Mating-Type Distribution and Genetic Diversity of Cercospora sojina Populations on Soybean from Arkansas: Evidence for Potential Sexual Reproduction
|
|
- Janel Richard
- 6 years ago
- Views:
Transcription
1 Popultion Biology Mting-Type Distriution n Geneti Diversity of Cerospor sojin Popultions on Soyen from Arknss: Eviene for Potentil Sexul Reproution Hun Kim, Annky D. Newell, Royn G. Cot-Siekmeyer, John C. Rupe, Ahm M. Fkhoury, n Burton H. Bluhm First, seon, thir, fourth, n sixth uthors: Deprtment of Plnt Pthology, University of Arknss, Fyetteville 72701; n fifth uthor: Deprtment of Plnt, Soil n Agriulturl Systems, Southern Illinois University Cronle, Cronle Aepte for pulition 12 April ABSTRACT Kim, H., Newell, A. D., Cot-Siekmeyer, R. G., Rupe, J. C., Fkhoury, A. M., n Bluhm, B. H Mting-type istriution n geneti iversity of Cerospor sojin popultions on soyen from Arknss: Eviene for potentil sexul reproution. Phytopthology 103: Cerospor sojin uses frogeye lef spot of soyen, whih n use serious eonomi losses in the Unite Sttes. In this stuy, 132 C. sojin isoltes were ollete from six fiels (from two ounties, Cross n Crwfor) in Arknss. To etermine mting type, multiplex polymerse hin retion ssy ws evelope with primers speifi for C. sojin. Of the 132 isoltes, 68 isoltes h the MAT1-1-1 iiomorph n 64 isoltes h the MAT1-2 iiomorph; no isoltes possesse oth iiomorphs. Both mting types were present in vriety of sptil sles, inluing seprte lesions on iniviul leves. Clone-orrete t from eight mirostellites inite tht mting-type loi were present in pproximtely equl proportions in ll popultions nlyze, whih suggests tht Arknss popultions of C. sojin re unergoing rypti sexul reproution. All six popultions evlute h high genotypi iversity of 26 to 79%. In ition, mong strins isolte from single lef, multiple n istint hplotypes were ssoite with oth mting types, supporting the hypothesis tht sexul reproution ours within the popultions. Most popultions showe signifint gmeti isequilirium ut levels of isequilirium were reltively low, prtiulrly in popultions from Crwfor County. A low ifferentition inex (G ST ) ws oserve for ll simple-sequene repet mrkers ross ll popultions. Furthermore, the vlue of G sttistis etween popultions suggests tht signifint geneti exhnge exists mong the popultions. Tken together, these results emonstrte tht C. sojin popultions from Arknss re genetilly iverse n most likely unergoing sexul reproution. Frogeye lef spot (FLS), use y Cerospor sojin Hr, is n eonomilly importnt isese of soyen in the Unite Sttes (27). FLS ws first esrie in Jpn in 1915 (25), n the first report of C. sojin in the Unite Sttes ws in South Crolin in 1924 (25). For mny ees, FLS hs een prevlent in southern U.S. sttes (37,38) n, more reently, hs eome enemi throughout the U.S. Miwest n upper Miwest (26,42). Beyon the Unite Sttes, C. sojin hs een reporte in t lest 27 ountries spnning North n South Ameri, Europe, Afri, n Asi (6). Symptoms of FLS inlue irulr or ngulr lesions of 1 to 5 mm in imeter tht initilly resemle rk, wter-soke spots (13). As the isese progresses, lesions enlrge into istintive rown spots with reish-rown mrgins, whih n olese n use severe lef lighting or efolition. C. sojin overwinters in infeste soyen resiue n n survive in hevily infete see (27). The isese yle of FLS is initite y spores originting from infete lef eris or lesions on otyleons resulting from plnting hevily infete see (27). Lesions my not pper until 2 weeks fter invsion of tissue n, therefore, re not typilly oserve on young leves (27). However, onii my pper s erly s 48 h fter inoultion on plnts expose to fvorle tempertures (25 to 30 C) n high reltive humiity (>90%). Conii re rrie y ir urrents n rin splsh n use Corresponing uthor: B. H. Bluhm, E-mil ress: luhm@urk.eu PHYTO R 2013 The Amerin Phytopthologil Soiety seonry infetions throughout the growing seson when environmentl onitions re fvorle. Beuse FLS is polyyli isese, symptoms n inrese ontinuously throughout the growing seson n reh epiemi proportions when environmentl onitions re fvorle or suitle ontrol mesures re not employe. Regring the ltter, serious onern regring FLS mngement is the reent emergene of resistne to stroilurin fungiies mong U.S. popultions of C. sojin (45). The rte n mehnism of spre of fungiie resistne throughout popultions of C. sojin hve onsierle implitions for FLS mngement, yet re poorly unerstoo. The potentil role of sexul reproution mong popultions of C. sojin in FLS epiemiology n mngement hs not een estlishe. In mny plnt-pthogeni fungi, sexul reproution is key mehnism through whih geneti iversity is proue, n often llows fungl pthogens to overome host resistne y generting more fit genotypes through reomintion (11). However, for most Cerospor spp., inluing C. sojin, sexul stge hs not een oserve in either fiel or lortory onitions. Bse on moleulr nlyses, Cerospor spp. form monophyleti group within the teleomorphi genus Myospherell (6 8,12), n Myospherell teleomorphs hve een foun for few Cerospor spp. (9,39). Like mny other heterothlli somyetes, ompletion of the sexul yle in Cerospor spp. is preite on the presene n intertion of iniviuls with ifferent iiomorphs, nmely MAT1-1 n MAT1-2, t single mting-type lous (5,14). Although the istriution of mtingtype iiomorphs throughout nturl popultions of given fungus neither proves nor isproves the existene of sexul stge, equl Vol. 103, No. 10,
2 proportions of mting type iiomorphs re expete in popultions unergoing sexul reproution (28). In the sene of known sexul stge, severl pprohes n provie eviene of rypti sexul reproution, inluing mesurements of geneti iversity, popultion ifferentition, n mting-type frequenies (28). Popultions unergoing sexul reproution typilly hve high geneti iversity n equl mting-type frequenies ompre with popultions solely or preominntly reprouing sexully (28). Reent reports y Groenewl et l. (15,17) showe tht t lest some popultions of C. zee-myis, C. zein, n C. etiol hve 1:1 istriutions of mting type iiomorphs, n tht popultions of C. etiol hve high levels of geneti iversity. Bse on these results, the uthors postulte tht C. etiol popultions unergo sexul reomintion even though no teleomorph hs yet een oserve, n tht other speies of Cerospor my lso unergo rypti sexul reproution. In the present stuy, our overll gol ws to ssess whether popultions of C. sojin isolte from Arknss unergo sexul reproution. The speifi ojetives of this stuy were to (i) evelop multiplex polymerse hin retion (PCR) onitions for rpi ientifition of mting types in C. sojin n use this ssy to etermine the frequenies n istriutions of the two mting types, (ii) etermine the level of geneti iversity n popultion ifferentition etween n within popultions se on mirostellite nlyses, n (iii) ssess the possiility of sexul reproution in fiel popultions with multilous nlyses of popultion struture. To this en, 132 isoltes of C. sojin were ollete from two lotions in Arknss, n the mting type n hplotype of eh isolte ws efine n nlyze. From this work, more etile unerstning of the popultion struture of C. sojin hs emerge, inluing eviene for rypti sexul reproution. MATERIALS AND METHODS Soyen smpling n fungl isoltion. To isolte C. sojin from symptomti soyen tissue, leves with visile lesions were inute in moist hmer ( petri plte ontining moist filter pper) t room temperture for 2 to 3 ys with 12-h photoperio to inue sporultion. Leves were heke ily for the onset of sporultion with isseting mirosope. Conii were ollete with flme-sterilize neele n trnsferre onto V8 gr meium ontining mpiillin (100 µg/ml). The ultures were inute t room temperture until the olonies were lrge enough to trnsfer onto new V8 gr pltes. For single-spore isoltion, olonies were srpe with flme loop n streke onto fresh V8 gr pltes n, susequently, single isolte olonies were trnsferre to new V8 gr pltes. The pltes were inute for 5 to 7 ys fter olonies grew visily. All isoltes were store t 80 C in 20% glyerol. Soyen plnts showing typil FLS isese symptoms were ollete from six fiels in two ounties (Cross n Crwfor) in Arknss on 11 or 30 Septemer 2009, respetively; these two ounties re seprte y 300 km. Four popultions (popw1, n = 24; popw2, n = 23; popw3, n = 20; n popw4, n = 20) were ollete from four iniviul fiels ner Wynne, AR, in Cross County; eh fiel ws seprte y rowys whih were 10 m wie, n five to six isese plnts were ollete from eh fiel for C. sojin isoltion. Aitionlly, two popultions (popk1, n = 21 n popk2, n = 24) were isolte from two fiels of the University of Arknss Vegetle Reserh Sttion ner Kiler in Crwfor County, n smpling methos were performe s esrie ove. Ultimtely, from these six fiels, 132 C. sojin isoltes were ollete for further nlysis. DNA extrtion. A 0.5-y-0.5-m segment of myelium from eh single-spore isolte ws ollete from ultures grown on V8 gr meium n ple into 1.5-ml miroentrifuge tue ontining 100 µl of Tris-EDTA uffer (10 mm Tris-Cl n 1 mm EDTA, ph 7.5). The tissue ws groun in the tue with sterile miropestle followe y inution in oiling wter for 10 min. After