Transformation of HBsAg (Hepatitis B Surface Antigen) Gene into Tomato Mediated by Agrobacterium tumefaciens

Size: px
Start display at page:

Download "Transformation of HBsAg (Hepatitis B Surface Antigen) Gene into Tomato Mediated by Agrobacterium tumefaciens"

Transcription

1 Trnsformtion of HBsAg (Heptitis B Surfe Antigen) Gene into Tomto Medited y Agroterium tumefiens Tin Li, Jing Kun Sun, Zho Hu Lu nd Qing Liu Shndong Provinil Key Lortory of Eo-Environmentl Siene for Yellow River Delt, Binzhou University, Binzhou, Chin Astrt: The plnt expression vetor pbrsag ws onstruted s suitle for trnsformtion vi Agroteriummedited pproh. It ontins ll elements for plnt expression, suh s CMV 35S promoter, oth left nd right order sequene for trnsferred DNA (T-DNA) in Agroterium, plnt reporter gene gus, nd plnt seletion mrker gene hpt. The reominnt inry vetor pbrsag ws trnsformed into Agroterium tumefiens strins y using the freeze-thw method. Tomto otyledon explnts were trnsformed y A. tumefiens nd plnts were regenerted on seletion medium. GUS stining, PCR nd PCR-Southern nlysis of the plnts were positive. It ws for the first time shown tht the HBsAg (heptitis B surfe ntigen) gene ws introdued into tomto plnts. The expression of trnsgene is under investigtion. Keywords: Agroterium; HBsAg gene; tomto; trnsformtion With the development of gene engineering tehnology, the study of using gene modified plnts to produe vines nd meditions hs eome hot spot. Plnt-sed vines hve ttrted the ttention of worldwide sholrs for its sfety nd eonomy, most of whih hve een expressed through geneti trnsformtions nd hve shown stisftory effets nd hve een put into ommeril prodution, suh s the vines of Heptitis B (Mson et l. 1992), pulmonry tuerulosis (Rigno et l. 6), ries (Modelsk et l. 1998), mesles virus (Bouhe et l. 3) et. Heptitis B virus (HBV) is glol disese. It n e trnsmitted y lood nd ody fluid nd its pthogenesis is omplex. With the inresing infetion of HBV, it hevily thretens people s helth. Epidemiologil dt revel tht there re out 36 million rriers of heptitis B virus throughout the gloe nd 78% of the world popultions hil from Asi (Behl et l. 8). Nowdys, n injetion of HBV vine is the only eonomi nd effetive wy to ontrol this disese. The ommerilly ville HBV vine is yest-derived nd the high ost hs led to the reserh for heper nd sfer methods to produe effetive heptitis B vines (Higshihshi et l. 1991; Shodel et l. 1994). Although vst mount of informtion is ville out the gene trnsformtion of heptitis B surfe ntigen (HBsAg), there re still mny truths to seek. Suessful tretment of HBV rriers with HBsAg plnt vine from plnts must hve enefiil effet on regions without fvourle environmentl snittion. Geneti engineering n e used to produe desirle gronomi trits quikly nd effiiently, nd lso to introdue genes enoding high-vlue reominnt proteins (Arokirj et l. 2). In omprison with the trditionl expression systems, plnt-derived heptitis B vine hs ttrted the ttention of the phrmeutil industry for resons of sfety nd eonomy (Wlmsley & 69

2 Arntzen ). In the experiment with mie nd humn eings, prenterl immuniztion of plntderived heptitis B surfe ntigen stimulted B nd T ell immune responses similr to those found with ommeril yest-derived heptitis B vine (Thnvl et l. 1995). So, it is fesile to produe heptitis B vine vi trnsgeni plnts. The ojetive of presented study ws to trnsform tomto s ndidte rop for edile vine prodution with HBsAg gene vi Agroteriummedited pproh. MATERIALS AND METHODS Plnt mteril The seeds of tomto Yugung 41 were purhsed from the Ademy of Agriulturl Sienes in Fujin Provine. The seeds were surfe sterilized with 75% lohol for 4 6 s nd wshed 3 4 times in sterilized distilled wter. Then the seeds were sterilized with 2% NClO for min nd wshed gin. Finlly, the seeds were sown nd germinted on hlf-strength Murshige nd Skoog (1962) (MS) medium. The otyledons of germinted seedlings were isolted, their pil prts were removed nd otyledons were setioned trnsversely into two segments. Plsmids psprok, pcambia-131, nd pbsag were preserved in our lortory, of whih the plsmid psprok ontins CMV35s promoter nd nos termintor, plsmid pcambia-131 ontins hyg-resistne gene, kn-resistne gene nd gus gene, nd plsmid pbsag ontins the 681 p DNA frgment (nmed HBsAg). The frgment ontining P35s-Tnos ws isolted y gel extrtion from plsmid psprok fter EoR I nd Hind III restritive digestion nd inserted into plsmid pcambia-131, whih hd een digested y the sme restrition endonulese to yield the reonstruted plsmid pcbrok. A 681 p DNA frgment nmed HBsAg ws otined y gel extrtion from plsmid pbsag fter X I nd Kpn I restritive digestion nd then suloned into plsmid pcbrok, whih hd een digested y the sme restrition endonulese to yield the reonstruted plnt inry expression plsmid pbrsag (Figure 1). All plsmids were isolted y the lkline lysis method nd purified y phenol nd hloroform extrtion (Smrook et l. 1989). Agroterium strin The A. tumefiens strins LBA444, EHA5 nd C58 were trnsformed with the reominnt inry vetor pbrsag vi the freeze-thw method (Hofgen & Willmitzer 1988). Trnsformnts were seleted on LB gr (sein enzymi hydrolyste mg/l, yest extrt 5 mg/l, sodium hloride 5 mg/l) plte ontining knmyin 5 mg/l (Sigm, St. Louis, USA), rifmpiin 5 mg/l nd streptomyin mg/l (Shndong Xinhu Phrmeutil Compny, Zio, Chin)nd the resistnt olonies were verified y restrition enzyme digestion nd used in trnsformtion experiments. Agroterium medited trnsformtion nd multiplition of trnsgeni plnts Tomto otyledon explnts were pre-ultivted on MS medium with 6-BA 2. mg/l nd IAA.2 mg/l (Shnghi Chemil Regent Compny, Shnghi, Chin) for 2 dys, then they were trnsformed y A. tumefiens with pbrsag. The otyledon explnts fter o-ultivtion for 2 dys on MS with 6-BA Constrution of plnt expression vetors Figure 1. Struture of plsmid pbrsag 7

3 2. mg/l nd IAA.2 mg/l were trnsferred to MS seletion medium with 6-BA 2. mg/l, IAA.2 mg/l, timentin mg/l (SmithKline Beehm Phrmeutils, Worthing, UK) nd hygromyin 7 mg/l (Sigm, St. louis, USA). Shoots were generted from the trnsformed llus on seletion medium fter 4 5 weeks. The shoots whih grew into 2 3 m were trnsferred for rooting on MS with IAA.5 mg/l, timentin mg/l nd hygromyin 7 mg/l. The rooting plnts growing into plntlets were trnsplnted into soil. GUS stining Both trnsformed nd untrnsformed of tomto plnts were immersed into GUS retion uffer for 12 to 24 h t 37 C nd then lehed with solute lohol for 3 5 h. Moleulr nlysis PCR nlysis. The modified method of CTAB (Stewrt & Vi 1993) ws used to extrt the genomi DNA of trnsgeni tomto plnts nd untrnsformed tomto plnts. PCR method ws used to onfirm the trnsgene integrtion into the GUS positive puttive trnsformnts. The primer pirs were: forwrd: 5 -CGCAGTCCCAAATCTCC-3, nd reverse: 5 -TGGTAACAGCGGCATAAA-3. ml of PCR mix ontined 25 ng of genomi DNA s templte, mm of eh primer,.3 ml of Tq DNA polymerse (5 U/ml) (Tkr, Dlin, Chin), 1.8 ml of eh dntp (2.5mM), 2. ml of PCR uffer. Cyling prmeters were t 94 C for 6 min, followed y 35 yles t 94 C for 1 min, 52 C for 1 min, nd t 72 C for 1 min, nd finl extension t 72 C for min, 4 C preservtion. Southern nlysis of PCR produts. PCR-Southern lotting ws rried out to further verify the integrtion of the trget gene (HBsAg) into the genome of tomto plnts. The lotting nd susequent hyridiztion were rried out ording to Smrook et l. (1989). Sttistil nlysis All dt on the trnsformtion frequeny represent the men vlues of three independent experiments with minimum of 5 explnts per tretment. RESULTS AND DISCUSSION Effets of mjor ftors on tomto trnsformtion The geneti trnsformtion medited y Agroterium is omplited proess whih is influened y mny prmeters suh s Agroterium strin (Crne et l. 6), explnt genotype (Chen et l. 8), o-ultivtion durtion (Brik et l. 5) nd signl moleules (Sthel et l. 1985). High-frequeny trnsformtion relies on the highly effiient T-DNA delivery from Agroterium into plnt ells (Ko et l. 3). Different strins of A. tumefiens vry in their trnsforming ilities. A omprtive study ws performed on the intertion of three different A. tumefiens strins (LBA444, EHA5 nd C58). Aording to the results of the GUS expression frequeny, A. tumefiens strin LBA444 ws found to e the most suitle, s GUS expression ws the highest (21%) in these explnts when ompred to EHA5 nd C58 (Figure 2A). So A. tumefiens strin LBA444 ws used in ll susequent experiments. The results were in line with those of Bhtthrjee et l. (). In their study, three different Agroterium strins (LBA444, EHA5 nd AGL1) were used nd the highest numer of lue-stined tissue tivity ws otined from the puttive trnsgeni tissue infeted y LBA444 strin. Figure 2B shows omprison of the trnsformtion frequeny fter different infetion time. The trnsformtion frequeny ws inresed with the infetion time inresing from to min. Results showed tht the -min infetion time in the presene of Agroterium produed the highest perentge of GUS positive explnts (19.6%). However, teri grew on the seletion medium signifintly t the time eyond min nd the trnsformtion frequeny ws ritilly redued. The results indited tht too short infetion time ws not fvourle for trnsformtion. However, too long infetion time resulted in the overgrowth of Agroterium nd therefore it ws hrmful to explnts (Shivni et l. ). Bteril onentrtion plys n importnt role in the prodution of trnsformnts. More nerosis of explnts ws seen t the highest onentrtions of teri for ll ultivrs. There ws signifint liner reltionship etween the perentge of neroti explnts nd teril onentrtion, 71

