Genetics and Resistance

Transcription

1 Genetis nd Resistne Development of Co-Dominnt Amplified Polymorphi Sequene Mrkers in Rie tht Flnk the Mgnporthe grise Resistne Gene Pi7(t) in Reominnt Inred Line 29 M. A. Cmpell, D. Chen, nd P. C. Ronld First nd third uthors: Deprtment of Plnt Pthology, University of Cliforni t Dvis, Dvis 95616; nd seond uthor: DNA LndMrks, Sint-Jen-sur-Rihelieu, Quee, J3B 6Z1, Cnd. Aepted for pulition 4 Novemer ABSTRACT Cmpell, M. A., Chen, D., nd Ronld, P. C Development of odominnt mplified polymorphi sequene mrkers in rie tht flnk the Mgnporthe grise resistne gene Pi7(t) in reominnt inred line 29. Phytopthology 94: Pi7(t), dominnt lst resistne gene derived from the rie ultivr Moroerekn, onfers omplete resistne ginst the fungl pthogen Mgnporthe grise. Pi7(t) previously ws positioned on hromosome 11 y restrition frgment length polymorphism (RFLP) mpping of reominnt inred line popultion. One derivtive of this popultion, reominnt inred line (RIL)29, ws designted s the representtive line for Pi7(t). A segregting F 2 popultion ws reted from RIL29 in order to determine the lotion of Pi7(t). The new mpping dt indite position for Pi7(t) 30 entimorgns distl to the originl lotion. Pi7(t) shres ommon position with the previously mpped Pi1 M. grise resistne gene. RIL29 rries DNA not derived from either prent used to rete the RIL popultion t the newly ssigned Pi7(t) lous. RFLP nlysis hs identified possile donor soure. The somyete Mgnporthe grise is present in nerly ll res of rie ultivtion nd is primry ioti soure of yield loss worldwide (15). The utiliztion of resistnt ultivrs is the most ost-effetive mens to mitigte disese losses. However, monogeni resistne ommonly is rendered ineffetive if frequeny of orresponding virulene lleles inreses in the pthogen popultion (15). Strtegies tht would rete more durly resistnt ultivrs presently re fousing upon the pyrmiding of resistne loi with differing resistne spetr into single ultivr through mrker-ssisted seletion (1). In order to suessfully generte resistne (R)-gene pyrmids, n urte mp position nd tightly linked mrkers re required for effiient mrkerssisted seletion strtegies. This report detils the geneti hrteriztion of mjor dominnt resistne gene. Over 30 M. grise resistne genes hve een positioned onto the rie lssil geneti mp (9). One of those resistne genes, Pi7(t), ws identified through sreening with M. grise nd restrition frgment length polymorphism (RFLP) mpping of reominnt inred line (RIL) popultion derived from ross etween the rie vs. Moroerekn nd CO39. Pi7(t) ws positioned on the long rm of hromosome 11 ner the teril light resistne lous X21 (19). Pi7(t) ws evluted with diverse M. grise isoltes to determine the effetive retion spetrum. Pi1, nother lst resistne lous present in C101LAC, hs lst retion spetrum identil to tht of Pi7(t) ut Pi1 nd Pi7(t) were not mpped to the sme position (7,14,19,21). C101LAC ws derived from ross etween rie vs. LAC23 nd CO39. Pi1 ws mpped in two independent reports using segregting popultions (14,21). In oth of these reports, Pi1 ws linked with mrkers ner the telomere on the long rm of hromosome 11 (14,21). Allelism tests performed using C101LAC Corresponding uthor: P. C. Ronld; E-mil ddress: pronld@udvis.edu Pulition no. P R 2004 The Amerin Phytopthologil Soiety rrying Pi1 nd RIL29 rrying Pi7(t) (14,21) indite tight linkge of Pi1 nd Pi7(t) (7). Beuse the positioning of Pi7(t) y RFLP mpping nd the llelism tests re in disgreement, we deided to mp Pi7(t) using segregting F 2 popultion. This report provides onlusive dt tht Pi7(t) is tightly linked to Pi1. Furthermore, our dt demonstrte tht RIL29, the representtive line for Pi7(t), rries nonprentl DNA (i.e., derived from neither Moroerekn nor CO39) t the genomi intervl spnning the