entrifugtion, the onentrtion of genomi DNA in the superntnt ws quntifie with ND-1000 spetrophotometer (NnoDrop Tehnologies, Wilmington, DE). Multiplex PCR ssy for etermintion of mting types. Degenerte primer pirs MgMfSpMt1-1f1/1r2 n MgMfSpmt1-2f2/2r1 n Cerospor-speifi primer pirs CerosporMt1f/1r n CerosporMt2f/2r (Tle 1) (14) were use to mplify onserve regions of the MAT1-1-1 n MAT1-2 genes of C. sojin isoltes J2L2 n 07-IN. All PCR onitions were followe s esrie y Groenewl et l. (14). Retion prouts were nlyze y eletrophoresis in 1% (wt/vol) grose gel with ethiium romie t 0.1 µg/ml in 1 Tris-orte-EDTA (TBE) uffer, visulize on UV trnsillumintor, n purifie with the QIAquik gel extrtion kit (Qigen, Vleni, CA). PCR prouts were then sequene with the originl primers, n the sequene informtion ws eposite t GenBnk. From these sequenes, three sets of primers were esigne for multiplex PCR ssy: Csojin18Sf/28Sr, CsMt1f/1r, n CsMt2f/2r. Primers were synthesize y Integrte DNA Tehnologies (Corlville, IA). For eh PCR, the totl retion of 50 µl ontine 2 µl of genomi DNA, 10 µl of 10 PCR retion uffer, 2 µl of 10 mm NTPs, 10 pmol of primer sets CsMt1f/1r n CsMt2f/2r, 5 pmol of primer set Csojin18Sf/28Sr, 5 µl of 25 mm MgCl 2, n 0.7 units of Tq polymerse. The PCR retions were performe with 2720 Therml Cyler (Applie Biosystems, Crls, CA). The initil enturtion step of 94 C for 2 min ws followe y 40 yles of mplifition (94 C for 30 s, 58.5 C for 30 s, n 72 C for 1 min), followe y finl elongtion step of 72 C for 5 min. All PCR prouts were visulize uner UV light on 1% (wt/vol) grose gel ontining ethiium romie t 0.1 µg/ml in 1 TBE uffer fter eletrophoreti seprtion t 95 V for 1 h. TABLE 1. Primers use in multiplex polymerse hin retion (PCR) for ientifition of mting types Primer Sequene (5 3 ) Note Soure MgMfSpMt1-1f1 CATTNGCNCATCCCTTTG Degenerte primer 14 MgMfSpMt1-1r2 GGCTTNGANACCATGGTGAG Degenerte primer 14 MgMfSpmt1-2f2 CAAAGAANGCNTTCNTGATCT Degenerte primer 14 MgMfSpmt1-2r1 TTCTTCTCNGATGGCTTGC Degenerte primer 14 CerosporMt1f CTTGCAGTGAGGACATGG Degenerte primer 14 CerosporMt1r GAGGCCATGGTGAGTGAG Degenerte primer 14 CerosporMt2f GATNTACCNTCTCGA Degenerte primer 14 CerosporMt2r CTGTGGAGCAGTG Degenerte primer 14 Csojin18Sf TCTCCGTAGGTGAACCTGCG Multiplex PCR primer This stuy Csojin28Sr TATCCCTACCTGATCCGAGGTCAA Multiplex PCR primer This stuy CsMt1f TGAGGACATGGCCACCCAAATA Multiplex PCR primer This stuy CsMt1r AAGAGCCCTGTCAAGTGTCAGT Multiplex PCR primer This stuy CsMt2f TGTTGTAGAGCTCGTTGTTCGCA Multiplex PCR primer This stuy CsMt2r TCAGACCTTATGAGCTTGAAAGTGCT Multiplex PCR primer This stuy 1046 PHYTOPATHOLOGY
3 Anlysis of geneti iversity. To nlyze geneti iversity in eh popultion, we use eight mirostellite (simple sequene repet [SSR]) mrkers (Tle 2) tht showe high levels of polymorphism mong wie rnge of C. sojin isoltes (29). SSR loi were mplifie vi PCR in 25-µl retions ontining 100 ng of DNA, 30 nm forwr n reverse primers, 0.5 mm NTPs, 2.5 mm MgCl 2, n 0.7 units of Tq polymerse. Cyling prmeters onsiste of n initil enturtion t 95 C for 5 min; followe y 30 yles of 94 C for 30 s, 56 C for 30 s, 72 C for 60 s; n extension t 72 C for 7 min. Retion prouts were seprte y eletrophoresis in 3% Metphor grose gels n etete y stining with ethiium romie. A 10-p DNA ler (Invitrogen, Crls, CA) ws use s size mrker. Consistent with similr stuies, this pproh llowe resolution of 3 to 4 p mong PCR prouts (30). Polymorphi DNA ns were sore mnully with GenAlex 6 (35) to etermine the numer of hplotypes n rete input file formts require for other nlysis tools. The totl numer of lleles, numer of effetive lleles, n geneti iversity t eh SSR lous were estimte with POPGENE, version 1.32 (43), whih lso estimtes vlues of Nei s unise geneti ientity n istne for popultions. In ition, POPGENE (43) n GenoDive (24) were use to etermine inies of geneti ifferentition suh s G ST n G ST. Genotypi iversity ws estimte y the metho of Stort n Tylor (41), n normlize y iviing y the numer of smples in eh popultion, s esrie y Grunwl et l. (17). Multilous v1.3 (1) ws use to etermine the vlue of rbrd, n lterntive mesure of the inex of ssoition for isequilirium, n the numer of lous pirs in linkge isequiliri ws estimte with POPGENE, version 1.32 (43). RESULTS Optimiztion of multiplex PCR onitions. Although sequenes of eh mting-type iiomorph re firly well onserve mong mny Cerospor spp., primers previously esigne from other speies inonsistently mplifie C. sojin mting-type genes. Thus, the mting-type loi of C. sojin were sequene n new primers were esigne for rpi, high-throughput ssessment of mting types. Degenerte primers (Tle 1) were use to mplify portions of the mting-type genes MAT1-1-1 n MAT1-2, n PCR-se genome wlking ws susequently use to otin the full-length sequenes of oth iiomorphs. Sequenes of mting-type genes were eposite in the Ntionl Center for Biotehnology Informtion tse (MAT1-1-1, GenBnk numer JX n MAT1-2, GenBnk numer JX047866), n primers tht speifilly mplifie the mting-type lleles of C. sojin were rete (CsMt1f/r n CsMt2f/r) (Tle 1). Also, primer pir tht mplifies the internl trnsrie sper (ITS) region of rdna (GenBnk ession numer AY266156) of C. sojin ws esigne to provie n internl positive ontrol to onfirm the presene of mplifile DNA (Tle 1). Multiplex PCR onitions suh s nneling tempertures n primer onentrtions were optimize. To etermine the optimum temperture for PCR, the primers were teste t nneling tempertures of 57.5, 58, 58.5, 58.8, n 59 C. Consequently, 58.5 C ws etermine to e the optimum nneling temperture for mplifition se on the intensity of PCR prouts. Inresing the onentrtion of primer pirs CsMt1f/r n CsMt2f/r reltive to the primers mplifying the ITS region of rdna provie more equl mplifition of the two single-opy loi reltive to the multiopy rdna sequene. After evluting severl rtios of primer onentrtions, 10 pmol of CsMt1f/r n CsMt2f/r primer pirs with 5 pmol of primer pirs for rdna provie the most onsistent, even mplifition of ll three prouts. With this multiplex PCR ssy, the mting type lous of 132 C. sojin isoltes ws ssesse, n single mplion of either 406 p (MAT1-1-1) or 298 p (MAT1-2) ws otine from eh isolte (Fig. 1). None of the isoltes ontine oth iiomorphs. All retions proue n mplion of 500 p, onfirming the presene of mplifile DNA from the ITS region (Fig. 1). Thus, the ssy provie roust n relile tool to sore lleles t the mting type lous of C. sojin. Distriution of mting types within popultions. Among the 132 C. sojin isoltes ollete from Arknss, 68 isoltes possesse MAT1-1-1 n 64 isoltes possesse MAT1-2, frequeny tht oes not evite signifintly from 1:1 rtio (χ 2 = 0.12) (Tle 3). At the level of iniviul fiels, popultion popw3 n popk2 signifintly evite from the null hypothesis of 1:1 Fig. 1. Multiplex polymerse hin retion for MAT genes of 10 representtive isoltes. Lnes 1 (07-IN) n 2 (J2L2) re stnr strins for MAT1-2 n MAT1-1-1, respetively; lnes 3, 5, 7, 9, n 10 show isoltes tht hve MAT1-1-1; n lnes 4, 6, n 8 represent isoltes tht possess MAT1-2. ITS = internl trnsrie sper. TABLE 2. Simple-sequene repet (SSR) mrkers use to nlyze geneti iversity of Cerospor sojin Lous Primer sequene (5 3 ) Repet motif Size rnge (p) N e SSRCs1 F: GGTAATCGCCCAGATGAAGA (AAC) (179) 6 R: CGAGGAGGTTGGTTGTTGTT SSRCs2 F: CGCAAAATTTCAGTTCAGCA (GAA) (178) 5 R: CACGATTGAAGAATGCATGG SSRCs3 F: GACGGAATACGGGCTTATGA (TTC) (171) 4 R: TCAGAGACTTGTCGCCTCAG SSRCs4 F: CCATATTGTCGCCAGGTCTT (AGA) (189) 3 R: GCTCGCATCTGACATTTCCT SSRCs5 F: GCCCATGCTAATGACTGGAT (CGCTGTAT) (228) 3 R: GGCACGACACACCCTCTATG SSRCs6 F: TGGCGAAGACGTCTGATATG (TTG) (219) 3 R: TTCTTTCGCATTGCATCAAC SSRCs7 F: AAGTATCGGAGCGGACACAG (TTCT) (235) 3 R: GTCCAGGCGTTTTAGACGAG SSRCs8 F: CCCCATATGCTGCAGAGCTA (ATG) (171) 3 R: TCCCTTCTTTGTGCATCATC Originlly esrie y the Moleulr Eology Resoures Primer Development Consortium (29). F, forwr primer; R, reverse primer. Numers inite how mny times the repet ourre in the originl sequene. Numers in prentheses re the lengths of the lleles erive from the originl sequene. e Oserve numer of lleles. Vol. 103, No. 10,
