A mutation in TaGW2-A increases thousand grain weight in wheat. James Simmonds

Transcription

1 A mutation in TaGW2-A increases thousand grain weight in wheat James Simmonds

2 Keeping up with demand As the world population continues to rise, demands are increasing and the rate of yield advances are slowing Global wheat production has failed to meet demand in 10 of the last 14 years (USDA The discovery of genes that beneficially impact on yield and yield components and their incorporation into breeding programs is required to address food insecurity

3 Targeting Grain Size Yield can be broken down into three major components that are fixed successively through the season spikes per surface area grain number per spike grain weight vegetative stage reproductive stage grain filling Plants m 2 Tiller/plant Tiller survival Spikes per surface area Spikelets/spike Spike fertility Grain number per spike grain weight (TGW) Yield Adapted from Slafer and Rawson, 1994

4 TILLING: Targeting Induced Local Lesions IN Genomes Studying a candidate gene... TILLING requires:- Population of (EMS) mutagenised plants High throughput screen to identify mutations in a gene of interest a reverse-genetics approach requires knowledge of gene sequence of your gene of interest non-transgenic Reverse Genetics

5 TILLING: Targeting Induced Local Lesions IN Genomes Uses Functional genomics What function does the gene have? Test hypotheses- Which of these genes is responsible for my phenotype? Translation between species Testing how genes from model species function in a crop species? Develop novel alleles Identify an allelic series gain insight into function Reverse Genetics

6 GW2 negatively regulates grain size? RING-type E3 ubiquitin ligase (GW2) negatively regulates cell division; (23.4% wider) Song et al 2007 Nature Genetics Wheat Several recent association studies in wheat with contrasting results Su et al 2011 TAG, Yang et al 2012 TAG, Zhang et al 2013 Euphytica RNAi of TaGW2 in wheat have also shown contradictory results (+/- regulator) Bednarek et al 2012 JXB, Hong et al 2014 Func Int Genomics

7 TaGW2 A genome TILLING >Genomic DNA AGTGTTACTACAATTGGATTGTGTCTGCAATTCTGTTACATTTTATCATTATCTCAAAATTTCTACATGAATTTGTCGAATGCAAAGATGGACATTATATTATAGGAGTT TCTGTTATTTAGCACTTCTACCATGTCCCGAGTTTTTTAACTTGTTAATAAGATTCTCCTAATTTGGGAACCACTGTAATTTCCCCTGTCCTAAAAAATGCATGTTTTTT TTTCTTAATTGTAGTACTACCCAAGCCTTAACCGATCAAAATGTTGCTCGAAAGGGATATGTACAGGTAATGTATCTGTCCTACTAGCTACTACCAGTGATTGTGTGTTA CTTGTTAGGTGCAAATTTCCTTACATGTCTTGTTTGGTATTTTGCAGAGTGCTTTCTTCAAATGAAACCAACTCATACTGCTCGACCTACACAGTATCCTTCATACCATC TCTGTTCTTGTTTCAAATATCCTGTATTGGTAAGTAATGTATGGGCCTTGTCAATTCTCACGGTAACACTTAACCAATAAAGATGCCCATTCTGCAAAACCCCCAACTAT GCTGTGGAGTATCGTGGTGTAAAGACAAAGGAGGAAAGGAGCATAGAGCAATTTGTAAGTCTTATTCCCTAATGTGTTTGTTTTTGTGTTGATATTAGAAAGCCAAATTC ATTTACTTTATCTTGTATAAATTTTGTTACAGGAAGAACAGAAAGTCATTGAAGCACAGATGAGGGTGCGGCAGCAAGCACTTCAAGACGAAGAGGATAAGATGAAAAGA AAACAGAGTAGGTGCTCTTCTAGCAGAACAATCGCTCCAACAACAGAAGTGGAGTATCGAGATATTTGCAGCACATCCTATTCAGGTCTGCACTAGATACGACAAATGTA CACATTTAATAATGTCAATTTTTCTGTAGTTTAATCTGATAACTTACAATTTACTATGTTCGTTGCAGTGCCATCGTACCAATGTACCCAGCAAGAAACTGAATGTTGTT CGTCTGAGCCTTCATGTTCTGCTCAGGCTAACATGCGGTCTTTCCATTCTAGGCATACTCGGTATGTTGTTTTATGTTTTATGTTCCATCATACTTTACCGAAGCTCATA TTGTTGGACAAATTCATTTTAGCAAGAAAATCCATATGCCATTCGTACCAACTGTTCCAAAAGGCTATATACTACACATTAGATGACAGCTACTCTAAAAGCAGGGAGTA TCTGAAGCATAAAGTACTAGCCATTGGATTAAATGTAGATAACAATGACTGACCATTGA Mutant Line Sequence We identified a mutation in the splice acceptor site of exon 5