4 nd there ws signifint intertion of ultivr with teril onentrtion (Dvis et l. 1991). Our results showed tht the trnsformtion frequeny ws inresed signifintly s the teril onentrtion rose from.1 to.4 (OD 6 ), while the trnsformtion frequeny ws redued s the teril onentrtion rose from.6 to 1. (OD 6 ) (Figure 2C). The results were similr to those of Sini nd Jiwl (7), who reported tht higher Agroterium onentrtions ould (A) GUS frequeny (%) 4 3 (B) d LBA444 EHA5 C Bteril strin Infetion time (min) (C) GUS frequeny (%) e d d (D) Bteril onentrtion (OD 6 ) Co-ultivtion time (dys) (E) 4 GUS frequeny (%) 3 d 3 As onentrtion (mg/l) Figure 2. Effet of vrious ftors on the trnsformtion effiieny (GUS positive expression); (A) effet of A. tumefiens strins on trnsformtion frequeny, (B) effet of infetion time on trnsformtion frequeny, (C) effet of A. tumefiens ell density on trnsformtion frequeny, (D) effet of o-ultivtion time on trnsformtion frequeny, (E) effet of AS onentrtion on trnsformtion frequeny; mens of trnsformtion frequenies were ompred using Fisher s LSD test (P <.5) nd the sme letters re not signifintly different 72

5 led to hypersensitive responses of explnts. Thus, reltively lower inoulum density improved the trnsformtion effiieny nd redued the Agroterium overgrowth in this study. Co-ultivtion is very importnt in the trnsformtion proess. Bteri tthment, T-DNA trnsfer nd integrtion were rried out during this stge, whih ould e elerted y supplementing some ingredients to the o-ultivtion medium or prolonging o-ultivtion so tht it ould e terminted suessfully (Brik et l. 5). The influene of o-ultivtion on Agroterium-medited trnsformtion hs een reported in numer of plnt speies (Bnerjee et l. 2; Mohn & Krishnmurthy 3). In our study, the highest GUS expression frequeny ws oserved with 2-dy o-ultivtion nd it ws remrkly different from the other o-ulture durtion (Figure 2D). Two dys were lso onfirmed s the optimum o-ultivtion durtion wheres 3-dy o-ultivtion might use the overgrowth of A. tumefiens leding to dmge of the plnt ells nd onsequently resulting in low trnsformtion frequeny. On the other hnd, shorter o-ultivtion time might disrupt A. tumefiens ell prolifertion, therey reduing its virulene nd leding to low trnsformtion frequeny. Some relitrnt plnt speies n e trnsformed y induing the vir genes of the teri y signl moleules or in vitro y o-ultivtion of Agroterium with wounded tissue or in medi tht ontin signl moleules (Sthel et l.1985). Aetosyringone (As) or relted ompounds funtioning s signl moleules hve een reported to improve the Agroterium-medited trnsformtion in severl plnt speies (Šváová & Grig 8; Wng et l. 9). In our study, mg/l nd mg/l As signifintly improved tomto trnsformtion effiieny, while 3 mg/l As signifintly redued tomto trnsformtion effiieny, the mximum frequeny of trnsformtion ws oserved t mg/l As (Figure 2E). Our experiments showed tht tomto trnsformtion effiieny ws enhned under low As onentrtion, ut it ws redued under high As onentrtion. The present results were in line with those of Priy & Shivendr (9). Trnsformed plnts were seleted on the sis of their resistne to hygromyin. The integrtion of trnsgene in different lines ws onfirmed y GUS stining. Tken together, tomto shoot prodution under the optiml onditions determined ove ws onduted: strin LBA444,.4 teril onentrtion (OD 6 ), -minute infetion, o-ultivtion for 2 dys nd mg/l etosyringone. Regenertion nd GUS stining of trnsgeni plnts Trnsformed tomto otyledon explnts showed the development of shoots on the hygromyin seletion medium. The shoots were exised nd ultured on rooting medium with 7 mg/l hygromyin. The trnsformed shoots ould develop roots nd grow into omplete plntlets on the seletion medium of this onentrtion wheres untrnsformed shoots hrdly developed ny roots nd hrdly grew into plntlets. The shoots were trnsferred to new seletion medium every two weeks. Most untrnsformed shoots were eliminted during out 4 6 weeks of seletion nd rooting ulture. Twenty-one independent hyg-resistnt plntlets were otined fter out 2 months of seletion (Figure 3). The trnsformtion events of puttive hygromyin-resistnt trnsgeni lines were onfirmed y GUS histohemil nlysis. After tomto lef tissues were stined with GUS retion solution nd lehed with solute lohol, the whole of the trnsformed tissues ppered nerly deep lue olour while untrnsformed tissues ppered olourless. GUS histohemil ssy is onvenient nd fst tehnique to detet the integrtion nd expression of trget gene whih ws widely used in mny plnt speies (Šváová et l. 5; Sri Shilp et l. ). The GUS histohemil ssy of the of T plnts showed lue olourtion, onfirming the presene of the trnsgene (Figure 3F). In this study, we used stringent hygromyin seletion, so GUS expression ws oserved in most of tomto ultivrs. This result lso indited the reliility of the seletion regime for otining trnsformed tomto plnts. Moleulr nlysis of trnsgeni tomto plnts PCR ws used to onfirm the trnsgene integrtion into the GUS positive puttive trnsformnts. The prtil gene-speifi HBsAg frgment (495 p) of the expeted size ws oserved in 73

6 Czeh J. Genet. Plnt Breed., 47, 11 (2): Figure 3. Trnsgeni tomto plnts otined fter Agroterium-medited trnsformtion; (A) llus nd shoots egn to pper t the wounded sites of the otyledon explnts fter 2 weeks of seletion, (B) shoots regenerted from llus 4 weeks lter, (C) shoots were trnsferred onto MS medium for elongtion, (D) shoots growing well on the rooting medium, (E) mture plnts trnsplnted in plsti pots, (F) GUS stining of the trnsgeni T plnts: I II trnsgeni tomto plnts; III non-trnsgeni tomto plnts (negtive ontrol) the trnsgeni plnts while it ws sent in the untrnsformed wild-type tomto plnts (negtive ontrol). The length (495 p) of the PCR mplifi74 tion frgment ws identil with tht mplified from pcambia-131 plsmid (positive ontrol). The results primrily verified tht the trget gene

7 Figure 4. PCR nlysis of trnsgeni tomto plnts; 1 DNA mrker II (DL p); 2,4 negtive ontrol; 3 positive ontrol; 5 8 trnsgeni tomto plnts Figure 5. PCR-Southern lot nlysis of trnsgeni tomto plnts; 1 6 trnsgeni tomto plnts; 7 non-trnsgeni tomto plnt (negtive ontrol); 8 enzyme shering of pbrsag with X I/Kpn I (positive ontrol) ws integrted into the genomi DNA of trnsformed tomto plnts (Figure 4). The PCR produts fter 1% gel seprtion were lotted onto nylon memrnes. The plsmid DNA ontining the HBsAg gene ws lelled with DIG nd used for the hyridiztion with the mplified PCR produts to onfirm the suess of trnsformtion. The trnsformed plnts gve the sme hyridiztion spots s did the positive ontrol, wheres the untrnsformed plnts showed no detetle hyridiztion signl (Figure 5). The results of PCR-Southern lot nlysis lerly demonstrted the presene of the trget gene in the tomto plnts. CONCLUSION Plnts n e used s the most effetive systems for the prodution of therpeuti proteins, inluding reominnt vines. In our study, tomto otyledon explnts were trnsformed with the plnt expression vetor pbrsag hrouring HBsAg gene vi Agroterium-medited pproh. The trnsgeni nture of the plnts ws onfirmed y GUS stining, PCR nd PCR-Southern nlysis. A numer of ftors whih re importnt for the onsistent prodution of trnsgeni tomto plnts inluding Agroterium strins, infetion time, o-ultivtion time, Agroterium onentrtions nd etosyringone onentrtions were evluted. The present results demonstrted the fesiility nd effetiveness of A. tumefiens strin LBA444 hrouring plsmids with HBsAg gene under the optimized onditions for tomto trnsformtion. This study would ly the foundtion for the development of new type of plnt-derived heptitis B vine or other edile vines nd promote their prtil pplition. However, dditionl study would e required to e rried out. The trnsformnts should e further onfirmed y Southern lot nd Northern lot, whih re superior to PCR nd PCR-Southern. The trget gene/gene of interest (GOI) expression should e deteted y Western lot while the mount of HBsAg protein should e deteted y ELISA. In ddition, more experiments re needed to onfirm the inheritne of trnsgenes in suessive genertions (T 1, T 2 ) nd the mode of GOI heritility. Aknowledgements. This study ws supported y the Eleventh Five-yer Pln for Supporting Siene nd Tehnology of Chin (No. 6BAC1A13) nd y the Ntionl Nturl Siene Foundtion of Chin (No ). Referenes Arokirj P., Rueker F., Oermyr E., Shmsul Bhri A.R., Hfsh J., Crer D.C., Yeng H.Y. (2): Expression of humn serum lumin in trnsgeni Heve rsiliensis. Journl of Ruer Reserh, 5: Bnerjee A.K., Agrwl D.C., Nlwde S.M., Krishnmurthy K.V. (2): Trnsient expression of β-gluuronidse in emryo xes of otton y Agroterium nd prtile omrdment methods. Biologi Plntrum, 45: Brik D.P., Mohptr U., Chnd P.K. (5): Trnsgeni grsspe (Lthyrus stivus L.): ftors influening Agroterium-medited trnsformtion nd regenertion. Plnt Cell Reports, 24:

8 Behl R., Jin R., Behl K. K., Bhgoliwl A., Aggrwl N., Dhole T. N. (8): Seroprevlene nd risk ftors for heptitis B virus infetion mong generl popultion in Northern Indi. Arquivos de Gstroenterologi, 45: Bhtthrjee B., Mohn M., Nir S. (): Trnsformtion of hikpe: effet of genotype, explnt, Agroterium-strin nd omposition of ulture medium. Biologi Plntrum, 54: Bouhe F.B., Mrquet-Blouin E., Yngi Y., Steinmetz A., Muller C. P. (3): Neutrlising immunogeniity of polyepitope ntigen expressed in trnsgeni food plnt: novel ntigen to protet ginst mesles. Vine, 21: Chen L., Zhng B., Xu Z. (8): Slt tolerne onferred y over expression of Aridopsis vuolr N(+)/H(+) ntiporter gene AtNHX1 in ommon ukwhet (Fgopyrum esulentum). Trnsgeni Reserh, 17: Crne C., Wright E., Dixon R.A., Wng Z.Y. (6): Trnsgeni Medigo truntul plnts otined from Agroterium tumefiens-trnsformed roots nd Agroterium rhizogenes-trnsformed hiry roots. Plnt, 223: Dvis M.E., Lineerger R.D., Miller A.R. (1991): Effets of tomto ultivr, lef ge, nd teril strin on trnsformtion y Agroterium tumefiens. Plnt Cell, Tissue nd Orgn Culture, 24: Higshihshi N., Ari Y., Enjo T., Horiuhi T., Seki Y., Skno K., Sto Y., Tkede K., Tkshin S., Akhshi T. (1991): High-level expression nd hrteriztion of heptitis B virus surfe ntigen in silkworm using ulovirus vetor. Journl of Virologil Methods, 35: Hofgen R., Willmitzer L. (1988): Storge for ompetent ells for Agroterium tumefiens. Nulei Aids Reserh, 16: Ko T.S., Lee S., Krsnynski S., Korn S.S. (3): Two ritil ftors re required for effiient trnsformtion of multiple soyen ultivrs: Agroterium strin nd orienttion of immture otyledonry explnt. Theoretil nd Applied Genetis, 7: Mson H.S., Lm D.K., Arntzen C.J. (1992): Expression of heptitis B surfe ntigen in trnsgeni plnts. Proeedings of the Ntionl Ademy of Sienes of the United Sttes of Ameri, 89: Modelsk A., Dietzshold B., Sleysh N., Fu Z.F., Steplewski K., Hooper D.C., Koprowski H., Yusiov V. (1998): Immuniztion ginst ries with plnt-derived ntigen. Proeedings of the Ntionl Ademy of Sienes of the United Sttes of Ameri, 95: Mohn K.L., Krishnmurthy K.V. (3): Plnt regenertion from depitted mture emryo xis nd Agroterium medited geneti trnsformtion of pigeon pe. Biologi Plntrum, 46: Murshige T., Skoog F. (1962): A revised medium for rpid growth nd iossys with too tissue ultures. Physiologi Plntrum, 15: Priy P., Shivendr V.S. (9): Geneti trnsformtion nd regenertion of Sesni drummondii using otyledonry nodes. Plnt Cell Reports, 28: Rigno M.M., Dreitz S., Kipnis A.P., Izzo A.A., Wlmsley A. M. (6): Orl immunogeniity of plnt-mde, suunit, tuerulosis vine. Vine, 24: Sini R., Jiwl P.K. (7): Agroterium tumefiens-medited trnsformtion of lkgrm: n ssessment of ftors influening the effiieny of uida gene trnsfer. Biologi Plntrum, 51: Smrook J., Fritsh E.F., Mnitis T. (1989): Moleulr Cloning: Lortory Mnul. 2 nd Ed. Cold Spring Hror Lortory Press, Cold Spring Hror, New York. Sthel S.E., Messens E., Montgu M.V., Zmryski P. (1985): Identifition of the signl moleules produed y wounded plnt ells tht tivte T-DNA trnsfer in Agroterium rhizogenes. Nture, 318: Shodel F., Kelly S. M., Peterson D. L., Milih D. R., Curtiss R. (1994): Hyrid Heptitis B virus orepre-s proteins synthesized in virulent Slmonell typhimurium nd Slmonell typhi for orl vintion. Infetion nd Immunity, 62: Shivni I., Hri S., Misr S. E. (): Agroteriummedited trnsformtion in hikpe (Cier rietinum L.) with n insetiidl protein gene: optimistion of different ftors. Physiology nd Moleulr Biology of Plnts, 16: Sri Shilp K., Dinesh Kumr V., Sujth M. (): Agroterium-medited geneti trnsformtion of sfflower (Crthmus tintorius L.). Plnt Cell, Tissue nd Orgn Culture, 3: Stewrt C.N., Vi L.E. (1993): A rpid CTAB isoltion tehnique for RAPD finger print nd other PCR pplitions. Biotehniques, 14: Šváová L., Grig M. (8): The effet of o-ultivtion tretments on trnsformtion effiieny in pe (Pisum stivum L.). Plnt Cell, Tissue nd Orgn Culture, 95: Šváová L., Smýkl P., Grig M., Ondřej V. (5): Agroterium-medited trnsformtion of Pisum stivum in vitro nd in vivo. Biologi Plntrum, 49:

9 Thnvl Y., Yng Y.F., Lyons P., Mson H.S, Arntzen C. (1995): Immunogeniity of trnsgeni plntderived heptitis B surfe ntigen. Proeedings of the Ntionl Ademy of Sienes of the United Sttes of Ameri, 92: Wlmsley A.M., Arntzen C.J. (): Plnts for delivery of edile vines. Current Opinion in Biotehnology, 11: Wng B., Liu L.J., Wng X.X., Yng J.Y., Sun Z. X., Zhng N., Go S.M., Xing X.L., Peng D.X. (9): Trnsgeni rmie [Boehmeri nive (L.) Gud.]: ftors ffeting the effiieny of Agroterium tumefiensmedited trnsformtion nd regenertion. Plnt Cell Reports, 28: Reeived for pulition Jnury 21, 11 Aepted fter orretions My 9, 11 Corresponding uthor: Prof. Zhohu Lu, Binzhou University, Shndong Provinil Key Lortory of Eo-Environmentl Siene for Yellow River Delt, Binzhou 25663, P.R. Chin e-mil: lu-zhh@263.net 77

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nture10924 no tg Lsm1-my Lsm2-my Lsm5-my Lsm6-my Lsm7-my Lsm8-my no tg Lsm1-my Lsm2-my Lsm5-my Lsm6-my Lsm7-my Lsm8-my kd 220 120 100 80 60 50 40 30 20 SeeBlue Mrker Mgi Mrk no tg Sm1-my Smd3-my

More information

Crop Rotations, Reduced Tillage and N Fertilization Effects on Corn Yields And Aflatoxin Levels

Crop Rotations, Reduced Tillage and N Fertilization Effects on Corn Yields And Aflatoxin Levels Crop Rottions, Redued Tillge nd N Fertiliztion Effets on Corn Yields And Afltoxin Levels J.E. Mtoh nd M. Rihrdson Texs AgriLife Reserh nd Extension Center Stte Hwy Corpus Christi, TX 78- jmtoh@g.tmu.edu

More information

EXPLORING BIOFUMIGATIONAL POTENTIAL OF MUSTARDS

EXPLORING BIOFUMIGATIONAL POTENTIAL OF MUSTARDS EXPLORING BIOFUMIGATIONAL POTENTIAL OF MUSTARDS Oleg Dugovish*, (University of Cliforni Coopertive Extension - Ventur County), Jmes Downer nd Ole Beker (University of Cliforni Coopertive Extension -Ventur

More information

Broken rice facts. Physical and Functional Characteristics of Broken Rice Kernels. Parboiling Process. May 23, Production of broken rice 14-10%

Broken rice facts. Physical and Functional Characteristics of Broken Rice Kernels. Parboiling Process. May 23, Production of broken rice 14-10% My 23, 218 Physil nd Funtionl Chrteristis of Broken Rie Kernels Broken rie fts Redued eonomi vlue Undesirle Inevitle Ree M. Brue University of Arknss Advisor: Dr. Griffiths G. Atungulu Inexpensive Affets