4 rtio for the two mting type lleles (χ 2 = 7.2 n 8.17, respetively) (Tle 3). Upon initil onsiertion, this ppere to inite high mount of lonl propgtion, espeilly when onsiering tht the other popultions i not evite signifintly from 1:1 rtio of mting type lleles (Tle 3). At ll lotions, we oserve tht oth mting types were frequently etete mong isoltes ollete from istint lesions on iniviul leves. For exmple, popultions popw1, popw2, popw3, n popw4, eh of whih onsiste of 10 iniviuls isolte from single lef, h mting type rtios of 5:5, 5:5, 0:10, n 4:6, respetively (Tle 4). However, when lone-orrete t erive from nlyses of SSRs were use for the nlysis of mting-type istriution, none of the six popultions evite signifintly from 1:1 rtio of mting types (Tle 3). Thus, the presene of oth mting types mong popultions in lose physil proximity (e.g., iniviul leves) n the lone-orrete 1:1 mting type frequeny throughout sptilly istriute popultions re onsistent with the hypothesis tht sexul reproution is ourring in C. sojin popultions in Arknss. Genotypi iversity within popultions. Vrious moleulr mrkers suh s rnom mplifie polymorphi DNA, mplifie frgment length polymorphism, restrition frgment length polymorphism, n mirostellites (SSRs) hve een use to nlyze geneti iversity of Cerospor spp. (4,10,15,20,34). In popultions of C. etiol, Groenewl et l. showe the potentil of sexul reproution se on high genotypi iversity n pproximtely equl proportions of mting-type lleles mong popultions (15). In ition, the existene of oth mting types n ifferent genotypes, s etermine y SSR nlyses, in iniviul leves supports preitions of sexul reproution in C. etiol popultions (2). Reently, useful SSR mrkers were hrterize from C. sojin (Tle 2) (29). In this stuy, eight SSR loi were nlyze to test the hypothesis tht sexul reproution ws ourring in C. sojin popultions within Arknss. Among the 132 isoltes, 29 lleles were sore t eight SSR loi, n 71 hplotypes were etete. Also, we oserve hplotypes tht were unique to single popultion (12 in popw1, 11 in popw2, 7 in popw3, 6 in popw4, 11 in popk1, n 8 in popk2) n foun tht few hplotypes were present in multiple popultions. For exmple, only 11 hplotypes were foun in t lest two popultions, n just one hplotype ws present in five of the six popultions. Vlues of gene iversity (H) were 0.42 to 0.58, whih were high in ll popultions (Tle 3). The popk2 popultion h the lowest H n the popw1 n popw2 popultions h the highest vlues (Tle 4). Normlize genotypi iversity ( /N) ws estimte t vrious sptil sles: iniviul leves, fiels, n lotions (Tle 4). Bse on nlyses of eight polymorphi SSRs, genotypi iversity ws oserve in vrious rnges through ll popultions smple. Moreover, multiple hplotypes n oth mting types were oserve mong isoltes from iniviul leves, whih suggests tht none of the popultions were solutely lonl. The TABLE 3. Distriution of mting-type genes of Cerospor sojin popultions from Arknss Frequenies Popultion Numer of smples Clonl frtion MAT1-1-1 MAT1-2 Unorrete t Clone-orrete t P popw popw popw * popw popk popk * Totl Estimte s 1 [(numer of ifferent genotypes)/(totl numer of isoltes)] (44). Frequenies were lulte from unorrete smples. Asterisk (*) inites mting-type frequenies tht re signifintly ifferent t P < Proility (P) for χ 2 of lone-orrete t with 1 egree of freeom. χ 2 test TABLE 4. Genotypi n geneti iversity within popultions t ifferent sptil sles Sptil sle, popultion N N H H /N (%) e rbrd f LD (%) g Within lef popw popw popw popw Within fiel popw * 26/271 (9) popw * 24/279 (9) popw * 17/191 (9) popw * 39/228 (17) popk ** 12/190 (6) popk ** 7/207 (3) Within lotion popw * popk * Numer of smples in popultion. Numer of hplotypes. Nei s gene iversity (H) within popultions (31); inites not lulte. Genotypi iversity (Ĝ) ws lulte for eh popultion oring to the metho of Stort n Tylor (41). Ĝ = 1/Σpi 2, where pi = the oserve frequeny of the ith multilous genotype in popultion. e Normlize genotypi iversity ( /N) ws lulte y iviing y the numer of smples in eh popultion (17). f Stnrize inex of ssoition (rbrd) ws estimte from lone-orrete t (1), n the null hypothesis of multilous equilirium ws rejete if P < 0.01 (*) or 0.05 (**); inites not lulte. g Numer of lous pirs in linkge isequiliri (LD) t P < 0.01 (21). Vlues re isplye s the numer of lous pirs in isequiliri/totl numer of linkge pirs, with the perentge given in prentheses; inites not lulte PHYTOPATHOLOGY
5 TABLE 5. Nei s gene iversity (33) of Cerospor sojin t eight mirostellite (simple sequene repet [SSR]) loi from lone-orrete smples Lous N 0 N E H T H S H e ST SSRCs SSRCs SSRCs SSRCs SSRCs SSRCs SSRCs SSRCs Men Numer of lleles in the totl smples. Effetive numer of lleles. Gene iversity in the totl smples over ll popultions. Men gene iversity verge over ll popultions. e Nei s oeffiient of geneti ifferentition (32); lulte y H T H S /H T. All vlues were signifint t P < normlize genotypi iversity vrie etween popultions: 20 to 80% t the level of iniviul leves n fiels (Tle 4) s well s t the level of lotion (popw, Wynne n popk, Kiler). Tests for multilous gmeti isequilirium y inex of ssoition (rbrd) showe tht ll popultions were in signifint isequilirium (Tle 4). The lowest rbrd vlue ourre in popk1 (0.048), n oth popultions from Kiler h reltively low vlues ompre with popultions from Wynne, t to (P < 0.01). In ition, the perentge of lous pirs in signifint linkge isequilirium (χ 2 test, P < 0.01) in the six popultions rnge from 3% (7 of 207 pirs) in the popk2 popultion to 17% (39 of 228 pirs) in the popw4 popultion (Tle 4); t the P < 0.05 signifine level, the perentge ws 12 to 24% (t not shown). Geneti iversity n ifferentition of popultions. The ontriution of eh SSR lous to mesurements of geneti iversity vrie sustntilly (Tle 5). All eight loi evlute were polymorphi, with 2 to 5 lleles etete per lous (verge = 3.6 lleles), n the effetive numer of lleles ws 1.6 to 3.2 (Tle 5). Among the SSR loi nlyze, SSRCs7 h the highest H T n H S vlues, n lous SSRCs8 h the lowest (Tle 5). The SSR lous SSRCs1 h the highest fixtion inex (G ST, 0.139) n SSRCs7 h the lowest fixtion inex (G ST, 0.040); the verge G ST of ll loi ws (Tle 5). The low vlue of G ST oserve in this stuy ws onsistent with previous report of Myospherell grminiol popultions retining sexul reproution (18), n inites reltively high migrtion rte. Furthermore, when other prmeters suh s G ST n G ST were use, the vlues were lso reltively low (t not shown). Pirwise lultions of Nei s unise geneti ientity etween six popultions of C. sojin in Arknss were uniformly high (0.851 to 0.991) (Tle 6). Intriguingly, the vlues mong the popultions ollete t Wynne (0.945 to 0.991) were reltively high ompre with popultions ollete t Kiler (0.857) (Tle 6). In some ses, the geneti ientity etween popultions from ifferent lotions ws s high s tht oserve etween popultions from the sme lotion (e.g., popw2/popk2 versus popw2/popw4). The lowest geneti ientity (0.851) ws foun etween popw3 n popk1. These results inite tht the mjority of geneti iversity is istriute on smll sptil sle in Arknss. Relte to popultion ifferentition, G ST vlues etween popultions inite signifint geneti ifferentition etween pproximtely two-thirs of the pirwise omprisons; the remining omprisons were not signifint (Tle 6). Other prmeters suh s G ST, G ST, n Jost s D inite either low levels of ifferentition or nonifferentition. Overll, these vlues of ifferentition reflet the orreltion in geneti ientity etween popultions. Tken together, these results suggest tht there hs een signifint geneti exhnge mong the popultions. DISCUSSION In this stuy, we evelope multiplex PCR ssy to rpily sore mting type loi in C. sojin, n investigte geneti iversity n struture of Arknss popultions with polymorphi SSR mrkers. The popultions i not evite signifintly from 1:1 rtio of mting types, n the nlysis of SSRs supporte the hypothesis tht sexul reproution ours mong popultions of C. sojin. Aitionlly, y proviing the first moleulr-level perspetive of the geneti iversity mong popultions of C. sojin, this stuy provies importnt informtion to guie FLS mngement strtegies, prtiulrly in the ontext of emerging resistne to stroilurin fungiies, s well s ongoing efforts to improve FLS resistne vi onventionl reeing pprohes. Anlyses of multilous gmeti isequilirium y inex of ssoition (rbrd) showe tht ll popultions were in signifint isequilirium. However, it is importnt to note tht the presene of gmeti isequilirium within popultions of C. sojin is not surprising given the urrent unerstning of the FLS isese yle. The popultions nlyze in this stuy were otine from soyen fiels experiening high levels of FLS reltively lte in the growing seson n, thus, sexul reproution ws likely to preominte. Thus, rnom mting t speifi point in the isese yle (e.g., the initil or finl stge) is the most likely explntion for the simultneous etetion of high levels of genotypi iversity n signifint levels of gmeti isequilirium. Consistent with this onept, low inex of ssoition vlues hve een oserve in fungl popultions in whih sexul reproution is postulte to our t low levels (e.g., C. etiol n Pyrenophor teres f. sp. teres) (15,36). Aitionlly, popultions unerlying isese outreks my e ominte y losely relte iniviuls, euse ertin genotypes my e fvore y seletion pressure ssoite with environment or previling host genotypes (40). Host effets on pthogen iversity re prtiulrly relevnt for FLS in the Unite Sttes, in whih monoultures of reltively limite numer of soyen ultivrs my ominte wie geogrphil re. Thus, uring FLS outreks, ertin genotypes of the pthogen my inrese in frequeny n generte isequilirium until sexul reomintion hs h time to rnomize the geneti kgroun. TABLE 6. Nei s unise geneti ientity (32) n orrete stnrize fixtion inex (19,23) y pirwise omprisons of fiel popultions Geneti ientity/fixtion inex Popultion popw1 popw2 popw3 popw4 popk1 popk2 popw popw2 ns popw popw4 ns ns ns popk ns popk Geneti ientity (ove the igonl) n orrete stnrize fixtion inex (G ST, elow the igonl) vlues were signifint t P < 0.05; ns = nonsignifint. Vol. 103, No. 10,