Pi1/Pi7(t) lous. LAC23, the donor for Pi1, is the likely soure. MATERIALS AND METHODS Plnt mterils. All seed were otined from the Interntionl Rie Reserh Institute (IRRI). The RILs RIL29 nd RIL206 were derived from n initil ross etween Moroerekn nd CO39. Fifteen F 1 hyrids from Moroerekn nd CO39 ross were llowed to self to produe 300 F 2 individuls. The F 2 through F 6 genertions were reted y single-seed desent from the originl seleted F 2 individuls The F 2 lines were sored for omplete resistne with the PO6-6 isolte of M. grise (19). RIL29 ws identified s representtive line ontining the lous Pi7(t) (7). RIL206 ws used s positive ontrol euse this line hs mplified frgment length polymorphisms (AFLPs) sed Moroerekn mrkers ner the Pi1 lous (3; M. A. Cmpell, unpulished dt). RIL29 ws krossed to CO39. The F 1 hyrid ws llowed to self-pollinte. Fifty F 2 progeny were isolted from the F 1 hyrid nd inoulted with isolte PO6-6. These inoulted F 2 individuls were dvned to the F 3 genertion for phenotypi nlysis with the Philippine lst isolte PO6-6. Pthogen isoltes nd inoultion methods. The PO6-6 isolte of M. grise, whih hs een utilized previously in the initil hrteriztion of the RIL nd ner isogeni lines (NILs), ws used in this study (11). All resistne hrteriztion using PO6-6 of the F 2 nd F 3 plnts ws onduted t IRRI. Fifty F 2 plnts were grown in plsti try with Moroerekn, CO39, nd RIL29 s ontrols. For F 3 fmily resistne phenotype hrteri- 302 PHYTOPATHOLOGY

2 ztion, plsti trys (37 y 26 y 11 m) were divided into seven equl rows. The first six rows ontined 20 F 3 seedlings from eh of the F 3 fmilies. The seventh row ontined 10 CO39 nd 10 RIL29 seed. Plnts were fertilized with mmonium sulfte t rte of 6 g/kg of soil. Seedlings were grown in the greenhouse for 21 dys efore inoultion. Inoulum ws prepred s desried previously (4). Seedlings then were inoulted with onidi/ml with 0.02% Tween 20. Inoulum suspension (50 ml) ws spryed onto eh try nd then held in dew hmer t 25 C for 24 h. Seedlings then were moved to greenhouses t IRRI. DNA ws extrted from the individuls nd rought to the University of Cliforni (UC)-Dvis for moleulr hrteriztion. The PO6-6 isolte nnot e imported into Cliforni due to U.S. Deprtment of Agriulture restritions nd no inoultions were possile t UC-Dvis. Disese evlution. Disese retions were sored 7 dys postinoultion using the following sle: 0 = no evidene of infetion; 1 = rown spekling (<1 mm); 2 = rown speks (1 to 2 mm); 3 = round to elliptil lesions (2 to 4 mm) with gry enter nd rown mrgins; 4 = spindle-shped lesions with neroti enters, ple of sporultion; nd 5 = olesed type 4 lesions tht hve killed the mjority of the lef lde. Plnts with sores of 0 to 3 re onsidered resistnt nd sores of 4 to 5 indite suseptiility. DNA mnipultions. Totl rie DNA from eh of the F 2 nd F 3 individuls, Moroerekn, CO39, RIL29, RIL206, LAC23, nd C101LAC were extrted following the protools previously desried (13). Of the 50 F 2 individuls, three F 2 DNA smples were found to e degrded upon trnsport to UC-Dvis nd disrded from further moleulr hrteriztion. The F 3 DNA ws used to verify the F 2 genotype using o-dominnt mplified polymorphi sequene (CAPS) mrkers. Nipponre Kslth RFLP mrkers were otined from speifi primers using polymerse hin retion (PCR) exept C10150S, C481S, C105, C10295S, nd R543. These DNA sed mrkers were otined diretly from the Rie Genome Reserh Projet (RGP) s purified plsmids. These plsmids were trnsformed into DH5α hemilly ompetent ells nd mplified from liquid ultures with pproprite universl primers. For RFLP nlysis, 6 µg of genomi DNA ws digested in totl volume of 60 µl for 12 h. One-tenth of the retion volume ws run on mini-gel to verify digestion. The remining DNA ws seprted vi eletrophoresis in 0.9% grose gels nd trnsferred to Hyond