More information

TTT DIAGRAM OF A NEWLY DEVELOPED NICKEL-BASE SUPERALLOY ALLVAC 718PLUS

TTT DIAGRAM OF A NEWLY DEVELOPED NICKEL-BASE SUPERALLOY ALLVAC 718PLUS Superlloys 718, 625, 706 nd Derivtives 2005 Edited y E.A. Lori TMS (The Minerls, Metls & Mterils Soiety), 2005 TTT DIAGRAM OF A NEWLY DEVELOPED NICKEL-BASE SUPERALLOY ALLVAC 718PLUS Xishn Xie 1, Chunmei

More information

Allelopathic appraisal effects of straw extract wheat varieties on the growth of corn

Allelopathic appraisal effects of straw extract wheat varieties on the growth of corn Afrin Journl of Biotehnology Vol. 9(48), pp. 8154-8160, 29 Novemer, 2010 Aville online t http://www.demijournls.org/ajb DOI: 10.5897/AJB10.859 ISSN 1684 5315 2010 Ademi Journls Full Length Reserh Pper

More information

PP100 N ABSOLUTE DEPTH FILTER ELEMENTS FEATURES & BENEFITS. Process Filtration

PP100 N ABSOLUTE DEPTH FILTER ELEMENTS FEATURES & BENEFITS. Process Filtration PP100 N ABSOLUTE DEPTH FILTER ELEMENTS Proess Filtrtion Donldson LifeTe PP100 N filters re solute rted depth type filters onstruted of 100% polypropylene. They ontin grded density polypropylene mirofier

More information

sensitive VBSs Vh subdomains EF EF

sensitive VBSs Vh subdomains EF EF Tlin- Tlin-EGFP-His 2 3 2 3 ABD Mehno- ABD2 ABD3 sensitive VBSs DD 6xHis EGFP Vh sudomins EGFP-Vinulin EGFP 2 3 4 Vt EGFP-Vh EGFP 2 3 4 -tinin- CH CH2 SP SP SP SP EF EF mcherry--tinin- mcherry CH CH2 SP

More information

EVALUATION OF ALTERNATIVE FUNGICIDES FOR CONTROL OF CERCOSPORA SPOT ON FUERTE

EVALUATION OF ALTERNATIVE FUNGICIDES FOR CONTROL OF CERCOSPORA SPOT ON FUERTE Proeedings V World Avodo Congress (Ats V Congreso Mundil del Agute) 23. pp. 579-583. EVALUATION OF ALTERNATIVE FUNGICIDES FOR CONTROL OF CERCOSPORA SPOT ON FUERTE A Willis nd JA Duvenhge Merensky Tehnologil

More information

Research Article Overexpression of Bacterial mtld Gene in Peanut Improves Drought Tolerance through Accumulation of Mannitol

Research Article Overexpression of Bacterial mtld Gene in Peanut Improves Drought Tolerance through Accumulation of Mannitol e Sientifi World Journl, Artile ID 125967, 10 pges http://dx.doi.org/10.1155/2014/125967 Reserh Artile Overexpression of Bteril mtld Gene in Penut Improves Drought Tolerne through Aumultion of Mnnitol

More information

Study on Tolerance and Accumulation Potential of Biofuel Crops for Phytoremediation of Heavy Metals

Study on Tolerance and Accumulation Potential of Biofuel Crops for Phytoremediation of Heavy Metals Interntionl Journl of Environmentl Siene nd Development, Vol. 4, No. 2, April 2013 Study on Tolerne nd Aumultion Potentil of Biofuel Crops for Phytoremedition of Hevy Metls Kokyo Oh, To Li, Hongyn Cheng,

More information

Gan et al., Supplemental Figure 1

Gan et al., Supplemental Figure 1 Gn et l., Supplementl Figure IB: DU45 Unp IB: py-68 IB: perk IB: ERK IB: Akt Unp DU45 DU45 ErB2 - EGF - EGF ErB2 75 75 Supplementl Figure. DU45 nd ells predominntly express nd re highly responsive to EGF.

More information

HeLa. CaSki. Supplementary Figure 1. Validation of the NKX6.1 expression in mrna level and

HeLa. CaSki. Supplementary Figure 1. Validation of the NKX6.1 expression in mrna level and Supplementry Figure. Li et l. Reltive expression ( / GAPDH ) 6 5 4 3 2 5 Reltive expression ( / GAPDH ) 4 3 2 Reltive expression ( / GAPDH ) 4 3 2 Reltive expression ( / GAPDH ) 4 3 2 Ve S Ve S2 S S2 Ve

More information

Modelling and Prediction of NOx emissions from coal fired boilers: Case study

Modelling and Prediction of NOx emissions from coal fired boilers: Case study Interntionl Reserh Journl of Engineering nd Tehnology (IRJET) e-issn: 9 - Volume: Issue: June- www.irjet.net p-issn: 9-7 Modelling nd redition of NO emissions from ol fired boilers: se study Vineeth Morris

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 1.138/n74 In the formt provided y the uthors nd unedited. d 331p 637p 9p 394p 48p 467p 22p 23p 489p 419p 3p 493p 332p 53p 39p 1 G1: 16.4% S: 73.1% G2/M: 1.5% 2 1 2 E-KO G1: 2.2% S: 7.7% G2/M: 9.1%

More information

Elevated Levels of Ethylene During Germination Reduces the Time to Emergence in Impatiens

Elevated Levels of Ethylene During Germination Reduces the Time to Emergence in Impatiens Elevted Levels of Ethylene During Germintion Redues the Time to Emergene in Imptiens M. Dutt, S. Kester nd R. Geneve Deprtment of Hortiulture University of Kentuky Lexington Kentuky 4546 U.S.A. Keywords:

More information

THE EFFECT OF DROUGHT STRESS AND TIME OF DISTRIBUTION OF NITROGEN FERTILIZER (SPLIT APPLICATION) ON THE YIELD AND YIELD COMPONENTS OF GRAIN SORGHUM

THE EFFECT OF DROUGHT STRESS AND TIME OF DISTRIBUTION OF NITROGEN FERTILIZER (SPLIT APPLICATION) ON THE YIELD AND YIELD COMPONENTS OF GRAIN SORGHUM Indin Journl of Fundmentl nd Applied Life Sienes ISSN: 2231 6345 (Online) An Open Aess, Online Interntionl Journl Aville t www.iteh.org/sp.ed/jls/2015/01/jls.htm 2015 Vol.5 (S1), pp. 5463-5468/Ndimpour

More information

Supplementary Figure S1. Akaike et al.

Supplementary Figure S1. Akaike et al. reltive expression of HIPK2 (HIPK2/GAPDH) Supplementry Figure S1. Akike et l. 1.25 ontrol HIPK2 #1 1 HIPK2 #2 HIPK2 3 U 0.75 0.5 0.25 0 ontrol : + + - HIPK2 #1: - - - + + - - - - HIPK2 #2: - - - - + +

More information

III. Adhesion Quality of Tin Plating on Aluminum: Thermal Shock and Adhesion Tests

III. Adhesion Quality of Tin Plating on Aluminum: Thermal Shock and Adhesion Tests Dt Bulletin Therml Aging Study of Tin Plting on Aluminum 0108DB0602 02/2007 Cedr Rpids, IA, USA Bell Chudnovsky* Vinent Pvgeu + Mihel Rpeux + Ali Zolfghri* Pierre Brdollet + *) Shneider Eletri North Ameri

More information

Effect of Thiourea on Dormancy Breaking and Yield of Potato (Solanum Tuberosum L.) Minitubers Marfona cv. in Greenhouse

Effect of Thiourea on Dormancy Breaking and Yield of Potato (Solanum Tuberosum L.) Minitubers Marfona cv. in Greenhouse 211 Interntionl Conferene on Environmentl nd Agriulture Engineering IPCBEE vol.15(211) (211) IACSIT Press, Singpore Effet of Thioure on Dormny Breking nd Yield of Potto (Solnum Tuerosum L.) Minituers Mrfon

More information

PES-BN ABSOLUTE MEMBRANE FILTER ELEMENTS FEATURES & BENEFITS. Process Filtration

PES-BN ABSOLUTE MEMBRANE FILTER ELEMENTS FEATURES & BENEFITS. Process Filtration PES-BN ABSOLUTE MEMBRANE FILTER ELEMENTS Proess Filtrtion The Donldson LifeTe PES-BN filter element is sterile grde rted, pleted high performne polyethersulfone memrne filter. It provides the gretest ssurne

More information

ROLAND V. RALLOS* Agriculture Research Section Philippine Nuclear Research Institute

ROLAND V. RALLOS* Agriculture Research Section Philippine Nuclear Research Institute Influene of Potssium Soluilizing Bteri on Growth nd Rdioesium Aumultion of Brssi rp L. vr. perviridis grown in Cs-Contminted Fukushim Soils ROLAND V. RALLOS* Agriulture Reserh Setion Philippine Nuler Reserh

More information

PF-PT N MEMBRANE FILTER ELEMENTS FEATURES & BENEFITS. Compressed Air & Process Filtration PF-PT N

PF-PT N MEMBRANE FILTER ELEMENTS FEATURES & BENEFITS. Compressed Air & Process Filtration PF-PT N PF-PT N MEMBRANE FILTER ELEMENTS Compressed Air & Proess Filtrtion The Donldson LifeTe PF-PT N filter element is sterile grde, pleted high performne PTFE memrne filter. It provides the gretest ssurne of

More information

Research. Tongjun Sun 1, Lucas Busta 2, Qian Zhang 1, Pingtao Ding 1, Reinhard Jetter 1,2 and Yuelin Zhang 1. Summary.