6 Regring the linkge isequilirium oserve mong lous pirs, vriety of phenomen oul explin the levels of isequilirium etete in this stuy, inluing popultion strtifition, geneti rift, n linkge mong mrkers. However, in the sene of physil or geneti mp of the C. sojin genome, it is not urrently possile to exmine the uses of the linkge isequilirium oserve mong SSR mrkers in this stuy. Overll, the levels of genotypi iversity oserve within eh popultion were onsistent with levels of genotypi iversity typilly oserve in sexully reprouing popultions of fungi (28). Prtiulrly in popk1, the low lonl frtion, low gmeti isequilirium, high genotypi iversity, n equl frequenies of the two mting types re onsistent with reent or ongoing sexul reproution. Other popultions, in ontrst, h intermeite levels of isequilirium n moerte lonl frtions, most likely resulting from higher levels of sexul reproution or less outrossing. The ifferenes oserve etween popultions might e ue, in prt, to smll smple sizes or smpling methos rther thn popultion strutures. However, these ftors o not prelue the possiility of sexul reproution, espeilly onsiering tht smll mount of sexul reomintion my e suffiient to sustin high levels of genotypi iversity (22). The level of geneti iversity oserve mong popultions of C. sojin in Arknss inites tht sexul reproution my filitte rpi pttion in the pthogen. This fining hs signifint implitions for the mngement of FLS. First, sexul reproution presumly provies C. sojin mehnism to overome host resistne. Consistent with this ie, multiple res of C. sojin hve een esrie se on virulene on ifferentil soyen ultivrs (25), eh of whih presumly possesses istint set of resistne genes. The high level of geneti iversity ientifie in this stuy suggests tht mny more res of C. sojin re likely to exist or re ple of rising in response to seletion pressure n, thus, onventionl strtegies to ree for resistne shoul tke high levels of iversity into ount. For exmple, sexul reomintion is likely to e ourring outsie of Arknss popultions of C. sojin n, thus, resistne tht is roust in one geogrphil re my not e effetive or urle ginst regionlly istint popultions of the pthogen. Seon, rypti sexul reomintion in C. sojin my elerte the spre of resistne to stroilurin fungiies. For exmple, if the initil emergene of stroilurin resistne ours t reltively low frequeny, resistne woul e present in limite numer of hplotypes (n presumly only few res) in the sene of sexul reomintion. Thus, the spre of resistne oul e limite y nturl onstrints on the ility of those speifi hplotypes to spre. Sexul reomintion, however, oul rpily elerte the istriution of fungiie resistne throughout popultions n into iverse geneti kgrouns of the pthogen. In this senrio, lolize emergene of resistne oul oneivly e istriute throughout mny res within few sexul yles. Resistne to stroilurin fungiies ontinues to e reporte in new lotions throughout the Unite Sttes; therefore, popultions of resistnt isoltes oul e evlute s esrie in this stuy to ssess the role tht sexul reproution plys in issemintion of resistne. The results of this stuy ll for itionl experimenttion to ress the potentil role of sospores in the epiemiology of FLS. The C. sojin popultions nlyze in this stuy were ollete from fiels in whih plnts were pprohing mturity n exhiiting lrge numers of lesions per lef, whih more urtely pproximtes the pek of n outrek rther thn its initition. Bse on the levels of geneti iversity etete in this stuy n the lk of oservtions of sexul fruiting oies or sospores uring folir isese evelopment, it is possile tht FLS is initite, t lest in some yers or irumstnes, y sospores forme in resiul lef eris from the previous growing seson; in this senrio, sospores oul e isperse lolly or over onsierle istnes, s hs een oserve for relte Myospherell spp. (3). Although the popultions nlyze in this stuy h outlessly unergone severl yles of sexul reproution efore smpling ourre, the lone-orrete results still inite tht sexul reproution ws likely to e riving fore unerlying the oserve popultion iversity. The extent to whih rypti sexul reproution is preite to e ourring mong glol popultions of C. sojin oul e etermine y nlyzing popultions ollete from itionl, geogrphilly iverse lotions. Moreover, temporl nlyses of geneti iversity of C. sojin popultions throughout the initition, pex, n onlusion of isese outrek oul potentilly illuminte the timing n importne of sexul reproution within growing seson. In this stuy, eight polymorphi SSR mrkers, with repet motifs of three to eight ses (Tle 2), were use to nlyze popultions of C. sojin. These mrkers were suffiiently polymorphi to sore on high-resolution grose gels with onventionl eletrophoresis rther thn more sophistite nlysis pltforms, suh s pillry eletrophoresis. Anlyses of SSR mrkers on grose gels hs the istint vntges of eing inexpensive n wiely essile (30); thus, this pproh ws selete with the hope of filitting follow-up stuies mong memers of the U.S. n interntionl FLS reserh ommunity, in whih wie rnge of geogrphilly istint C. sojin popultions oul potentilly e nlyze. However, it is possile tht ertin level of geneti iversity will e lost with grose-se nlyses ue to less resolution of PCR prout sizes ompre with other methos. We elieve tht SSR mrkers with lrger repet motifs, s use in this stuy, ovite this onern to onsierle extent, eviene of whih is the ft tht grosese nlyses of the SSR mrkers use in this stuy ientifie suffiient iversity to strongly support preitions of rypti sexul reproution within Arknss popultions of C. sojin. As itionl genome sequene resoures eome ville for C. sojin, the ientifition n eployment of new SSR mrkers will outlessly ontriute to future efforts to stuy the geneti iversity of the pthogen. Thus, in the future, refine methos of SSR nlysis my e require to fully ress questions of geneti iversity in C. sojin. Bse on the high levels of geneti iversity oserve within Arknss popultions of C. sojin, new hypotheses regring the geneti sis of host speifiity n e formulte n teste. Mny speies of Cerospor, inluing C. sojin, hve nrrowly restrite host rnge (6). The geneti n moleulr sis of host speifiity mong Cerospor spp. is fsinting yet poorly stuie phenomenon, n hs ro potentil implitions for the mngement of Cerospor iseses s well s the refinement of txonomi reltionships within the genus. Historilly, host rnge ws key omponent of the speies onept mong Cerospor spp., lthough reent refinements to the txonomy of Cerospor spp., inluing C. sojin, hve rwn most hevily on morphologil hrteristis n DNA sequene informtion t selete loi (16). To te, C. sojin hs een reporte s pthogeni on hnful of speies within the Leguminose fmily, preominntly of the gener Glyine n Muun (6). Given this host rnge, future experiments oul e evise to test whether reltionships exist etween selete C. sojin genotypes n pthogeniity on vrious plnt speies reporte to e omptile hosts for the pthogen, thus potentilly lrifying the importne of host rnge s omponent of the speies onept for the orgnism. ACKNOWLEDGMENTS This reserh ws supporte y the Unite Soyen Bor (wr numer 2262), the Arknss Soyen Promotion Bor, n the University of Arknss Division of Agriulture. We thnk S. Goowin for guine uring the preprtion of the mnusript PHYTOPATHOLOGY
7 LITERATURE CITED 1. Agpow, P. M., n Burt, A Inies of multilous linkge isequilirium. Mol. Eol. Notes 1: Bolton, M. D., Seor, G. A., River, V., Weiln, J. J., Ruolph, K., Birl, K., Rengifo, J., n Cmpell, L. G Evlution of the potentil for sexul reproution in fiel popultions of Cerospor etiol from USA. Fungl Biol. 116: Brunner, P. C., Stefnto, F. L., n MDonl, B. A Evolution of the CYP51 gene in Myospherell grminiol: Eviene for intrgeni reomintion n seletive replement. Mol. Plnt Pthol. 9: Ci, G., n Shneier, R. W Popultion struture of Cerospor kikuhii, the usl gent of Cerospor lef light n purple see stin in soyen. Phytopthology 98: Coppin, E., Deuhy, R., Arnise, S., n Pir, M Mting types n sexul evelopment in filmentous somyetes. Miroiol. Mol. Biol. Rev. 61: Crous, P. W., n Brun, U Myospherell n its nmorphs: 1. Nmes pulishe in Cerospor n Psslor. CBS Bioivers. Ser. 1: Crous, P. W., Groenewl, J. Z., Groenewl, M., Clwell, P., Brun, U., n Hrrington, T. C Speies of Cerospor ssoite with grey lef spot of mize. Stu. Myol. 55: Crous, P. W., Groenewl, J. Z, Mnsill, J. P., Hunter, G. C., n Wingfiel, M. J Phylogeneti ressessment of Myospherell spp. n their nmorphs ourring on Eulyptus. Stu. Myol. 50: Deighton, F. C New nmes in Myospherell (M. rhiis n M. pruni-persii) n vlition of M. rosiol. Trns. Br. Myol. So. 50: Dunkle, L. D., n Levy, M Geneti relteness of Afrin n Unite Sttes popultions of Cerospor zee-myis. Phytopthology 90: Glss, L. N., n Kulu, G. A Mting type n vegettive inomptiility in filmentous somyetes. Annu. Rev. Phytopthol. 