N+ memrnes (Amershm Phrmi Bioteh, Pistwy, NJ) (without EtBr stining) using 0.4 N NOH. RFLP proes were generted from gel-purified PCR mplions (Qiogene, Montrel, Cnd) y the rndom hexmer leling method using γ- [ 32 P]dCTP. The memrnes were hyridized nd wshed y mnufturer s protools (Amershm). The wshed filters were visulized using Phosphoimger sreens (Moleulr Dynmis, Mountin View, CA). PCR mplifitions. CAPS mrkers were mplified using Tq polymerse uffer, 200 µm dntp, 1 mm primer, 100 to 200 ng of DNA, nd Tq polymerse (Promeg Corp., Mdison, WI). CAPS mrker development nd use hve een desried previously (8). All mplifitions were run on Tetrd thermoyler (MJ Reserh In., Wlthm, MA). All CAPS mrkers hd the following profile: prehet 94 C for 2 min, 40 (94 C for 45 s, vrile nneling temps [Tle 1] for 45 s, nd 1 min nd 45 s extension for 72 C). Amplifition yles were ompleted with 10-min exten- TABLE 1. Nme, position, ession numer, nd primer sets of ll rie mrkers developed nd evluted in this study Mrker Position origin Aession, nnel temperture ( C) Primer sets C M, RGP(YAC) TIGR TC56715, For, 60 5 AGAGCTCTAGGGTTTCCGCTGCCG 5 GAGTACTTAGGTTATTAGGCCTTC 22A M, CUGI(STC) OSJNB22A14f, For, 55 5 TTACAGTTCTTTTTATAAAGTAAG 5 TTGATACAAATCGTAATTACACAT R M, RGP(N/K) TIGR TC62909, For, 55 5 GATCAGGAAGATGCTGGAGAAGCT 5 CTCCTGGTCTCGTCGCTGTACAGCC C M, RGP(YAC) TIGR TC62275, For, 61 5 GTGCCATCCACGTATCCAACGAACG 5 AGATATATAACCATGTGTACACTAT C M, RGP(YAC) TIGR TC 66850, For, 58 5 TTCAAACGATCGATCGACAGGCATC 5 GAAATCACTGGAGCGGAGAGCTTC E M, RGP(YAC) GB AU030126, For, 58 5 CTCATTGGGCGTCGATGATCGAGA 5 AATACAGCATTGTATTCGATGACTG E50301S M, RGP(YAC) TIGR TC61223, For, 58 5 TCAAGTCTGTATCTGACAGCCCTTC 5 CATGGAACAGCTGTTCATATTCAGG R M, RGP(N/K) TIGR TC51900, For, 61 5 CTTGGAAGGTGCTAATCAGCATGTC 5 GTTATCTCGTGAGCTAGAAAGAGA 61M M, CUGI(STC) OSJNB61M17f, For, 58 5 CTGCAAGATGGAGTACTTACTGATA 5 GCCAACCTGATATGAATATTGTGGG S M, RGP(N/K) 5 GB D47425, For, 58 5 CAAGGTAGAAGTGAACAAGGTTAG 3 GB AU082171, 5 GTAAGTCACACAAGCTATGTTGCAC C10150 d M, RGP(N/K) GB D21990, For, C481S d M, RGP(N/K) GB D15341, For, C105 d M, RGP(N/K) GB D28177, For, C10295S d M, RGP(YAC) TIGR TC63186, For, R543 d M, RGP(N/K) TIGR TC56778, For, S M, RGP(YAC) TIGR TC58996, For, 56 5 GTGATAATGTTCTTGACACTGGAG 5 GTAAACCAACATTTTACGATGTAG Position in entimorgns (M). RGP(N/K) = restrition frgment length polymorphism (RFLP) mrker derived from the Rie Genome Reserh Projet (RGP) Nippore Kslth-sed geneti mp; CUGI(STC) = Clemson University Genomis Institute teril rtifiil hromosome (BAC) end sequene, whih is referred to s sequene tgged onnetor (STC); RGP(YAC) = DNAs whih were found to hyridize to single yest rtifiil hromosome (YAC). An ordered YAC rry previously ws developed nd positioned onto the Nipponre Kslth mp. For = forwrd, = reverse, = not pplile. = not pplile. d These RFLP mrkers were otined diretly from RGP in plsmids. No primer sets were developed. Vol. 94, No. 3,

3 sion t 72 C. All primers were otined from Operon Tehnologies, In., Almed, CA. Polymorphism sreens for CAPS mrkers. Eh primer set ws used to mplify genomi DNA from the prents (i.e., CO39 nd RIL29) in 10 seprte 50-µl retions. The 10 retions then were pooled for polymorphism surveys. In ll, 20 to 30 ommon restrition enzymes were used for eh mrker. From eh prent, PCR mplifition produt (15 µl) ws digested in 40-µl totl retion volume for 3 h t the mnufturer s speified temperture nd uffer onditions. Digestion produts were seprted vi eletrophoresis in 1.5% grose gel in Tris-ette EDTA (TAE) uffer nd visulized with ethidium romide under UV illumintion. F 2 nd F 3 nlysis using CAPS mrkers. All mplifitions from F 2 individuls with primer sets for CAPS mrkers hd 0-µl retion volume. Ten miroliters of ll F 2 PCR mplifitions were seprted vi eletrophoresis on 0.8% grose test