Research. Tongjun Sun 1, Lucas Busta 2, Qian Zhang 1, Pingtao Ding 1, Reinhard Jetter 1,2 and Yuelin Zhang 1. Summary. Reserh TGACG-BINDING FACTOR (TGA) nd TGA regulte sliyli id nd pipeoli id iosynthesis y modulting the expression of SYSTEMIC ACQUIRED RESISTANCE DEFICIENT (SARD) nd CALMODULIN-BINDING PROTEIN g (CBPg) Tongjun

More information

Overexpression of Arabidopsis P3B increases heat and low temperature stress tolerance in transgenic sweetpotato

Overexpression of Arabidopsis P3B increases heat and low temperature stress tolerance in transgenic sweetpotato Ji et l. BMC Plnt Biology (217) 17:139 DOI 1.1186/s1287-17-187-2 RESEARCH ARTICLE Open Aess Overexpression of Aridopsis P3B inreses het nd low temperture stress tolerne in trnsgeni sweetpotto Chng Yoon

More information

Factors affecting delivery and transient expression of -glucuronidase gene in Dendrobium Sonia protocormlike-body

Factors affecting delivery and transient expression of -glucuronidase gene in Dendrobium Sonia protocormlike-body Afrin Journl of Biotehnology Vol. 5 (2), pp. 88-94, 16 Jnury 26 Aville online t http://www.demijournls.org/ajb ISSN 1684 5315 26 Ademi Journls Full Length Reserh Pper Ftors ffeting delivery nd trnsient

More information

PRODUCTION METHOD. contact sulphuric acid plant, various kind of waste gases).

PRODUCTION METHOD. contact sulphuric acid plant, various kind of waste gases). "POL" PHOSPHATE FERTLZER DRY AND WASTE-FREE PRODUCTON METHOD / The elborted fertilizer prodution tehnology nd POL -phosphte fertilizer, re originl hievements dpted to present hnges in the rw-mteril nd

More information

An efficient transient expression system for gene function analysis in rose

An efficient transient expression system for gene function analysis in rose https://doi.org/1.1186/s137-17-268-1 Plnt Methods METHODOLOGY Open Aess An effiient trnsient expression system for gene funtion nlysis in rose Jun Lu 1,2, Mengjun Bi 1,2, Horn Ren 1,2, Jinyi Liu 1,2 nd

More information

(Triticum aestivum L. (Secale cereale)

(Triticum aestivum L. (Secale cereale) (Tritium estivum L. Sele erele L. * Aven spp (Aegilops ylindri) Bromus spp (Sele erele) E-mil: m_dynt@yhoo.om * (Cirsium rvense) Minit SAS (Lolium rigidum) (Vri hispni) 0 5 10 15 20 25 30 35 40 45 50 2

More information

INVESTIGATION OF THE EFFECTS OF IRRIGATION METHODS AND NUTRIENT TREATMENTS ON THE MECHANICAL PROPERTIES OF SAFFLOWER SEED

INVESTIGATION OF THE EFFECTS OF IRRIGATION METHODS AND NUTRIENT TREATMENTS ON THE MECHANICAL PROPERTIES OF SAFFLOWER SEED 1216 Bulgrin Journl of Agriulturl Siene, 21 (No 6) 2015, 1216-1221 Agriulturl Ademy INVESTIGATION OF THE EFFECTS OF IRRIGATION METHODS AND NUTRIENT TREATMENTS ON THE MECHANICAL PROPERTIES OF SAFFLOWER

More information

In vitro micropropagation of Citrus aurantifolia (lime)

In vitro micropropagation of Citrus aurantifolia (lime) showed epiotyl nd hypootyl formtion (Figure 1 g). Results of GA 3 -promoted germintion of somti emryos were lredy oserved in Lveter thuringi 18 nd in Iris germni 19. In the present investigtion, TDZ (1.0

More information

Comparative Study of Weldline Strength in Conventional Injection Molding and Rapid Heat Cycle Molding

Comparative Study of Weldline Strength in Conventional Injection Molding and Rapid Heat Cycle Molding Comprtive Study of Weldline Strength in Conventionl Injetion Molding nd Rpid Het Cyle Molding JIQUAN LI 1,2, SHAOGUANG YANG 1, LIH-SHENG TURNG 2, ZUOJIAN XIE 1, SHAOFEI JIANG 1 * 1 College of Mehnil Engineering,

More information

Economic Evaluation of Glyphosate-Resistant and Conventional Sugar Beet 1

Economic Evaluation of Glyphosate-Resistant and Conventional Sugar Beet 1 Weed Tehnology. 24. Volume :3 396 Eonomi Evlution of Glyphoste-Resistnt nd Conventionl Sugr Beet ANDREW R. KNISS, ROBERT G. WILSON, ALEX R. MARTIN, PAUL A. BURGENER, nd DILLON M. FEUZ 2 Astrt: Field experiments

More information

Electrostatic vs covalent bond in modified Jeffamine: effect on the phase behaviour and on the templating of mesoporous silica

Electrostatic vs covalent bond in modified Jeffamine: effect on the phase behaviour and on the templating of mesoporous silica Eletroni upplementry Mteril (EI) for oft Mtter This journl is The Royl oiety of Chemistry 3 upporting Informtion Eletrostti vs ovlent ond in modified Jeffmine: effet on the phse ehviour nd on the templting

More information

Comparison of Two Diagnostic Methods for Evaluation of Sugarcane yellow leaf virus Concentration in Brazilian Sugarcane Cultivars

Comparison of Two Diagnostic Methods for Evaluation of Sugarcane yellow leaf virus Concentration in Brazilian Sugarcane Cultivars Funtionl Plnt Siene nd Biotehnology 2009 Glol Siene Books Comprison of Two Dignosti Methods for Evlution of Sugrne yellow lef virus Conentrtion in Brzilin Sugrne Cultivrs Sndr M. Sgliusi 1* Sikt K. Bsu

More information

Effect Of Explant Source And Different Medium Culture On Friable Embryogenic Callus Induction Of Four Cultivars Of Cassava (Manihot Esculenta Crantz)

Effect Of Explant Source And Different Medium Culture On Friable Embryogenic Callus Induction Of Four Cultivars Of Cassava (Manihot Esculenta Crantz) Effet Of Explnt Soure And Different Medium Culture On Frile Emryogeni Cllus Indution Of Four Cultivrs Of Cssv (Mnihot Esulent Crntz) Simplie Prosper Yndi, Christophe Bernrd Gndonou, Semll Sill, Innoent

More information

Arabidopsis thaliana class-ii TGA transcription factors are essential activators of jasmonic acid/ethylene-induced defense responses

Arabidopsis thaliana class-ii TGA transcription factors are essential activators of jasmonic acid/ethylene-induced defense responses Pulished in "The Plnt Journl 6(2): 2-2, 2" whih should e ited to refer to this work. Aridopsis thlin lss-ii TGA trnsription ftors re essentil tivtors of jsmoni id/ethylene-indued defense responses Mrk

More information

Effect of weed competition on growth characteristics of sunflower at different levels of nitrogen fertilizer

Effect of weed competition on growth characteristics of sunflower at different levels of nitrogen fertilizer Aville online t www.sholrsreserhlibrry.om Sholrs Reserh Librry Annls of Biologil Reserh, 212, 3 (11):5162-5168 (http://sholrsreserhlibrry.om/rhive.html) ISSN 976-1233 CODEN (USA): ABRNBW Effet of weed

More information

Unprecedented inhibition of tubulin polymerization directed by gold nanoparticles inducing cell cycle arrest and apoptosis

Unprecedented inhibition of tubulin polymerization directed by gold nanoparticles inducing cell cycle arrest and apoptosis Eletroni supplementry informtion (ESI) for Nnosle Unpreedented inhiition of tuulin polymeriztion direted y gold nnoprtiles induing ell yle rrest nd poptosis Diptimn Choudhury,,e, Pulrjpilli Lourdu Xvier,,

More information

*** supplementary information. axon growth (µm/1h) 5 ng/ml NGF. 150 ng/ml NGF. 20 ng/ml NGF. n.s. n.s. n.s. DOI: /ncb1916

*** supplementary information. axon growth (µm/1h) 5 ng/ml NGF. 150 ng/ml NGF. 20 ng/ml NGF. n.s. n.s. n.s. DOI: /ncb1916 DOI: 1.138/n1916 25 xon growth (µm/1h) 2 15 1 5 ng/ml NGF 5 ng/ml NGF 2 ng/ml NGF 1 ng/ml NGF 15 ng/ml NGF Figure S1 () Doseresponse urve for xon outgrowth in response to NGF. Speifi tivities of NGF from

More information

Determining effects of irrigation stress on growth and yield of potato cultivars in Ardabil cold region

Determining effects of irrigation stress on growth and yield of potato cultivars in Ardabil cold region J. Bio. & Env. Si. 2014 Journl of Biodiversity nd Environmentl Sienes (JBES) ISSN: 2220-6663 (Print) 2222-3045 (Online) Vol. 4, No. 4, p. 318-326, 2014 http://www.innspu.net RESEARCH PAPER OPEN ACCESS

More information

A" 700" B" 700" 24" PAR" Day"length" 20" Photosynthe7cally"ac7ve"radia7on"(PAR)"(Ue/m2)" 600" 500" 16" 400" Hours" 12" 300" 200" 100"

A 700 B 700 24 PAR Daylength 20 Photosynthe7callyac7veradia7on(PAR)(Ue/m2) 600 500 16 400 Hours 12 300 200 100 Oikos OIK-1764 De Long, J. R., Krdol, P., Sundqvist, M. K., Veen, G. F nd Wrdle, D. A. 214. Plnt growth response to diret nd indiret temperture effets vries y vegettion type nd elevtion in surti tundr.