30: Goowin, S. B., Dunkle, L. D., n Zismnn, V. L Phylogeneti nlysis of Cerospor n Myospherell se on the internl trnsrie sper region of riosoml DNA. Phytopthology 91: Gru, C. R., Dorrne, A. E., Bon, J., n Russin, J. S Fungl iseses. Pges in Soyens: Improvement, Proution, n Uses. H. R. Boerm n J. E. Speht, es. ASA, CSSA, n SSSA, Mison, WI. 14. Groenewl, M., Groenewl, J. Z., Hrrington, T. C., Aeln, E. C., n Crous, P. W Mting type gene nlysis in pprently sexul Cerospor speies is suggestive of rypti sex. Fungl Genet. Biol. 43: Groenewl, M., Line, C. C., Groenewl, J. Z., n Crous, P. W Iniret eviene for sexul reproution in Cerospor etiol popultions from sugr eet. Plnt Pthol. 57: Groenewl, J. Z., Nkshim, C., Nishikw, J., Shin, H.-D., Prk, J.-H., Jm, A. N., Groenewl, M., Brun, U., n Crous, P. W Speies onepts in Cerospor: Spotting the wees mong the roses. Stu. Myol. 75: Grunwl, N. J., Goowin, S. B., Milgroom, M. G., n Fry, W. E Anlysis of genotypi iversity t for popultions of miroorgnisms. Phytopthology 93: Gurung, S., Goowin, S. B., Kge, M., Bokus, W. W., n Ahikri, T. B Geneti ifferentition t mirostellite loi mong popultions of Myospherell grminiol from Cliforni, Inin, Knss, n North Dkot. Phytopthology 101: Herik, P A stnrize geneti ifferentition mesure. Evolution 59: Imzki, I., Homm, Y., Kto, M., Vllone, S., Yorinori, J. T., Henning, A. A., Iizumi, H., n Koizumi, S Geneti reltionships etween Cerospor kikuhii popultions in South Ameri n Jpn. Phytopthology 96: Lee, J.-K., Kim, H., Jeon, J.-J., Kim, H.-S., Zeller, K. A., Crter, L. L. A., Leslie, J. F., n Lee, Y.-W Popultion struture of n myotoxin proution y Fusrium grminerum from mize in South Kore. Appl. Environ. Miroiol. 78: Leslie, J. F., n Klein, K. K Femle fertility n mting type effets on effetive popultion size n evolution in filmentous fungi. Genetis 144: Meirmns, P. G., n Herik, P. W Assessing popultion struture: F ST n relte mesures. Mol. Eol. Resour. 11: Meirmns, P. G., n Vn Tieneren, P. H GENOTYPE n GENODIVE: Two progrms for the nlysis of geneti iversity of sexul orgnisms. Mol. Eol. Notes 4: Melhers, L. E Diseses of erel n forge rops in the Unite Sttes in Plnt Dis. Rep. (Suppl.) 40: Mengistu, A., Kurtzweil, N. C., n Gru, C. R First report of frogeye lef spot (Cerospor sojin) in Wisonsin. Plnt Dis. 86: Min, M. A., Missoui, A. M., Wlker, D. R., Phillips, D. V., n Boerm, H. R Frogeye lef spot of soyen: A review n propose re esigntions for isoltes of Cerospor sojin Hr. Crop Si. 48: Milgroom, M. G Reomintion n the multilous struture of fungl popultions. Annu. Rev. Phytopthol. 34: Moleulr Eology Resoures Primer Development Consortium, Anris, M., Aris, M. C., Brthel, B. L., Bluhm, B. H., Brie, J., Cnl, D., Chen, X. M., Cheng, P., Chippero, M. B., Coelho, M. M., Collins, A. B., Dsh, M., Dvis, M. C., Durte, M., Duois, M. P., Frnçoso, E., Glmes, M. A., Gopl, K., Jrne, P., Kle, M., Krzmrski, L., Kim, H., Mrtell, M. B., Mrie, R. S., Negri, V., Negro, J. J., Newell, A. D., Piee, A. F., Puhulutegui, C., Rggi, L., Smonte, I. E., Srsol, J. H., See, D. R., Seyoum, S., Silv, M., Solro, C., Tolley, K. A., Tringli, M., Vsemägi, A., Xu, L. S., n Znón-Mrtínez, J Permnent geneti resoures e to Moleulr Eology Resoures Dtse 1 Ferury Mrh Mol. Eol. Resour. 12: Morgnte, M., Pfeiffer, A., Jurmn, I., Pgli, G., n Olivieri, A. M PCR nlysis of SSR polymorphisms in plnts using grose gels. Pges in: Moleulr Tools for Sreening Bioiversity: Plnts n Animls. A. Krp, D. S. Ingrm, n P. G. Is, es. Kluwer Aemi Pulishers, Dorreht, The Netherlns. 31. Nei, M Anlysis of gene iversity in suivie popultions. Pro. Ntl. A. Si. USA 70: Nei, M Estimtion of verge heterozygosity n geneti istne from smll numer of iniviuls. Genetis 89: Nei, M Moleulr Evolutionry Genetis. Columi Press, New York. 34. Okori, P., Ruihyo, P. R., Ekwmu, A., Fhleson, J., n Dixelius, C Geneti hrteriztion of Cerospor sorghi from ultivte n wil sorghum n its reltionship to other Cerospor fungi. Phytopthology 94: Pekll, R., n Smouse, P. E GENALEX 6: Geneti nlysis in Exel. Popultion geneti softwre for tehing n reserh. Mol. Eol. Notes 6: Ru, D., Brown, A. H. D., Bruker, C. L., Attene, G., Blms, V., S, E., n Pp, R Popultion geneti struture of Pyrenophor teres Drehs., the usl gent of net loth of rley (Horeum vulgre L.). Theor. Appl. Genet. 106: Rosso, M. L., Vzquez, A., n Riney, K. M First report of frogeye lef spot of soyen use y Cerospor sojin re 11 in Virgini. Plnt Dis. 95: Sinlir, J. B., n Bkmn, P. A A Compenium of Soyen Diseses, 3r e. Amerin Phytopthologil Soiety, St. Pul, MN. 39. Sivnesn, A Teleomorphs of Cerospor sesmi n Ceroseptori sesmi. Trns. Br. Myol. So. 85: Smith, M. J., Feil, E. J., n Smith, N. H Popultion struture n evolutionry ynmis of pthogeni teri. BioEssys 22: Stort, J. A., n Tylor, J. F Genotypi iversity: Estimtion n preition in smples. Genetis 118: Yng, X. B., Uphoff, M. D., n Snogo, S Outreks of soyen frogeye lef spot in Iow. Plnt Dis. 85: Yeh, F. C., Yng, R. C., Boyle, T. B. J., Ye, Z. H., n Mo, J. X POPGENE, the User-Frienly Shrewre for Popultion Geneti Anlysis. Moleulr Biology n Biotehnology Centre, University of Alert, Cn. 44. Zhn, J., Munt, C. C., Hoffer, M. E., n MDonl, B. A Lol pttion n effet of host genotype on the evolution of virulene: An experimentl test in plnt pthosystem. J. Evol. Biol. 15: Zhng, G. R., Newmn, M. A., n Brley, C. A First report of the soyen frogeye lef spot fungus (Cerospor sojin) resistnt to quinone outsie inhiitor fungiies in North Ameri. Plnt Dis. 96:767. Vol. 103, No. 10,
Crop Rotations, Reduced Tillage and N Fertilization Effects on Corn Yields And Aflatoxin Levels
Crop Rottions, Redued Tillge nd N Fertiliztion Effets on Corn Yields And Afltoxin Levels J.E. Mtoh nd M. Rihrdson Texs AgriLife Reserh nd Extension Center Stte Hwy Corpus Christi, TX 78- jmtoh@g.tmu.edu
More information2014 Southeast Hay Convention
214 Southest Hy Convention Effet of Polymer-Cote Ure on Bermugrss Forge Proution Effet of Polymer-Cote Ure on Bermugrss Forge Proution Introution Without A, users of fe risky lterntives. - H 3 voltiliztion
More informationEXPLORING BIOFUMIGATIONAL POTENTIAL OF MUSTARDS
EXPLORING BIOFUMIGATIONAL POTENTIAL OF MUSTARDS Oleg Dugovish*, (University of Cliforni Coopertive Extension - Ventur County), Jmes Downer nd Ole Beker (University of Cliforni Coopertive Extension -Ventur
More information2013 Small Grain Forage Trial: Species x Harvest Date
213 Smll Grin Forge Tril: Speies x Hrvest Dte Dr. Hether Dry, UVM Extension gronomist Susn Monhn, Conner urke, Eri Cummings, n Hnnh Hrwoo UVM Extension Crops n Soils Tehniins 82-524-651 Visit us on the
More informationInvestigation of Physicochemical Changes of Rice and Soaking Water during Cooking
Amerin-Eursin J. Agri. & Environ. Si., 17 (5): 422-426, 2017 ISSN 1818-6769 IDOSI Pulitions, 2017 DOI: 10.5829/iosi.ejes.2017.422.426 Investigtion of Physiohemil Chnges of Rie n Soking Wter uring Cooking
More informationDiatomite and re-use coal waste as promising alternative for fertilizer to environmental improvement
Artile Ditomite n re-use ol wste s promising lterntive for fertilizer to environmentl improvement Mohmm Hssn Syyri-Zhn 1, AolHmi Gholmi 2, Somyeh Rezeepour 2 1 Assistnt Prof, Deprtment of Soil Siene, Fulty
More informationScreening for temperature tolerance of some. Aspergillus spp. Lahore-54590, Pakistan. *E. mail:
Myopth (8) 6(&): 7- Sreening for temperture tolerne of some spergillus spp. *Neelm Nzir n Ghzl Nsim Lhore ompost (Pvt.) Lt. Mehmoo ooti, Ring Ro, Lhore, Pkistn. Institute of Myology n Plnt Pthology, University
More informationTILLAGE SYSTEM EFFECTS ON INPUT EFFICIENCY OF WINTER WHEAT, MAIZE AND SOYBEAN IN ROTATION
NARDI FUNDULEA, ROMANIA ROMANIAN AGRICULTURAL RESEARCH, NO. 27, 21 www.in-funule.ro Print ISSN 1222-4227; Online ISSN 267-572 TILLAGE SYSTEM EFFECTS ON INPUT EFFICIENCY OF Alexnru I. Coiu 1 1 Ntionl Agriulturl
More informationsensitive VBSs Vh subdomains EF EF
Tlin- Tlin-EGFP-His 2 3 2 3 ABD Mehno- ABD2 ABD3 sensitive VBSs DD 6xHis EGFP Vh sudomins EGFP-Vinulin EGFP 2 3 4 Vt EGFP-Vh EGFP 2 3 4 -tinin- CH CH2 SP SP SP SP EF EF mcherry--tinin- mcherry CH CH2 SP
More informationConcerns about climate change
3 Lrge-sle forests for ioenergy: ln-use, eonomi n environmentl implitions An nlysis of ntionl-level impts of plnttion forestry for energy proution in New Zeln useful tool for strtegi eision-mking. M. Jk
More informationBroken rice facts. Physical and Functional Characteristics of Broken Rice Kernels. Parboiling Process. May 23, Production of broken rice 14-10%
My 23, 218 Physil nd Funtionl Chrteristis of Broken Rie Kernels Broken rie fts Redued eonomi vlue Undesirle Inevitle Ree M. Brue University of Arknss Advisor: Dr. Griffiths G. Atungulu Inexpensive Affets
More informationPreparation of Ultrafine Silver Powder Using Glycerol as Reducing Agent
Journl of Metls, Mterils n Minerls, Vol.18 No.2 pp.1-5, 28 Preprtion of Ultrfine Silver Power Using Glyerol s Reuing Agent Eksit NISARATANAPORN n Kittiporn WONGSUWAN Deprtment of Metllurgil Engineering,
More informationSUPPLEMENTARY INFORMATION
SI Fig. PrpS is single copy gene k 3. 9... EcoRV EcoRV k 5 BmH Pst c well k HindIII HindIII HindIII.3.5 3.. Southern lots of Ppver genomic DNA from plnts with SS8 hplotypes, hyridized with PrpS proe..