gel in TAE uffer to ensure mplifition qulity. The F 2 PCR retion (20 µl) ws digested for 3 h t the mnufturer s speified temperture nd uffer onditions in totl retion volume of 50 µl. Digestion produts were seprted vi eletrophoresis in 1.5% grose gel in TAE uffer nd visulized fter stining with ethidium romide. Four to six F 3 progeny from eh F 2 prent were genotyped y CAPS mrkers to ensure onsisteny. RESULTS Phenotypi nlysis of 50 F 2 derived from the CO39 RIL29 ross. RIL29 is the representtive line for Pi7(t). Pi7(t) onfers omplete resistne to lst isolte PO6-6 nd RIL29 hs retion sore of 0. CO39 showed omplete suseptiility, with retion sores of 4 or 5. Moroerekn ws ompletely resistnt to PO6-6 with retion sore of 0. RIL29 ws krossed to CO39 to generte n F 2 mpping popultion. The F 2 popultion of 50 individuls ws sored diretly with PO6-6 nd found to follow the predited 3:1 phenotypi segregtion rtio for single dominnt gene. In the F 2 phenotypi nlysis, there were 41 resistnt nd 9 suseptile individuls. The χ 2 sum for this F 2 nlysis ws 1.4 (P = 0.25). Eh of the F 2 individuls ws dvned to F 3 for further resistne phenotype onfirmtion. F 3 progeny from eh of the F 2 progenitors were sored with PO6-6 nd used to verify the disese sores otined from the F 2 inoultion. The segregtion rtios for the three genotypes in the F 3 fmilies were 19 homozygous resistnt (RR), 22 heterozygous (RS), nd 9 homozygous suseptile (SS). The χ 2 sum for 1:2:1 rtio ws 4.8 (P = 0.09). Within eh heterozygous F 3 popultion, the resistne nd suseptile rtios fit the predited 3:1 segregtion rtio nd the χ 2 nlysis ws onsistent within ll heterozygous F 3 fmilies. These results supported the hypothesis tht RIL29 possesses single dominnt lous for resistne to the lst isolte PO6-6. Resistne to M. grise isolte PO6-6 in RIL29 is loted on hromosome 11. Both Pi1 nd Pi7(t) initilly were mpped using hromosome mrker set derived from the mpping popultion developed t Cornell in the lte 1980s nd erly 1990s (17). However, ll mrkers used in this report re derived from the highdensity RFLP mp developed y the Nipponre nd Kslth ross (5). Susequent to the retion of the Nipponre Kslth mp, tiled teril rtifiil hromosome (BAC) rry ws developed using Nipponre (22). Pi1 is tightly linked with the Cornell mrkers G181 (derived from the RFLP mrker XNp181) nd RZ536 (21). G181 ws inorported s n RFLP mrker into the Nipponre Kslth mp t position entimorgns (M). Sequene nlysis showed tht the Cornell-sed mrker RZ536 shres ext sequene identity with the Nipponre Kslth RFLP mrker S S10003 is found t M on the Nipponre Kslth-sed mp (Fig. 1). To verify tht Pi7(t) ws indeed on hromosome 11, CAPS mrker ws developed using the DNA-sed RFLP mrker S S12886 is positioned on the Nipponre Kslth mp t M. Primers were designed from the two ends of the DNA sequene (GenBnk entries AU nd D47425 for the 5 nd 3 ends, respetively) for S The mplion from genomi DNA ws pproximtely 1,200 p in length for the prentl vs. Moroerekn nd CO39 s well s their derivtive, RIL29. HpII ws found to digest the CO39 into two frgments nd left oth the Moroerekn nd the RIL29 lleles undigested. If the llelism test results for tight linkge of Pi1 nd Pi7(t) re urte, then the S12886 CAPS mrker should show tight linkge with the F 2 PO6-6 resistne genotype. Ext o-segregtion ws found etween the CAPS mrker derived from S12886 nd the resistne lous Pi7(t) for the 47 F 2 individuls from the CO39 RIL29 popultion. Four to six F 3 progeny of these 47 F 2 prents lso were genotyped with the S12886 CAPS mrker nd onfirmed the F 2 genotype. Therefore, (i) Pi7(t) is on hromosome 11, (ii) the originl hromosoml ssignment of Pi7(t) is inorret, (iii) Pi7(t) mps to the sme lotion s the resistne lous Pi1, nd (iv) the onflit etween the moleulr nd geneti mps is resolved. To refine this nlysis, new set of CAPS mrkers ws developed t the Pi1 lous. The mrkers were derived from two soures: Fig. 1. A, Reltive mp positions of Pi1 nd Pi7(t) on the long rm of hromosome 11 using the Cornell mrkers from the 1992 high-density mp. B, Mp of the Pi1 lous using the Rie Genome Reserh Projet (RGP) mrkers from the Nipponre Kslth high-density lssil mp, yest rtifiil hromosome (YAC) positive restrition frgment length polymorphism (RFLP) mrkers, nd the teril rtifiil hromosome (BAC)-end sequene mrkers. 