More information

Efficacy of Armicarb (potassium bicarbonate) against scab and sooty blotch on apples

Efficacy of Armicarb (potassium bicarbonate) against scab and sooty blotch on apples Effiy of Armir (potssium ironte) ginst s nd sooty loth on pples Einfluss von Armir (Klium Biront) uf den Shorf und Regenflekenkrnkheit des Apfels Luius Tmm 1, Thoms Amsler 1, Hnsjko Shärer 1, Mtthis Refrdt

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SI Fig. PrpS is single copy gene k 3. 9... EcoRV EcoRV k 5 BmH Pst c well k HindIII HindIII HindIII.3.5 3.. Southern lots of Ppver genomic DNA from plnts with SS8 hplotypes, hyridized with PrpS proe..

More information

Technology & Prod uct Reports Does Amendment of Soak Solution with Sucrose and Urea Increase Production of Shiitake Mushrooms on Sawdust Blocks?

Technology & Prod uct Reports Does Amendment of Soak Solution with Sucrose and Urea Increase Production of Shiitake Mushrooms on Sawdust Blocks? Tehnology & Prod ut Reports Does Amendment of Sok Solution with Surose nd Ure Inrese Prodution of Shiitke Mushrooms on Swdust Bloks? Cthy Sot, Cul Beyl, nd Gokul Ghle ADDITIONAL INDEX WORDS. iologil effiieny,

More information

Chapter 6. Characterization of bacterial isolates from rotting potato tuber tissue showing antagonism to Dickeya sp. biovar 3 in vitro and in planta

Chapter 6. Characterization of bacterial isolates from rotting potato tuber tissue showing antagonism to Dickeya sp. biovar 3 in vitro and in planta Chpter 6 Chrteriztion of teril isoltes from rotting potto tuer tissue showing ntgonism to Dikey sp. iovr 3 in vitro nd in plnt Roert Czjkowski, Wldo J. de Boer, Johnnes A. vn Veen, Jn M. vn der Wolf Plnt

More information

Supplemental Figure S1

Supplemental Figure S1 Supplementl Figure S1 TG nrt1.5- Li et l., 1 nrt1.5- Lin et l., 8 F L CTGCCT R T 5'UTR 3'UTR 1 3 81p (k) nrt1.5- C nrt1.5- Supplementl Figure S1. Phenotypes of the T-DN insertion mutnts (this pper), nrt1.5-

More information

Combined Hot Air-Microwave Drying Methods in Banana Chips Production

Combined Hot Air-Microwave Drying Methods in Banana Chips Production Amerin-Eursin J. Agri. & Environ. Si., (8): 77-776, ISSN 88-6769 IDOSI Pulitions, DOI:.589/idosi.ejes...8.88 Comined Hot Air-Mirowve Drying Methods in Bnn Chips Prodution Hmid Tvkolipour nd Leil Zirjni

More information

Physiological effects of mechanized harvesting and ways to minimize its impacts

Physiological effects of mechanized harvesting and ways to minimize its impacts 8/3/218 Physiologil effets of mehnized hrvesting nd wys to minimize its impts S.R.W. Pthirnge 1, M.A. Wijertne 1 nd W.A.J.M. De Cost 2 1 Agronomy Division, Te Reserh Institute of Sri Lnk 2 Fulty of Agriulture,

More information

DNA synthesis and topoisomerase inhibitors increase

DNA synthesis and topoisomerase inhibitors increase Pro. Ntl. Ad. Si. USA Vol. 92, pp. 5719-5723, June 1995 Medil sienes DNA synthesis nd topoisomerse inhibitors inrese trnsdution by deno-ssoited virus vetors DAVID W. RUSSELL*t, IAN E. ALEXANDER*, AND A.

More information

Article received ; Revised ; Accepted

Article received ; Revised ; Accepted Pk. J. Biotehnol. Vol. 13 (3) 205-209 (2016) ISSN Print: 1812-1837 www. pjt.org ISSN Online: 2312-7781 GRAIN YIELD, PHOSPHORUS CONTENT AND UPTAKE OF WHEAT (TRITICUM AESTIVUM L.) AS AFFECTED BY PHOSPHORUS

More information

The Effect of Cultivation Patterns and Compound Fertilizer Types on Physiological Characteristics of Leaf and Stem of Longping 206

The Effect of Cultivation Patterns and Compound Fertilizer Types on Physiological Characteristics of Leaf and Stem of Longping 206 Interntionl Journl of Reserh in Agriulture nd Forestry Volume 3, Issue 6, June 2016, PP 34-41 ISSN 2394-5907 (Print) & ISSN 2394-5915 (Online) The Effet of Cultivtion Ptterns nd Compound Fertilizer Types

More information

A Little More Advanced Biotechnology Tools. Engineered plasmids. Selection for plasmid uptake. Better Plasmids. Antibiotic becomes a selecting agent

A Little More Advanced Biotechnology Tools. Engineered plasmids. Selection for plasmid uptake. Better Plasmids. Antibiotic becomes a selecting agent A Little More Advnced Biotechnology Tools Better Plsmids Engineered plsmids Building custom plsmids restriction enzyme sites ntibiotic resistnce genes s selectble mrker EcoRI BmHI HindIII restriction sites

More information

Effect of AtNRT2.1 transgene on HATS nitrate uptake in transgenic Nicotiana plumbaginifolia

Effect of AtNRT2.1 transgene on HATS nitrate uptake in transgenic Nicotiana plumbaginifolia Progress in Biologil Sienes Vol. 1, No.1, 1-9, Winter/Spring 11 Effet of AtNRT2.1 trnsgene on HATS nitrte uptke in trnsgeni Niotin plumginifoli Przhk Zoufn 2 nd Mnsour Shriti 1 * 1 Deprtment of Biology,

More information

Supplementary Figure 1. Zhang et al.

Supplementary Figure 1. Zhang et al. Supplementry Figure 1. Zhng et l. T30-SurA: GGCAGTTTCATCATGAATGTGCAGGAGCTTGCAACAATTAAGGTGGAGAATCTCCC T30-SurB: GGCAGTTTCATCATGAATGTGCAGGAGCTAGCAACTATTAAGGTGGAGAATCTCCC T41-SurA: ACTGAATAATCAACACTTGGGAATGGTGGTTCAATGGGAGGATCGGTTCTAT

More information

Economic Profitability and Sustainability of Canola Production Systems in Western Canada

Economic Profitability and Sustainability of Canola Production Systems in Western Canada Economic Profitility nd Sustinility of Cnol Production Systems in Western Cnd Elwin Smith, R. Blckshw, Agriculture nd Agri-Food Cnd (AAFC), Lethridge, AB, N. Hrker, J. O'Donovn, AAFC Lcome AB, S. Brndt,

More information

Responses of rice yield and the fate of fertilizer nitrogen to soil organic carbon

Responses of rice yield and the fate of fertilizer nitrogen to soil organic carbon Vol. 63, 2017, No. 9: 416 421 Plnt Soil Environ. Responses of rie yield nd the fte of fertilizer nitrogen to soil orgni ron Weifu PENG, Yongjun ZENG, Qinghu SHI, Shn HUANG* Ministry of Edution nd Jingxi

More information

7 mm Diameter Miniature Single-Turn Cermet Trimmer

7 mm Diameter Miniature Single-Turn Cermet Trimmer 7 mm Dimeter Miniture Single-Turn Cermet Trimmer A dust seled plsti se proteting qulity ermet trk gurntees high performne nd proven reliility. Adjustments re mde esier y the ler sle redings. is idelly

More information

Growing Wheat (Trititcum aestivum L.) by the Methods of Organic Agriculture Under the Conditions of Dobrudzha Region, Bulgaria

Growing Wheat (Trititcum aestivum L.) by the Methods of Organic Agriculture Under the Conditions of Dobrudzha Region, Bulgaria Turkish Journl of Agriulturl nd Nturl Sienes Speil Issue: 1, 2014 TÜRK TARIM ve DOĞA BİLİMLERİ DERGİSİ TURKISH JOURNAL of AGRICULTURAL nd NATURAL SCIENCES www.turkjns.om Growing Whet (Trititum estivum

More information

Soybean Fungicide and Insecticide Seed Treatments (2006 Final Report)

Soybean Fungicide and Insecticide Seed Treatments (2006 Final Report) Soyen Fungicide nd Iecticide Seed Tretments (2006 Finl Report) Purpose: The ojective of this study ws to investigte new iecticide seed tretments for soye. Cruiser ws registered recently nd Gucho hs yet

More information

Research Article Identification of Differential Expression Genes in Leaves of Rice (Oryza sativa L.) in Response to Heat Stress by cdna-aflp Analysis

Research Article Identification of Differential Expression Genes in Leaves of Rice (Oryza sativa L.) in Response to Heat Stress by cdna-aflp Analysis BioMed Reserh Interntionl Volume 213, Artile ID 576189, 11 pges http://dx.doi.org/1.1155/213/576189 Reserh Artile Identifition of Differentil Expression Genes in Leves of Rie (Oryz stiv L.) in Response

More information

THE INFLUENCE OF THERMOMECHANICAL TREATMENT AND CHEMICAL COMPOSITION ON RECRYSTALLIZATION OF Al-Mg ALLOYS

THE INFLUENCE OF THERMOMECHANICAL TREATMENT AND CHEMICAL COMPOSITION ON RECRYSTALLIZATION OF Al-Mg ALLOYS Assoition of Metllurgil Engineers of Seri Sientifi pper AMES UDC:669.715 721.065.53.040.2-174=20 THE INFLUENCE OF THERMOMECHANICAL TREATMENT AND CHEMICAL COMPOSITION ON RECRYSTALLIZATION OF Al-Mg ALLOYS