More informationChrome River Job Aid Reconciling PCard in Chrome River
Chrome River Jo Ai Reoniling PCr in Chrome River 1. Log into Chrome River. 2. Open e-wllet to etermine types of trnstions to e reonile. From the Home sreen:. Selet the hmurger menu ion. Selet ewllet. The
More informationOrganic Cover Crop Research at WSU Puyallup
Orgnic Cover Crop Reserch t WSU Puyllup Ferury 8 Crig Cogger, Andy Bry, nd Liz Myhre Wshington Stte University Puyllup Reserch nd Extension Center Astrct: Cover crops re loclly grown source of orgnic mtter
More informationOne-pot selective conversion of furfural into 1,5-pentanediol
Supplementry Informtion for One-pot seletive onversion of furfurl into 1,5-pentneiol over P -e Ir-ReO x /SiO 2 ifuntionl tlyst Sio Liu, Ysushi Am, Mszumi Tmur, Yoshino Nkgw* n Keiihi Tomishige* Deprtment
More informationFood Arthropod Abundance Associated with Rest-Rotation Livestock Grazing. Hayes B. Goosey. Department of Animal and Range Sciences
Food Arthropod Aundnce Associted with Rest-Rottion Livestock Grzing Hyes B. Goosey Deprtment of Animl nd Rnge Sciences Montn Stte University We hve completed the second seson of investigtion into the response
More informationKissi Wakweya and Reta Dargie. Oromia Agricultural Research Institute, Sinana Agricultural Research Center, P.O. Box 208, Bale-Robe, Ethiopia
Amerin-Eursin J. Agri. & Environ. Si., 7 (5): 383-39, 207 ISSN 88-6769 IDOSI Pulitions, 207 DOI: 0.5829/iosi.ejes.207.383.39 Effet of Different Wee Mngement Prties on Growth, Yiel n Yiel Components of
More informationMICRO-MECHANICAL BEHAVIOR STUDY OF NON-METALLIC INCLUSIONS IN P/M DISK SUPERALLOY RENE 95
Superlloys 2004 Eite y K.A. Green, T.M. Pollok, H. Hr, T.E. Howson, R.C. Ree, J.J. Shirr, n S, Wlston TMS (The Minerls, Metls & Mterils Soiety), 2004 MICRO-MECHANICAL BEHAVIOR STUDY OF NON-METALLIC INCLUSIONS
More informationImproving Water and Nutrient Use Efficiency of Potato by Partial Root-Zone Drying Irrigation in a Semi-Arid Area in China: A Field Experimental Study
YAN SHI et l: IMPROVING WATER AND NUTRIENT USE EFFICIENCY OF POTATO BY PARTIAL ROOT-... Improving Wter n Nutrient Use Effiieny of Potto y Prtil Root-Zone Drying Irrigtion in Semi-Ari Are in Chin: A Fiel
More informationInternational Tourism Operations 2 Sample Questions
4867-015 Interntionl Tourism Opertions 2 Smple Questions 1 Whih one of the following is the est wy for trvel ontt entre to onut n immeite review of ustomer servie levels? Sening out questionnires. Reoring
More informationPrimer in Population Genetics
Primer in Popultion Genetics Hierrchicl Orgniztion of Genetics Diversity Primer in Popultion Genetics Defining Genetic Diversity within Popultions Polymorphism number of loci with > 1 llele Number of lleles
More informationH. Randall Smith; Ph.D. Agronomy and Wayne Porter: Ph.D. Horticulture Mississippi State University Extension Service
Effect of SumGrow on growth, development nd yield of Irish pottoes (Solnum tuerosum) t the Beumont Reserch Sttion (Mississippi Stte University) during 217 H. Rndll Smith; Ph.D. Agronomy nd yne Porter:
More informationRAIN (RAndom INsertion) Scheduling Algorithm for SoC Test
RAIN (RAnom INsertion) Sheuling Algorithm for SoC Test Jung-Been Im Sunghoon Chun Geune Kim Jin-Ho An Sungho Kng Deprtment of Eletril n Eletroni Engineering Yonsei University 134, Shinhon-Dong Seoemoon-Gu,
More informationTHE EFFECT OF SOIL MOISTURE ON RESIDUAL FLUID AND GRANULAR PHOSPHORUS AVAILABILITY
THE EFFECT OF SOIL MOISTURE ON RESIDUAL FLUID AND GRANULAR PHOSPHORUS AVAILABILITY Therese MBeth 1, Mike MLughlin 1,2, Json Kiry 2, Dvi Chittleorough 3 n Roger Armstrong 4 1 Shool of Agriulture, Foo n
More informationMicrobial community dynamics and function associated with rhizosphere over periods of rice growth
Miroil ommunity ynmis n funtion ssoite with rhizosphere over perios of rie growth Q. Hussin 1,2, G.X. Pn 1, Y.Z. Liu 1, A. Zhng 1, L.Q. Li 1, X.H. Zhng 1, Z.J. Jin 1 1 Institute of esoures, Eosystem n
More informationGenetics and Resistance
Genetis nd Resistne Development of Co-Dominnt Amplified Polymorphi Sequene Mrkers in Rie tht Flnk the Mgnporthe grise Resistne Gene Pi7(t) in Reominnt Inred Line 29 M. A. Cmpell, D. Chen, nd P. C. Ronld
More informationSteels used in braking systems
Steels use in rking systems A report A mterils engineer is require to prepre report on the seletion of plin ron steels for use in the proution of vrious omponents for rke mnufturing ompny. Portions of
More informationEffect of Water Stress on Seed Germination of Agropyron Elongatum, Agropyron Desertourm & Secale Montanum
DESERT DESERT Online t http://jesert.ut..ir DESERT 7 () 49-5 Effet of Wter Stress on See Germintion of Elongtum, Desertourm & Sele Montnum E. Zni Esfhn *, H. Azrnivn Assistnt Professor, Reserh Institute
More informationUnprecedented inhibition of tubulin polymerization directed by gold nanoparticles inducing cell cycle arrest and apoptosis
Eletroni supplementry informtion (ESI) for Nnosle Unpreedented inhiition of tuulin polymeriztion direted y gold nnoprtiles induing ell yle rrest nd poptosis Diptimn Choudhury,,e, Pulrjpilli Lourdu Xvier,,
More informationPRODUCTIVITY STUDY OF FOUR AVOCADO CULTIVARS IN ALGARVE REGION
1999. Revist Chpingo Serie Hortiultur 5: 73-76. PRODUCTIVITY STUDY OF FOUR AVOCADO CULTIVARS IN ALGARVE REGION Edurdo Leopoldo Ferreir Direção Regionl de Agriultur do Algrve Aprtdo 282, 8 Fro Portugl SUMMARY
More informationSUPPLEMENTARY INFORMATION
DOI: 1.138/n74 In the formt provided y the uthors nd unedited. d 331p 637p 9p 394p 48p 467p 22p 23p 489p 419p 3p 493p 332p 53p 39p 1 G1: 16.4% S: 73.1% G2/M: 1.5% 2 1 2 E-KO G1: 2.2% S: 7.7% G2/M: 9.1%
More informationTechnology & Prod uct Reports Does Amendment of Soak Solution with Sucrose and Urea Increase Production of Shiitake Mushrooms on Sawdust Blocks?
Tehnology & Prod ut Reports Does Amendment of Sok Solution with Surose nd Ure Inrese Prodution of Shiitke Mushrooms on Swdust Bloks? Cthy Sot, Cul Beyl, nd Gokul Ghle ADDITIONAL INDEX WORDS. iologil effiieny,
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nture10924 no tg Lsm1-my Lsm2-my Lsm5-my Lsm6-my Lsm7-my Lsm8-my no tg Lsm1-my Lsm2-my Lsm5-my Lsm6-my Lsm7-my Lsm8-my kd 220 120 100 80 60 50 40 30 20 SeeBlue Mrker Mgi Mrk no tg Sm1-my Smd3-my
More informationPHOSPHORUS SOURCE EFFECTS ON DRYLAND WINTER WHEAT IN CROP- FALLOW ROTATIONS IN EASTERN WASHINGTON
PHOSPHORUS SOURCE EFFECTS ON DRYLAND WINTER WHEAT IN CROP- FALLOW ROTATIONS IN EASTERN WASHINGTON Richrd Koenig, Deprtment of Crop nd Soil Sciences Aron Esser, Lincoln/Adms County Extension Wshington Stte
More informationQuantification of Field Resistance to Verticillium dahliae in Eight Russet-Skinned Potato Cultivars Using Real-Time PCR
Am. J. Potto Res. (2013) 90:158 170 DOI 10.1007/s12230-012-9280-1 Quntifition of Fiel Resistne to Vertiillium hlie in Eight Russet-Skinne Potto Cultivrs Using Rel-Time PCR J. S. Pshe & A. L. Thompson &
More informationEconomic Evaluation of Glyphosate-Resistant and Conventional Sugar Beet 1
Weed Tehnology. 24. Volume :3 396 Eonomi Evlution of Glyphoste-Resistnt nd Conventionl Sugr Beet ANDREW R. KNISS, ROBERT G. WILSON, ALEX R. MARTIN, PAUL A. BURGENER, nd DILLON M. FEUZ 2 Astrt: Field experiments
More informationSLASH PINE FAMILIES IDENTIFIED WITH HIGH RESISTANCE TO FUSIFORM RUST. C. H. Walkinshaw '
SLASH PINE FAMILIES IDENTIFIED WITH HIGH RESISTANCE TO FUSIFORM RUST C. H. Wlkinshw ' Abstrct.--Fusiform rust redily kills slsh pine, Pinus elliottii Engelm. vr. elliottii. When the number of rust-infected
More informationEffects of various organic materials on soil aggregate stability and soil microbiological properties on the Loess Plateau of China
Vol. 59, 213, No. 4: 162 168 Plnt Soil Environ. Effets of vrious orgni mterils on soil ggregte stility n soil miroiologil properties on the Loess Plteu of Chin F. Wng 1, Y.A. Tong 1, J.S. Zhng 1, P.C.