61M17 represents BAC tht ws positioned on the ordered BAC rry etween the RGP mrkers R1506 nd S Note tht RZ536 from the Cornell-sed mp hs ext sequene identity with the Nipponre Kslth RFLP mrker S PHYTOPATHOLOGY

4 (i) sequene of the RFLP mrkers from the Nipponre Kslth mp (5) nd (ii) the sequene tgged onnetor (STC) mrkers derived from the end sequene of tiled Nipponre BAC ssemly (22). The hromosoml rrngement of ll mrkers utilized in this study re illustrted in Figure 1 nd detiled in Tle 1. The originl ross to generte the RILs utilized uplnd jponi v. Moroerekn nd suseptile indi v. CO39. The intersuspeies ross ws predited to possess suffiiently high rtes of polymorphism to effiiently generte CAPS mrkers. Eight CAPS mrkers, inluding S12886, were found t the Pi1 lous. Tle 2 detils the CAPS polymorphisms. In ddition to S12886, three CAPS mrkers were seleted for mpping Pi7(t). The mrkers 22A14, R251, nd C30662 were pplied to the segregting F 2 popultion nd spnned 7-M intervl on hromosome 11. R251 nd C30662 re DNA-sed RFLP mrkers from the Nipponre Kslth mp t M (Fig. 1) STC sequene from BAC lone OSJNB0089D23 is identil to the Nipponre Kslth RFLP mrker C950. The mrker 22A14 hs een shown to hyridize to single digestion frgment using n EoRI digestion of the BAC OSJNB0089D23 (dt not shown). Therefore, C950 nd 22A14 re shown t the sme lotion on the geneti mp. The CAPS mrkers 22A14 (110.0 M), R251 (112.9 M), nd C30662 (112.9 M) showed no reominnts when ompred with one nother when pplied to the CO39 RIL29 F 2 popultion of 47 individuls. Eh of these mrkers showed the sme five reomintion events for 94 meioti events (47 F 2 individuls) when ompred with the F 2 genotype for Pi7(t) otined from inoultion of the F 3 progeny. S12886 showed no reomintion events with the F 2 genotype for Pi7(t) (Tle 3). These results led to the onlusion tht the Pi7(t) resistne lous is positioned etween the RGP mrkers R251 nd C30662 (112.9 M) nd the telomere (Fig. 1). The origin of Pi7(t). The resistne in RIL29 should e derived from the Moroerekn prent. However, the three nonprentl CAPS polymorphisms in Tle 2 would e diffiult to explin if RIL29 ws indeed the produt of solely Moroerekn nd CO39. RIL29 mplions of 22A14, R251, nd C30662 ll show nonprentl polymorphisms with respet to the two prentl ultivrs (Moroerekn nd CO39). Thus, during the development of RIL29, nonprentl DNA ppers to hve een inorported. To ssess the soure of the nonprentl DNA, Southern lots using 12 mrkers linked with the Pi1/Pi7(t) lous were performed on six ultivrs: CO39, Moroerekn, RIL29, RIL206, LAC23, nd C101LAC. LAC23 nd the representtive NIL for Pi1, C101LAC, were inorported due to the identil lst retion profiles of Pi1 nd Pi7(t) to diverse set of M. grise isoltes (6). RIL206 ws inorported s positive ontrol. RIL206 hs Moroerekn lleles t the region flnking Pi1 (3; M. A. Cmpell, unpulished dt). The reltive order of these RFLP mrkers on the geneti mp is provided in Figure 1 nd the results of the RFLP nlysis re provided in Tle 4. A representtive Southern lot for the mrker C30662 is provided in Figure 2. The results of the RFLP nlysis re onsistent with the hypothesis tht the RIL29 genome is not exlusively derived from the prents Moroerekn nd CO39. The RFLP ptterns oserved in RIL29 