More information

Sustainable Crop Rotations for Alberta s Brown Soil Zone

Sustainable Crop Rotations for Alberta s Brown Soil Zone Otober 2003 Agdex 515-1 Sustinble Crop Rottions for Albert s Brown Soil Zone C rop prodution on the Cndin Priries hs historilly foused on spring whet. In reent dedes, rops suh s brley nd nol hve inresed

More information

Influence of glyphosate on Rhizoctonia and Fusarium root rot in sugar beet

Influence of glyphosate on Rhizoctonia and Fusarium root rot in sugar beet Pest Mngement Siene Pest Mng Si 62:1182 1192 (26) Influene of glyphoste on Rhizotoni nd Fusrium root rot in sugr eet Ree L Lrson, 1, Amy L Hill, 1 Ann Fenwik, 1 Andrew R Kniss, 2 Lind E Hnson 1 nd Stephen

More information

Enzyme Triggered Cascade Reactions and Assembly of Abiotic Block Copolymers into Micellar Nanostructures

Enzyme Triggered Cascade Reactions and Assembly of Abiotic Block Copolymers into Micellar Nanostructures Enzyme Triggered Csde Retions nd Assemly of Aioti Blok Copolymers into Miellr Nnostrutures Jingyi Ro, Christine Hottinger, nd Anzr Khn Deprtment of Mterils, ETH-Zürih, Switzerlnd nzr@mt.ethz.h Styrene,

More information

Optimising soil disturbance for erosion and runoff control in row crops.

Optimising soil disturbance for erosion and runoff control in row crops. Ref: C0672 Optimising soil disturne for erosion nd runoff ontrol in row rops. Jonn Niziolomski, Ro Simmons, Jne Rikson nd Mike Hnn, Crnfield Soil nd Agri- Food Institute, Crnfield University, Crnfield,

More information

Effects of Moisture Content and Storage Period on Proximate Composition, Microbial Counts and Total Carotenoids of Cassava Flour

Effects of Moisture Content and Storage Period on Proximate Composition, Microbial Counts and Total Carotenoids of Cassava Flour IJISET - Interntionl Journl of Innovtive Siene, Engineering & Tehnology, Vol. 2 Issue 11, Novemer 2015. www.ijiset.om Effets of Moisture Content nd Storge Period on Proximte Composition, Miroil Counts

More information

Hepatitis C virus replication in mice with chimeric human livers

Hepatitis C virus replication in mice with chimeric human livers Heptitis C virus replition in mie with himeri humn livers DAVID F. MERCER 1, DANIEL E. SCHILLER 1, JOHN F. ELLIOTT 2, DONNA N. DOUGLAS 1, CHUNHAI HAO 3, ALINE RINFRET 4, WILLIAM R. ADDISON 2, KARL P. FISCHER

More information

Genetics and Resistance

Genetics and Resistance Genetis nd Resistne Development of Co-Dominnt Amplified Polymorphi Sequene Mrkers in Rie tht Flnk the Mgnporthe grise Resistne Gene Pi7(t) in Reominnt Inred Line 29 M. A. Cmpell, D. Chen, nd P. C. Ronld

More information

EFFECT OF MULCHING AND FERTILIZER RATES ON THE GROWTH OF RRIM 3001

EFFECT OF MULCHING AND FERTILIZER RATES ON THE GROWTH OF RRIM 3001 EFFECT OF MULCHING AND FERTILIZER RATES ON THE GROWTH OF RRIM 31 Muhmmd Zhidin in Rzmn, Wn Mohmed Noordin in Wn Dud, Zulkefly Sulimn ABSTRACT The mjor issues nd hllenges fed y Mlysi reently were delining

More information

METHODOLOGY METHODOLOGY IMPACT OF SUGAR SYRUPS ON LIFESPAN AND AGE RELATED PHYSIOLOGICAL CONDITION IN CAGED HONEYBEES

METHODOLOGY METHODOLOGY IMPACT OF SUGAR SYRUPS ON LIFESPAN AND AGE RELATED PHYSIOLOGICAL CONDITION IN CAGED HONEYBEES Impt of sugr syrups on lifespn nd ge relted physiologil ondition in ged honeyees IMPACT OF SUGAR SYRUPS ON LIFESPAN AND AGE RELATED PHYSIOLOGICAL CONDITION IN CAGED HONEYBEES The trnsition from nursing

More information

iaspp oncoprotein is a key inhibitor of p53 conserved from worm to human 12.5 no irradiation +100 J/m 2 UV germ-cell corpses / gonad arm

iaspp oncoprotein is a key inhibitor of p53 conserved from worm to human 12.5 no irradiation +100 J/m 2 UV germ-cell corpses / gonad arm onoprotein is key inhiitor of onserved from worm to humn 23 Nture Pulishing Group http://www.nture.om/nturegenetis Dniele Bergmshi 1 *, Yrden Smuels 1 *, Nigel J. O Neil 2 *, Giuseppe Triginte 1, Tim Crook

More information

Effects of Control Release Fertilizers on Nutrient Leaching, Palm Growth and Production Cost

Effects of Control Release Fertilizers on Nutrient Leaching, Palm Growth and Production Cost Florid Interntionl University FIU Digitl Commons Deprtment of Erth nd Environment College of Arts, Sienes & Edution 11-18-215 Effets of Control Relese Fertilizers on Nutrient Lehing, Plm Growth nd Prodution

More information

Overexpression of DEAD box protein pmss116 promotes ATP-dependent splicing of a yeast group intron in vitro

Overexpression of DEAD box protein pmss116 promotes ATP-dependent splicing of a yeast group intron in vitro 2966-2972 Nulei Aids Reserh, 1995, Vol. 23, No. 15 Overexpression of DEAD ox protein pmss116 promotes ATP-dependent spliing of yest group intron in vitro sell Niemer, Crlo Shmelzer nd G. Vlentin Borner*

More information

SINGLE-STAGE ELECTROMAGNETIC ELEVATOR MODELLING IN FEMM SOFTWARE

SINGLE-STAGE ELECTROMAGNETIC ELEVATOR MODELLING IN FEMM SOFTWARE 8th Interntionl DAAAM Blti Conferene "INDUSTRIAL ENGINEERING - 19-21 April 2012, Tllinn, Estoni SINGLE-STAGE ELECTROMAGNETIC ELEVATOR MODELLING IN FEMM SOFTWARE Lpkovskis, V., Mironovs, V. Astrt: In present

More information

Effect of Cooling Rate on Microstructure and Mechanical Properties in Al-Si Alloys

Effect of Cooling Rate on Microstructure and Mechanical Properties in Al-Si Alloys Proeedings of the 12th Interntionl Conferene on Aluminium Alloys, Septemer 5-9, 2010, Yokohm, Jpn 2010 The Jpn Institute of Light Metls pp. 675-680 675 Effet of Cooling Rte on Mirostruture nd Mehnil Properties

More information

Effect of Nitrogen Rate on Yield of Nine Warm-season Introduced Perennial Forage Varieties

Effect of Nitrogen Rate on Yield of Nine Warm-season Introduced Perennial Forage Varieties Effet of Nitrogen Rte on Yield of Nine Wrm-seson Introdued Perennil Forge Vrieties By Eddie Funderurg, Jon T. Biermher, Corey Moffet, Mohu Hque nd Jgdeesh Mosli When rnhers think out plnting n introdued

More information

Fish Extracts for Integrated Disease, Insect, and Fertility Management in Organic Blueberries in the Southeastern U.S. Final Report ( )

Fish Extracts for Integrated Disease, Insect, and Fertility Management in Organic Blueberries in the Southeastern U.S. Final Report ( ) Fish Extrts for Integrted Disese, Inset, nd Fertility Mngement in Orgni Blueerries in the Southestern U.S. Finl Report (2009-2010) Prinipl investigtor Hrld Sherm Plnt Pthology Dept. University of Georgi

More information

Journal of Integrative Agriculture 2017, 16(0): Available online at ScienceDirect

Journal of Integrative Agriculture 2017, 16(0): Available online at   ScienceDirect Journl of Integrtive Agriulture 2017, 16(0): 60345-7 Aville online t www.sienediret.om SieneDiret RESEARH ARTILE Isoltion nd hrteriztion of the seondry wll-relted SND1 gene in hwthorn HEN Ke-qin 1, GUO

More information

A Novel Delivery System for the Root Symbiotic Fungus, Sebacina vermifera, and Consequent Biomass Enhancement of Low Lignin COMT Switchgrass Lines

A Novel Delivery System for the Root Symbiotic Fungus, Sebacina vermifera, and Consequent Biomass Enhancement of Low Lignin COMT Switchgrass Lines DOI 1.17/s12--9636-8 A Novel Delivery System for the Root Symioti Fungus, Sein vermifer, nd Consequent Biomss Enhnement of Low Lignin Swithgrss Lines Prsun Ry 1 & Tkko Ishig 1 & Stephen R. Deker 2 & Geoffrey

More information

Effect of Water Stress on Seed Germination of Agropyron Elongatum, Agropyron Desertourm & Secale Montanum