More informationConservation Tillage Strategies For Corn, Sorghum And Cotton
(93%) cotton nd percent lint ws similr in oth pickers. The 15-inch row system with 27 plnts/a gve higher lint yield (1491 l/a) compred to 4-inch row cotton with 5 plnts/a (136 l/a). Plnt cnopy closed 3
More informationPotentials of Tillage and Mulch Application on Imperata cylindrica Control in Okra (Abelmoschus esculentus (L) Moench in Isohyperthemic Arenic Kandult
Amerin-Eursin J. Agri. & Environ. Si., 9 (2): 176-180, 2010 ISSN 1818-6769 IDOSI Pulitions, 2010 Potentils of Tillge n Mulh Applition on Impert ylinri Control in Okr (Aelmoshus esulentus (L) Moenh in Isohyperthemi
More informationLandscape position and age of reconstructed prairies effect on soil organic carbon sequestration rate and aggregate associated carbon
oi:1.2489/jsw.65.1.9 Lnspe position n ge of reonstrute priries effet on soil orgni ron sequestrtion rte n ggregte ssoite ron Jose G. Guzmn n Mhi Al-Kisi Astrt: Chnges in griulturl ln use suh s the estlishment
More informationJob Description. Senior Lecturer. Electronic & Electrical Engineering. Education and Research. Head of Department/Group. Any research staff/students
Jo Desription Jo title Deprtment/Shool Jo fmily Senior Leturer Eletroni & Eletril Engineering Edution nd Reserh Grde 9 Reporting to Responsile for Lotion Hed of Deprtment/Group Any reserh stff/students
More informationReturn Temperature in DH as Key Parameter for Energy Management
Interntionl OPEN ACCESS Journl Of Modern Engineering Reserch (IJMER) Return Temperture in DH s Key Prmeter for Energy Mngement Normunds Tlcis 1, Egīls Dzelzītis 2, Agnese Līckrstiņ 2 *JSC Rīgs siltums
More informationINFLUENCE OF LONG-TERM CHICKEN MANURE APPLICATION ON THE CONCENTRATION OF SOIL TETRACYCLINE ANTIBIOTICS AND RESISTANT BACTERIA VARIATIONS
- 1143 - INFLUENCE OF LONG-TERM CHICKEN MANURE APPLICATION ON THE CONCENTRATION OF SOIL TETRACYCLINE ANTIBIOTICS AND RESISTANT BACTERIA VARIATIONS WANG, W. Z. CHI, S. L. XU, W. H.* ZHANG, C. L. College
More informationPhysiological effects of mechanized harvesting and ways to minimize its impacts
8/3/218 Physiologil effets of mehnized hrvesting nd wys to minimize its impts S.R.W. Pthirnge 1, M.A. Wijertne 1 nd W.A.J.M. De Cost 2 1 Agronomy Division, Te Reserh Institute of Sri Lnk 2 Fulty of Agriulture,
More informationSilkworm genomics progress and prospects
SPEIAL SETION: REENT AVANES IN SILKWORM IOLOGY Silkworm genomis progress n prospets J. Ngrju, n M. R. Golsmith** Lbortory of Moleulr Genetis, entre for NA Fingerprinting n ignostis, EIL Ro, Nhrm, Hyerb
More informationLife cycle management -Prediction -
JST Oen Seminr Soro, 2 Mrh 2 Life yle mngement -Predition - Professor, Hokkido University, Jn Hiroshi YOKOTA, PhD, PE Life-Cyle Mngement system Servie eriod Usge Design Environment Servie life Future ln
More informationMR405: Response of Young Black Spruce (Picea mariana (Mill.) B.S.P.) to a Mixture of Wood Ash and Secondary Papermill Sludge
The University of Mine DigitlCommons@UMine Misellneous Reports Mine Agriulturl nd Forest Experiment Sttion -997 MR45: Response of Young Blk Sprue (Pie mrin (Mill.) B.S.P.) to Mixture of Wood Ash nd Seondry
More informationAvailable online at ScienceDirect. Energy Procedia 49 (2014 ) SolarPACES 2013
Aville online t www.sieneiret.om SieneDiret Energy Proei 49 (2014 ) 2340 2350 SolrPACES 2013 Comprison of solr power output foresting performne of the Totl Sky Imger n the University of Cliforni, Sn Diego
More informationImplications of Accelerated Agricultural Growth on Household Incomes and Poverty in Ethiopia: A General Equilibrium Analysis
ESSP2 Disussion Pper 002 Implitions of Aelerted Agriulturl Growth on Household Inomes nd Poverty in Ethiopi: A Generl Equilibrium Anlysis Pul Dorosh nd Jmes Thurlow with the support of the EDRI/University
More informationEconomic Profitability and Sustainability of Canola Production Systems in Western Canada
Economic Profitility nd Sustinility of Cnol Production Systems in Western Cnd Elwin Smith, R. Blckshw, Agriculture nd Agri-Food Cnd (AAFC), Lethridge, AB, N. Hrker, J. O'Donovn, AAFC Lcome AB, S. Brndt,
More informationEvaluation of residue management practices effects on corn productivity, soil quality, and greenhouse gas emissions
Grute Theses n Disserttions Iow Stte University Cpstones, Theses n Disserttions 2013 Evlution of resiue mngement prties effets on orn proutivity, soil qulity, n greenhouse gs emissions Jose Germn Guzmn
More informationPROCEEDINGS 2017 Crop Pest Management Short Course & Minnesota Crop Production Retailers Association Trade Show
PROCEEDINGS 2017 Crop Pest Mngement Short Course & Minnesot Crop Prodution Retilers Assoition Trde Show Institute for Ag Professionls http://www.extension.umn.edu/griulture/g-professionls/ Do not reprodue
More informationTTT DIAGRAM OF A NEWLY DEVELOPED NICKEL-BASE SUPERALLOY ALLVAC 718PLUS
Superlloys 718, 625, 706 nd Derivtives 2005 Edited y E.A. Lori TMS (The Minerls, Metls & Mterils Soiety), 2005 TTT DIAGRAM OF A NEWLY DEVELOPED NICKEL-BASE SUPERALLOY ALLVAC 718PLUS Xishn Xie 1, Chunmei
More informationVariation in the natural termite resistance of teak (Tectona grandis Linn. fil.) wood as a function of tree age
Ann. For. Si. 65 (8) 78 INRA, EDP Sienes, 8 DOI: 1.151/forest:847 Aville online t: www.fs-journl.org Originl rtile Vrition in the nturl termite resistne of tek (Teton grnis Linn. fil.) woo s funtion of
More informationInstallation Instructions for Trantorque Keyless Bushings
Instlltion Instrutions for Trntorque Keyless Bushings A Trntorque Keyless Bushing offers flexile n esy instlltion while proviing exeptionl holing power. Referring to the series, plese follow these Instlltion
More informationTHE INFLUENCE OF THERMOMECHANICAL TREATMENT AND CHEMICAL COMPOSITION ON RECRYSTALLIZATION OF Al-Mg ALLOYS
Assoition of Metllurgil Engineers of Seri Sientifi pper AMES UDC:669.715 721.065.53.040.2-174=20 THE INFLUENCE OF THERMOMECHANICAL TREATMENT AND CHEMICAL COMPOSITION ON RECRYSTALLIZATION OF Al-Mg ALLOYS
More informationVertical Distribution of Pratylenchus spp. in Silt Loam Soil and Pacific Northwest Dryland Crops
Vertil Distriution of Prtylenhus spp. in Silt Lom Soil n Pifi Northwest Dryln Crops Rihr W. Smiley, Professor, Json G. Sheey, Fulty Reserh Assistnt, n Snr A. Esley, Fulty Reserh Assistnt, Oregon Stte University,
More informationImpacts of fertilizer application rates on phosphorus dynamics in salt-affected soil
Vol. 63 27 No. : 468 474 Plnt Soil Environ. oi:.722/58/27-pse Impts of fertilizer pplition rtes on phosphorus ynmis in slt-ffete soil Ling-An NIU* Jin-min HAO College of Resoure n Environmentl Sienes Chin
More informationResponse of Sunflower (Helianthus annuus L.) To Inoculation with Mycorrhiza Under Different Phosphorus Levels
Amerin-Eursin J. Agri. & Environ. Si., 2 (3): 337-34, 202 ISSN 88-6769 IDOSI Pulitio, 202 Respoe of Sunflower (Helinthus nnuus L.) To Inoultion with Myorrhiz Uner Different Phosphorus Levels Hossein Soleimnzeh
More informationEVALUATION OF ALTERNATIVE FUNGICIDES FOR CONTROL OF CERCOSPORA SPOT ON FUERTE
Proeedings V World Avodo Congress (Ats V Congreso Mundil del Agute) 23. pp. 579-583. EVALUATION OF ALTERNATIVE FUNGICIDES FOR CONTROL OF CERCOSPORA SPOT ON FUERTE A Willis nd JA Duvenhge Merensky Tehnologil
More informationElectrostatic vs covalent bond in modified Jeffamine: effect on the phase behaviour and on the templating of mesoporous silica
Eletroni upplementry Mteril (EI) for oft Mtter This journl is The Royl oiety of Chemistry 3 upporting Informtion Eletrostti vs ovlent ond in modified Jeffmine: effet on the phse ehviour nd on the templting
More informationRose Midge Research Report 2006
Rose Mige Reserh Report 26 Stuy Title: Evlution of hemil n iologil tretments for ontrol of rose mige (Dsineur rhoophg Coquillet): effiy n rop tolerne. Reserher: Dr. Jnie Elmhirst, Elmhirst Dignostis &
More informationEmployed Worker Training Agreement
Employe Worker Trining Agreement SECTION : GENERAL INFORMATION Orgniztion Nme: Street Aress: Authorize Contt Person: Telephone Numer: Emil Aress: Zip Coe: Fx Numer: Wesite Aress: Dte of Estlishment: Yers
More informationTHE EFFECT OF DROUGHT STRESS AND TIME OF DISTRIBUTION OF NITROGEN FERTILIZER (SPLIT APPLICATION) ON THE YIELD AND YIELD COMPONENTS OF GRAIN SORGHUM
Indin Journl of Fundmentl nd Applied Life Sienes ISSN: 2231 6345 (Online) An Open Aess, Online Interntionl Journl Aville t www.iteh.org/sp.ed/jls/2015/01/jls.htm 2015 Vol.5 (S1), pp. 5463-5468/Ndimpour
More informationDuctile Cast Iron Induction Re-Melting
Dutile Cst Iron Inution Re-Melting Dr. Olexiy A. Thykovsky, Senior Professor, Deprtment of Founry of ferrous n non-ferrous metls, Ntionl Tehnil University of Ukrine KPI Kyiv, Ukrine, Peremohy v., 37 Oksn
More informationGan et al., Supplemental Figure 1
Gn et l., Supplementl Figure IB: DU45 Unp IB: py-68 IB: perk IB: ERK IB: Akt Unp DU45 DU45 ErB2 - EGF - EGF ErB2 75 75 Supplementl Figure. DU45 nd ells predominntly express nd re highly responsive to EGF.