indite the presene of nonprentl lleles (e.g., the hyridiztion ptterns re polymorphi when ompred with Moroerekn nd CO39). For suset of the mrkers, the nonprentl hyridiztion ptterns in RIL29 nd the hyridiztion ptterns in LAC23 re monomorphi. In evluting the RFLP mrkers 22A14, C30662, C10150S, C481S, nd S10640, ll show monomorphism etween RIL29 nd LAC23. Further, RIL29 is polymorphi for these mrkers with respet to its prents CO39 nd Moroerekn. These results suggest tht, during the retion of RIL29, nonprentl DNA ws inorported into the genome where the RIL29-derived resistne lous ws mpped. The most likely origin for this geneti mteril is v. LAC23. DISCUSSION In order to urtely position the resistne lous derived from RIL29, new segregting popultion nd new PCR-sed CAPS mrkers were developed. The reomintion dt from these CAPS mrkers pplied to the popultion support the positioning TABLE 2. Co-dominnt mplified polymorphi sequene mrkers developed for the mpping of Pi7(t) in rie F 2 popultion derived from ross etween CO39 nd Moroerekn Lengths of digestion produts for ultivrs Mrker Length CO39 RIL29 Moroerekn Enzyme C950 2,000 2,000 1, ,100 ClI 22A BlI R251 1, , HeIII C AvI C , (200 2) 1, , DrI E ,000 1, NdeI 61M17 1,000 1, n.d. PvuII S , ,200 1,200 HpII Approximte size of the mplion is given (whih ws the sme for ll three ultivrs) nd the resultnt digestion produts produing the polymorphism. All lengths re in se pirs. The Moroerekn mplion ws not tested for digestion with PvuII. TABLE 3. Genotypes of the five F 2 reominnts nd the numer of reomintions displyed for eh mrker for the smll F 2 popultion (47 F 2 individuls) F 2 individul Mrker Mrker A14 R251 C30662 S12886 Pi7(t) 22A14 CC RC RC RC RC n/ R251 CC RC RC RC RC n/ C30662 CC RC RC RC RC n/ 5 5 S12886 RC RR RR CC RR n/ 0 Pi7(t) RC RR RR CC RR R nd C indite the lleles from the resistnt (RIL29) nd suseptile (CO39) prent, respetively. n/ = Not pplile. Pi(t)is the genotype of the F 2 individul determined y the phenotypi inoultion sreen of the F 3 progeny. Vol. 94, No. 3,

5 TABLE 4. Restrition frgment length polymorphism (RFLP) hyridiztion ptterns nd mirostellite sores re given for six ultivrs Cultivrs used for RFLP nlysis Mrker Enzyme CO39 Moroerekn RIL29 RIL206 LAC23 C101LAC 22A14 RI,H3 CO39 CO39 LAC23 CO39 LAC23 N.S.P. C30662 RI,H3,RV CO39 CO39 LAC23 CO39 LAC23 LAC23 E50658 RI,H3 CO39 CO39 CO39 CO39 CO39 CO39 R1506 SI CO39 Moroerekn N.S.P. N.D. N.D. N.D. S12886 H3 CO39 Moroerekn Moroerekn N.S.P. Moroerekn N.S.P. C10150S H3 CO39 Moroerekn LAC23 Moroerekn LAC23 N.S.P. C481S H3 CO39 Moroerekn LAC23 Moroerekn LAC23 N.D. C105 RI,H3 CO39 CO39 CO39 CO39 CO39 CO39 C10295S H3 CO39 Moroerekn Moroerekn Moroerekn Moroerekn Moroerekn R543 RI CO39 Moroerekn CO39 CO39 Moroerekn Moroerekn S10640 H3,RV CO39 CO39 LAC23 CO39 LAC23 LAC23 Any ptterns tht were monomorphi etween ultivrs were listed s the first ultivr to show tht pttern. N.S.P. = no similr polymorphism; the ultivr possessed unique RFLP pttern when ompred with the other five ultivrs in this RFLP nlysis. N.D. indites tht n RFLP nlysis ws not performed. Enzymes used for this RFLP polymorphism nlysis were EoRI (RI), HindIII (H3), nd EoRV (RV). Fig. 2. Representtive restrition frgment length polymorphism (RFLP) nlysis using the RFLP mrker C Six ultivrs were digested with EoRI (left side) nd HindIII (right side). Cultivrs: 1 = CO39, 2 = Moroerekn, 3 = RIL29, 4 = RIL206, 5 = LAC23, nd 6 = C101LAC. of Pi7(t) on hromosome 11. Pi7(t) shres ommon position with the previously mpped Pi1 lst resistne gene. This ssignment of the Pi7(t) lous onfirms the results from previous llelism tests using the representtive lines C101LAC nd RIL29 (7). Surprisingly, the ssumption of Moroerekn s the donor of Pi7(t) in RIL29 hs een lled into question. The genertion of