Effect of Water Stress on Seed Germination of Agropyron Elongatum, Agropyron Desertourm & Secale Montanum DESERT DESERT Online t http://jesert.ut..ir DESERT 7 () 49-5 Effet of Wter Stress on See Germintion of Elongtum, Desertourm & Sele Montnum E. Zni Esfhn *, H. Azrnivn Assistnt Professor, Reserh Institute

More information

Application of Bio-filteration Wastewater Treatment Using Iraqi Gypsum and Phosphate Bio-filters

Application of Bio-filteration Wastewater Treatment Using Iraqi Gypsum and Phosphate Bio-filters Journl of Wter Resoure nd Hydruli Engineering De. 13, Vol. Iss., PP. 19-156 pplition of io-filtertion Wstewter Tretment Using Irqi Gypsum nd Phosphte io-filters yd S. Mustuf 1, Sdeq O. Sulimn, Mrw Y. Khudir

More information

2000 Nature America Inc.

2000 Nature America Inc. Quntittive expression of Ot-3/4 defines differentition, dedifferentition or self-renewl of ES ells Hitoshi Niw 1,2, Jun-ihi Miyzki 2 & Austin G. Smith 1 Cell fte during development is defined y trnsription

More information

Generation of germline-competent induced pluripotent stem cells

Generation of germline-competent induced pluripotent stem cells Vol 448 19 July 2007 doi:10.1038/nture05934 Genertion of germline-ompetent indued pluripotent stem ells Keisuke Okit 1, Tomoko Ihisk 1,2 & Shiny Ymnk 1,2 ARTICL We hve previously shown tht pluripotent

More information

Effects of Planting Density and Weeding Time on Weeds and fenugreek Dry Mater

Effects of Planting Density and Weeding Time on Weeds and fenugreek Dry Mater Tehnil Journl of Engineering nd Applied Sienes Aville online t www.tjes.om 213 TJEAS Journl-213-3-23/335-3355 ISSN 251-853 213 TJEAS Effets of Plnting Density nd Weeding Time on Weeds nd Dry Mter Mehrnz

More information

Influence of Chemical Fertilizer Applications on Water Quality in Paddy Fields in Nong Harn, Sakon Nakhon Province, Thailand

Influence of Chemical Fertilizer Applications on Water Quality in Paddy Fields in Nong Harn, Sakon Nakhon Province, Thailand Ksetsrt J. (Nt. Si.) 49 : 868 879 (2015) Influene of Chemil Fertilizer Applitions on Wter Qulity in Pddy Fields in Nong Hrn, Skon Nkhon Provine, Thilnd Anurk Khruekhm 1,2, * Bundit Anurugs 2 nd Nth Hungspreug

More information

Effects of herbaceous vegetation control and aspen stem density on boreal mixedwood stand development. Partners Report Field Season

Effects of herbaceous vegetation control and aspen stem density on boreal mixedwood stand development. Partners Report Field Season www.forestreserh., Produt tlogue, Reports, RP-38 Effets of hereous vegettion ontrol nd spen stem density on orel mixedwood stnd development. Prtners Report - 26 Field Seson (FRP projet 13-31 (6331); SERG-I

More information

IncP-1 and PromA Group Plasmids Are Major Providers of Horizontal Gene Transfer Capacities Across Bacteria in the Mycosphere of Different Soil Fungi

IncP-1 and PromA Group Plasmids Are Major Providers of Horizontal Gene Transfer Capacities Across Bacteria in the Mycosphere of Different Soil Fungi Mirob Eol DOI 10.1007/s00248-014-0482-6 SOIL MICROBIOLOGY InP-1 nd PromA Group Plsmids Are Mjor Providers of Horizontl Gene Trnsfer Cpities Aross Bteri in the Myosphere of Different Soil Fungi Miozhi Zhng

More information

Meganuclease-mediated Virus Self-cleavage Facilitates Tumor-specific Virus Replication

Meganuclease-mediated Virus Self-cleavage Facilitates Tumor-specific Virus Replication originl rtile The Amerin Soiety of Gene & Cell Therpy Megnulese-medited Virus Self-levge Filittes Tumor-speifi Virus Replition Engin Gürlevik 1, Peter Shhe 1, Anneliese Goez 1, Arnold Kloos 1, Normn Woller

More information

Comparison the Effect of Different Treatments for Breaking Seed Dormancy of Citrullus colocynthis

Comparison the Effect of Different Treatments for Breaking Seed Dormancy of Citrullus colocynthis Comprison the Effet of Different Tretments for Breking Seed Dormny of Citrullus oloynthis Mortez Seri (Corresponding uthor) & Alirez Shhriri Fulty of Nturl Resoures, University of Zol P.O.Box: 98615-538,

More information

Bassam Kanaan Abdul Jabbar, Halimi Mohd Saud, Mohd Razi Ismail 1, Radziah Othman 2, Sheikh Hasna Habib and Hossain Kausar* 1

Bassam Kanaan Abdul Jabbar, Halimi Mohd Saud, Mohd Razi Ismail 1, Radziah Othman 2, Sheikh Hasna Habib and Hossain Kausar* 1 Legume Res., 36 (6) : 522-527, 2013 AGRICULTURAL RESEARCH COMMUNICATION CENTRE www.rjournls.om / indinjournls.om INFLUENCE OF MOLYBDENUM IN ASSOCIATION WITH RHIZOBIUM ON ENHANCED BIOLOGICAL NITROGEN FIXATION,

More information

Genetic barcode sequencing for screening altered population dynamics of hematopoietic stem cells transduced with lentivirus

Genetic barcode sequencing for screening altered population dynamics of hematopoietic stem cells transduced with lentivirus Cittion: Moleulr Therpy Methods & Clinil Development (214) 1, 1452; doi:1.138/mtm.214.52 214 The Amerin Soiety of Gene & Cell Therpy All rights reserved 2329-51/14 www.nture.om/mtm Artile Geneti rode sequening

More information

Job Description. Senior Lecturer. Electronic & Electrical Engineering. Education and Research. Head of Department/Group. Any research staff/students

Job Description. Senior Lecturer. Electronic & Electrical Engineering. Education and Research. Head of Department/Group. Any research staff/students Jo Desription Jo title Deprtment/Shool Jo fmily Senior Leturer Eletroni & Eletril Engineering Edution nd Reserh Grde 9 Reporting to Responsile for Lotion Hed of Deprtment/Group Any reserh stff/students

More information

Effects of salinity different levels on germination indices in four varieties of sunflower (Helianthus annuus L.)

Effects of salinity different levels on germination indices in four varieties of sunflower (Helianthus annuus L.) Interntionl Reserh Journl of Applied nd Bsi Sienes Aville online t www.irjs.om ISSN -X / Vol, ():- Siene Explorer Pulitions Effets of slinity different levels on germintion indies in four vrieties of sunflower

More information

MR405: Response of Young Black Spruce (Picea mariana (Mill.) B.S.P.) to a Mixture of Wood Ash and Secondary Papermill Sludge

MR405: Response of Young Black Spruce (Picea mariana (Mill.) B.S.P.) to a Mixture of Wood Ash and Secondary Papermill Sludge The University of Mine DigitlCommons@UMine Misellneous Reports Mine Agriulturl nd Forest Experiment Sttion -997 MR45: Response of Young Blk Sprue (Pie mrin (Mill.) B.S.P.) to Mixture of Wood Ash nd Seondry

More information

scientificreport ATM-mediated phosphorylation of SOG1 is essential for the DNA damage response in Arabidopsis scientific report

scientificreport ATM-mediated phosphorylation of SOG1 is essential for the DNA damage response in Arabidopsis scientific report sientifireport is essentil for the DNA dmge response in Aridopsis Koru O. Yoshiym 1,2+,JunyKoyshi 3,NouoOgit 1,MinkoUed 1,SeisukeKimur 2, Hisji Mki 1 & Mski Umed 1,4++ 1 Grdute Shool of Biologil Sienes,

More information

WEATHERING PERFORMANCE OF A WOOD SURFACE COATED WITH ACRYLIC RESIN CONTAINING UV ABSORBER

WEATHERING PERFORMANCE OF A WOOD SURFACE COATED WITH ACRYLIC RESIN CONTAINING UV ABSORBER Drewno 0, Vol. 0, No. 00 DOI: 0.8/wood.-98.9.0 WEATHERING PERFORMANCE OF A WOOD SURFACE COATED WITH ACRYLIC RESIN CONTAINING UV ABSORBER This study exmines the effets of -month nturl wethering test (Uzungöl

More information

Received: 9 February 2014 / Accepted: 18 April Wageningen Academic Publishers

Received: 9 February 2014 / Accepted: 18 April Wageningen Academic Publishers World Myotoxin Journl, 215; 8 (2): 171-179 SPECIAL ISSUE: Afltoxins in mize nd other rops Wgeningen Ademi P u l i s h e r s Climte hnge ftors nd Aspergillus flvus: effets on gene expression, growth nd

More information

Ag ricultural Experiment Station

Ag ricultural Experiment Station Tehnil Report TB07-01 Mrh 2007 Ag riulturl Experiment Sttion College of Agriulturl Sienes Deprtment of Soil nd Crop Sienes Western Colordo Reserh Center Investigtion of Orgni Weed Control Methods Investigtion

More information

Functional analysis of the Landsberg erecta allele of FRIGIDA

Functional analysis of the Landsberg erecta allele of FRIGIDA Shmlenh et l. BMC Plnt Biology 214, 14:218 RESEARCH ARTICLE Open Aess Funtionl nlysis of the Lndserg eret llele of FRIGIDA Ing Shmlenh 1, Lei Zhng 1, Mlgorzt Ryngjllo 1 nd José M Jiménez-Gómez 1,2* Astrt

More information