8 . leading to a premature stop codon Wild type TILLING mutant What is the effect on phenotype?

9 Testing for phenotype After a single backcross to Kronos we check phenotype to assess function Tracking the mutation with a mutant specific KASPAr TaGW2-1_Amutant_FAM TaGW2-1_Awt_VIC TaGW2-2_Aspecific_C GAAGGTGACCAAGTTCATGCTGCTTCAATGACTTTCTGTTCTTCT GAAGGTCGGAGTCAACGGATTGCTTCAATGACTTTCTGTTCTTCC AGAGCAATTTGTAAGTCTTATTCC WS 1-2

10 Gw2 Increases TGW through wider and longer grains * *

11 Production of NILs (BC 2 & BC 4 ) The original TILLING line will be segregating for various other mutations Near Isogenic Line were developed to validate the effect of gw2-a in a homogenous background

12 Kronos NILs confirm F 2 /F 3 results ** Kronos - tetraploid Average 7.6% increase in TGW

13 Kronos NILs confirm F 2 /F 3 results

14 Production of 6X NILs How does the effect translate in hexaploid wheat?

15 Effect maintained in hexaploid NILs Paragon Average 10.2% increase in TGW

16 Effect maintained in hexaploid NILs

17 Will this convert to yield? Replicated yield trial of the BC 2 NILs sown in the winter yield data due summer 2015 BC 4 NILs sown in replicated 1m bulk plots for analysis of morphometric properties and multi site field trials 2015/16 To access material contact :- james.simmonds@jic.ac.uk (cc cristobal.uauy@jic.ac.uk)

18 Diploid rice : single copy 3 mm RINGprotein Song et al (2007) Nature Genetics 39

19 Hexaploid Wheat : multiple brakes 3 mm GW-A GW-B GW-D A genome B genome D genome

20 in silico TILLING With exome capture of 4X and 6X TILLING populations discovering mutations will become a lot more straightforward! TILLING in an afternoon! Forward Genetics From phenotype to mutation...

21 A powerful forward genetic resource Phenotypic screen of mutants in the field Cross-reference to EMS catalogue Identify putative functional variants (in silico) Validate in segregating F 2 and NILs

22 TGW Variation Cadenza pop_ Field Cadenza Wide variation in TGW (and other traits) in 2014 Mutant line with the largest TGW showing a 34% increase compared to Cadenza WT Now it may be possible to uncover which mutations are causing these increases Preliminary analysis indicates we have a line with a HOM GW2_D STOP mutation in the top 5 for grain width

23 TGW Variation Kronos pop Kronos Good variation in TGW 116 lines with larger TGW than Kronos Mutant line with the largest TGW showing a 24% increase compared to Kronos WT

24 JIC Field m single row per mutant line Kronos M4 population Winter sown 985 sequenced mutants Cadenza M4 population Spring sown 1720 mutants (1200 being sequenced) Contact (cc to visit the plots

25 Summary Using TILLING we identified a splice acceptor site mutation in TaGW2-A which leads to increases in TGW in tetraploid (7%) and hexaploid wheat (10%) The increase is due to grains being both wider and longer supports previous studies that GW2 is a negative regulator of grain size Field trials for yield evaluation underway in silico TILLING will provide a powerful resource to rapidly access and combine alleles in wheat Kronos and Cadenza TILLING populations can be used for forward genetic screens

26 Acknowledgements Cristobal Uauy Peter Scott Teresa Mestre Max Bush Mario Caccamo Jorge Dubcovsky Sarah Ayling Ksenia Krasileva (TGAC) Christine Fosker Hans Vasquez-Gross Paul Bailey Alicia del Blanco Leah Clissold Ricardo Ramirez-Gonzalez Andy Phillips