CAPS mrkers from the Nipponre Kslth RFLP mp nd Nipponre BAC end sequene reveled the presene of nonprentl polymorphisms for three of the eight mrkers. Simultneous muttion of three tightly linked mrkers in the retion of the RILs seems unlikely. The geneti intervl ontining the Pi1/ Pi7(t) lous hs DNA from nonprentl soure. A similr result ws oserved in the mpping of Pi44(t) tht ws identified from this sme Moroerekn- nd CO39-derived RIL popultion (2). Pi44(t) is loosely linked to Pi7(t)/Pi1 on the long rm of hromosome 11. For the Pi44(t) representtive line RIL276, AFLP-derived o-segregting mrker AF348 nd the mirostellite mrker RM224 showed nonprentl nding ptterns when ompred with Moroerekn nd CO39. No other ultivr ws identified s the donor of the nonprentl DNA in RIL276 ontining Pi44(t) (2). In this report, the RFLP-sed hrteriztion of the six ultivrs onfirms the hypothesis tht RIL29 hs nonprentl geneti mteril t the Pi7(t)/Pi1 lous. Beuse RIL29 shres lleles with LAC23 nd the NIL derivtive C101LAC, LAC23 is the most likely soure for the nonprentl lleles. The nonprentl polymorphisms in RIL29 s well s the work with RIL276 present ommon prolem in developing pure lines s well s shring mterils. The introdution of foreign (i.e., nonprentl) DNA in n inreeding speies, suh s rie, mens tht genotyping of dvned lines must e n essentil step efore relese. In the se of Pi7(t) reserh, NILs were eing developed t IRRI onurrently with the CO39- nd Moroerekn-derived RILs. LAC23, the donor of Pi1, likely ws inorported identlly into the RIL lines, lthough LAC23 hs not een proven s the soure of the nonprentl DNA. The region surrounding the Pi7(t)/Pi1 lous is known to e rih soure of R gene homologues. Severl degenerte PCR strtegies hve independently identified nuleotide-inding site leuine-rih repet (NBS/LRR) homologue lusters tht mp to tightly linked positions with respet to Pi1 (10,12). Further, n ordered nlysis, y the uthors, of ll STC sequenes using TIGR BLAST hs shown tht lrge numer of NBS/LRR sequenes exist in lusters long this intervl. For the intervl etween C950 nd R1506, 20 NBS-LRR homologues were identified with homology to fmily memers R2, R3, R6, nd R10 (10). Not only does the telomeri intervl on the long rm of hromosome 11 rry high onentrtion of NBS-LRR homologous sequenes, ut it lso rries multiple resistne speifiities. For exmple, X4, teril light resistne gene, ws tightly linked with RGP mrker L1044, whih is positioned etween C950 nd R251 (20). Severl other M. grise nd teril light resistne loi (Pi-f, X3, nd Pi18(t)) hve een positioned ner the Pi1/Pi7(t) lous (16,20). Interestingly, the multi-lleli M. grise resistne lous, Pik, hs een demonstrted y llelism tests to e tightly linked to Pi1. Pik showed tight linkge with RFLP mrker G181 (7). Using diverse lst isoltes from the Philippines, the retion spetrum for Pi1 (in C101LAC), Pi7(t) (in RIL29), nd Pik were shown to e identil (18). Therefore, Pi1 nd Pi7(t) tully my prove to e lleles or identil to Pik. In the proess of mpping Pi7(t), new PCR-sed CAPS mrkers quikly were generted. These mrkers will e useful for susequent fine mpping of the Pi7(t) lous. Furthermore, these CAPS mrkers re useful for reeders wishing to inorporte this lous into their reeding progrms. Although the positioning of the Pi7(t) to the Pi1 lous ws suessful, the nonprentl polymorphisms indite tht the donor ultivr for this resistne gene presently is unler. Susequent fine mpping will e required to lerly identify the origin nd position of Pi7(t) in geneti intervl rih with resistne gene homologues. ACKNOWLEDGMENTS We thnk D. Chen, D. Mkill, H. Tsunemtsu, nd G. L. Wng for their reful review of the mnusript; C. Drdik for his ssistne on CAPS mrker design; nd J.-S. Jeon for his tehnil ssistne. All experiments were onduted in strit ompline with the lws of the ountry in whih the experiments were performed. LITERATURE CITED 1. Cmpell, M. A., Fitzgerld, H. F., nd Ronld, P. C Engineering resistne in rop plnts. Trns.. 11: PHYTOPATHOLOGY

