problem set are to be turned in to the box outside 68120 by 5:00pm on Friday
Initiatives and developments in the assessment of emerging food safety risks for mycotoxins
Potential impacts of climate change on food safety and strategic identification of emerging risks 25 November 2009 Bangkok Thailand Initiatives and developments in the assessment of emerging food safety
1 Name. 1. (3 pts) What is apoptosis and how does it differ from necrosis? Which is more likely to trigger inflammation?
1 Name MCB 150 Midterm Eam #1 (100 points total) Please write your full name on each page of the eam!! The eam consists of 17 questions (6 pages). Each has a different point count as indicated. Please
Next steps towards durable disease resistance
Next steps towards durable disease resistance Prof. Dr. Richard G.F. Visser, Wageningen UR Plant Breeding One day conference 3 September 2015: Novel approaches to achieve durable disease resistance Late
CHAPTER 2A HOW DO YOU BEGIN TO CLONE A GENE? CHAPTER 2A STUDENT GUIDE 2013 Amgen Foundation. All rights reserved.
CHAPTER 2A HOW DO YOU BEGIN TO CLONE A GENE? 35 INTRODUCTION In the Program Introduction, you learned that the increase in diabetes in the United States has resulted in a great demand for its treatment,
MCDB /15/13 Working with DNA and Biotechnology
Part I: Working with DNA MCDB 1041 3/15/13 Working with DNA and Biotechnology You work in a clinic doing prenatal testing and genetic counseling. You use PCR analysis combined with restriction enzyme digests
Contents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution...
vii Contents Contents... vii List of Figures... xii List of Tables... xiv Abbreviatons... xv Summary... xvii 1. Introduction...1 1.1 In vitro evolution... 1 1.2 Phage Display Technology... 3 1.3 Cell surface