6 2. Chen, D. H., del Vin, M., Inuki, T., Mkill, D. J., Ronld, P. C., nd Nelson, R. J Moleulr mpping of the lst resistne gene, Pi- 44(t), in line derived from durly resistnt ultivr. Theor. Appl. Genet. 98: Chen, D. H., Nelson, R. J., Wng, G. L., Mkill, D. J., nd Ronld, P. C Use of DNA mrkers in introgression nd isoltion of genes ssoited with durle resistne to rie lst. Pges in: DNA- Bsed Mrkers in Plnts. R. L. Phillips nd I. K. Vsil, eds. Kluwer Ademi Pulishers, Dordreht, the Netherlnds. 4. Chen, D. H., Zeigler, R. S., Leung, H., nd Nelson, R. J Phenotypi hrteriztion of the rie lst resistne gene Pi-2(t). Plnt Dis. 80: Hrushim, Y., Yno, M., Shomur, A., Sto, M., Shimno, T., Kuoki, Y., Ymmoto, T., Lin, S. Y., Antonio, B. A., Pro, A., Kjiy, H., Hung, N., Ymmoto, K., Ngmur, Y., Kurt, N., Khush, G. S., nd Sski, T A high-density rie geneti linkge mp with 2275 mrkers using single F 2 popultion. Genetis 148: Inuki, T., Nelson, R. J., Zeigler, R. S., Srkrung, S., Mkill, D. J., Bonmn, M., Tkmure, I., nd Kinoshit, T Allelism of lst resistne genes in ner-isogeni lines of rie. Phytopthology 84: Inuki, T., Zeigler, R. S., Srkrung, S., Bronson, M., Dung, L. V., Kinoshit, T., nd Nelson, R. J Development of pre-isogeni lines for rie lst resistne y mrker-ided seletion from reominnt inred popultion. Theor. Appl. Genet. 93: Koniezny, A., nd Ausuel, F. M A proedure for mpping Aridopsis muttions using o-dominnt eotype speifi PCR-sed mrkers. Plnt J. 4: Kinoshit, T Linkge mp using mutnt genes in rie. Rie Genet. Newsl. 15: Leister, D., Kurth, J., Lurie, D. A., Yno, M., Sski, T., Devos, K., Grner, A., nd Shulze-Lefert, P Rpid reorgniztion of resistne gene homologues in erel genomes. Pro. Ntl. Ad. Si. USA 95: Mkill, D. J., nd Bonmn, M Inheritne of lst resistne in ner-isogeni lines of rie. Phytopthology 82: Mgo, R., Nir, S., nd Mohn, M Resistne gene nlogues from rie: Cloning, sequening, nd mpping. Theor. Appl. Genet. 99: MCouh, S. R., Kohert, G., Yu, H., Wng, Z. Y., nd Khush, G. S Moleulr mpping of rie hromosomes. Theor. Appl. Genet. 76: Mew, T. V., Pro, S. A., Hittlmni, S., Inuki, T., Nelson, R. J., nd Zeigler, R. S Fine mpping of mjor genes for lst resistne in rie. Rie Genet. Newsl. 11: Ou, S. H Rie diseses. Commonwelth Agriulturl Bureux, Wllingford, UK. 16. Sllud, C., Lorieux, M., Roumen, E., Thrreu, D., Berruyer, R., Svestsrni, P., Grsmeur, O., Ghesquiere, A., nd Notteghem, J.-L Identifition of five new lst resistne genes in the highly lst-resistnt rie vriety IR64 using QTL mpping strtegy. Theor. Appl. Genet. 106: Tnksley, S. D., Cusse, M., Fulton, T., Ahn, N., Wng, Z., Wu, K., Xio, J., Yu, Z., Seond, G., nd MCouh, S. R A high-density moleulr mp of the rie genome. Rie Genet. Newsl. 9: Tsunemtsu, H., Ynori, J. T. Y., Eron, L. A., Hyshi, N., Ando, I., Kto, H., Ime, T., nd Khush, G. S Development of monogeni lines of rie for lst resistne. Breed. Si. 50: Wng, G. L., Mkill, D. J., Bonmn, J. M., MCouh, S. R., Chmpoux, M. C., nd Nelson, R. J RFLP mpping of genes onferring omplete nd prtil resistne to lst in durly resistnt rie ultivr. Genetis 136: Wng, W., Zhi, W., Luo, M., Jing, G., Chen, X., Li, X., Wing, R. A., Zhu, L Chromosome lnding t the teril light resistne gene X4 lous using deep overge rie BAC lirry. Mol. Gen. Genom. 265: Yu, Z. H., Mkill, D. J., Bonmn, J. M., nd Tnksley, S. D Tgging genes for lst resistne in rie vi linkge RFLP mrkers. Theor. Appl. Genet. 81: Yun, Q., Ling, F., Hsio, J., Zismnn, V., Benito, M. I., Qukenush, J., Wing, R., nd Buell, R Anhoring of rie BAC lones to the rie geneti mp in silio. Nulei Aids Res. 28: Vol. 94, No. 3,