More informationTree Shelters Fail to Enhance Height Growth of Northern Red Oak in the Upper Peninsula of Michigan. 1
Tree Shelters Fil to Enhnce Height Growth of Northern Red Ok in the Upper Peninsul of Michign. 1 Dougls O. Lntgne, Associte Professor, MSU Deprtment of Forestry nd Rymond Miller, Resident Forester, Upper
More informationSoybean Fungicide and Insecticide Seed Treatments (2006 Final Report)
Soyen Fungicide nd Iecticide Seed Tretments (2006 Finl Report) Purpose: The ojective of this study ws to investigte new iecticide seed tretments for soye. Cruiser ws registered recently nd Gucho hs yet
More informationLong term effect of wastewater irrigation of forage crops on soil and plant quality parameters
Deslintion 215 (27) 143 152 Long term effet of wstewter irrigtion of forge rops on soil n plnt qulity prmeters Munir J. Mohmm Rusn *, Smi Hinnwi, Lith Rousn Fulty of Agriulture, Jorn University of Siene
More informationDeveloping Optimal Controlled Atmosphere Conditions for Thompson Seedless Table Grapes
Developing Optiml Controlled Atmosphere Conditions for Thompson Seedless Tle Grpes C.H. Crisosto, D. Grner, nd G. Crisosto Deprtment of Pomology University of Cliforni, Dvis, t Kerney Agriculturl Center
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nture10970 I. GN directly grown on the h-bn relese lyer Figure S1 shows X-ry diffrction with the 2θ/ω configurtion nd n opticl microscopy imge for the GN directly grown on the h-bn relese lyer.
More informationUSE OF CONTROLLED RELEASE PHOSPHATIC FERTILIZER TO IMPROVE GROWTH, YIELD AND PHOSPHORUS USE EFFICIENCY OF WHEAT CROP
Pk. J. Agri. Si., Vol. 54(4), 541-547; 2017 ISSN (Print) 0552-9034, ISSN (Online) 2076-0906 DOI: 10.21162/PAKJAS/18.6533 http://www.pkjs.om.pk USE OF CONTROLLED RELEASE PHOSPHATIC FERTILIZER TO IMPROVE
More informationThe role of plant soil feedbacks and land-use legacies in restoration of a temperate steppe in northern China
Eol Res (21) 25: 111 1111 DOI 1.17/s11284-1-735-x ORIGINAL ARTICLE Lili Jing Xingguo Hn Gungming Zhng Pul Krol The role of plnt soil feeks n ln-use legies in restortion of temperte steppe in northern Chin
More informationInfluence of glyphosate on Rhizoctonia and Fusarium root rot in sugar beet
Pest Mngement Siene Pest Mng Si 62:1182 1192 (26) Influene of glyphoste on Rhizotoni nd Fusrium root rot in sugr eet Ree L Lrson, 1, Amy L Hill, 1 Ann Fenwik, 1 Andrew R Kniss, 2 Lind E Hnson 1 nd Stephen
More informationEvaluation of Corn Varieties for Certified Organic Production Crawfordsville Trial, 1998
Evlution of Corn Vrieties for Certified Orgnic Production Crwfordsville Tril, 1998 Dr. Kthleen Delte, ssistnt professor, Depts. of Horticulture & Agronomy Kevin Vn Dee, frm superintendent, Southest Reserch
More informationComparative Genome Mapping Between Apple and Pear by Apple Mapped SSR Markers
Amerin-Eursin J. Agri. & Environ. Si., 9 (3): 303-309, 2010 ISSN 1818-6769 IDOSI Pulitions, 2010 Comprtive Genome Mpping Between Apple nd Per y Apple Mpped SSR Mrkers 1 1 2 1 1 1 Min Lu, Horu Tng, Xioyng
More informationCadmium Phytoavailability and Enzyme Activity under Humic Acid Treatment in Fluvo-aquic Soil
IOP Conferene Series: Erth n Environmentl Siene PAPER OPEN ACCESS Cmium Phytovilility n Enzyme Ativity uner Humi Ai Tretment in Fluvo-qui Soil To ite this rtile: Borui Liu et l 2018 IOP Conf. Ser.: Erth
More informationFRACTAL CHARACTERIZATION OF WHEAT CROP BASED ON DIGITAL IMAGES CAPTURED IN THE VISIBLE SPECTRUM
FRACTAL CHARACTERIZATION OF WHEAT CROP BASED ON DIGITAL IMAGES CAPTURED IN THE VISIBLE SPECTRUM Florin SALA, Mrius BOLDEA, Iosif GERGEN Bnt University of Agriulturl Sienes nd Veterinry Mediine, Regele
More informationSustainable Crop Rotations for Alberta s Brown Soil Zone
Otober 2003 Agdex 515-1 Sustinble Crop Rottions for Albert s Brown Soil Zone C rop prodution on the Cndin Priries hs historilly foused on spring whet. In reent dedes, rops suh s brley nd nol hve inresed
More informationTotal Rewards: Vacation, Sick and Personal Leave for Full Time Employees
POLICY: 6Hx28:3D-03 Responsible Exeutive: Vie President, Orgniztionl Development & Humn Resoures Poliy Contts: Diretor, HR Poliy nd Compline Progrms Speifi Authority: 1001.61, F.S. Lw Implemented: 1001.64,
More informationCombined Hot Air-Microwave Drying Methods in Banana Chips Production
Amerin-Eursin J. Agri. & Environ. Si., (8): 77-776, ISSN 88-6769 IDOSI Pulitions, DOI:.589/idosi.ejes...8.88 Comined Hot Air-Mirowve Drying Methods in Bnn Chips Prodution Hmid Tvkolipour nd Leil Zirjni
More informationCHAPTER 5 SEISMIC RESERVOIR CHARACTERIZATION.
CHAPTER 5 ISMIC RERVOIR CHARACTERIZATION. ISMIC RERVOIR CHARACTERIZATION Centrl Scotin Slope Study CANADA June 2016 Ojectives: Chrcterize the snd distriution, using the Mrthon nd Verits 3D post-stck seismic
More informationTHE EFFECTS OF WITHDRAWAL AND MELT OVERHEATING HISTORIES ON THE MICROSTRUCTURE OF A NICKED-BASED SINGLE CRYSTAL SUPERALLOY
THE EFFECTS OF WITHDRAWAL AND MELT OVERHEATING HISTORIES ON THE MICROSTRUCTURE OF A NICKED-BASED SINGLE CRYSTAL SUPERALLOY Lin Liu, Tiwen Hng, Minming Zou, Weiguo Zhng, Jun Zhng, Hengzhi Fu Stte Key Lortory
More informationNonlinear Mixed Effects Model for Swine Growth
Nonliner Mixed Effects Model for Swine Growth A. P. Schinckel nd B. A. Crig Deprtment of Animl Sciences nd Deprtment of Sttistics, Purdue University Introduction Severl nonliner growth functions model
More informationSUPPLEMENTARY INFORMATION
S shrna S Viility, % of NT sirna trnsfete ells 1 1 Srmle NT sirna Csp-8 sirna RIP1 Atin L929 shrna sirna: Csp8 Atin L929: shrna Csp8 e Viility, % of NT sirna trnsfete ells NT sirna Csp-8 sirna M45 M45mutRHIM
More informationChanging pattern of plant height in rice cultivars with increased fertilizer
Journl Crop n Wee, 11(Speil Issue):44-50(2015) Chnging pttern of plnt height in rie ultivrs with inrese fertilizer A. L. RANAWAKE Deprtment of Agriulturl Biology, Fulty of Agriulture, University of Ruhun,
More informationEffect of Nitrogen Rate on Yield of Nine Warm-season Introduced Perennial Forage Varieties
Effet of Nitrogen Rte on Yield of Nine Wrm-seson Introdued Perennil Forge Vrieties By Eddie Funderurg, Jon T. Biermher, Corey Moffet, Mohu Hque nd Jgdeesh Mosli When rnhers think out plnting n introdued
More informationPP100 N ABSOLUTE DEPTH FILTER ELEMENTS FEATURES & BENEFITS. Process Filtration
PP100 N ABSOLUTE DEPTH FILTER ELEMENTS Proess Filtrtion Donldson LifeTe PP100 N filters re solute rted depth type filters onstruted of 100% polypropylene. They ontin grded density polypropylene mirofier
More informationCONSERVATION VS CONVENTIONAL TILLAGE,FALL DOUBLE CROPPING
262 Southern Conservtion Systems Conference, Amrillo TX, June 26-28, 26 CONSERVATION VS CONVENTIONAL TILLAGE,FALL DOUBLE CROPPING AND COVER CROP EFFECTS ON CROP WATER USE IN SUBTROPICAL SOUTH TEXAS Bo
More informationChapter 9. Mapping and characterizing whole genomes. Structural Genomics Functional genomics
Chpter 9 Mpping nd chrcterizing whole genomes Structurl Genomics Functionl genomics How mny genes hs humn? 5,500 27,000 Interprettion of genomic informtion: high throughput technologies re used to get
More informationLeaf Rust in Barley 2011 Background, Aims and Method
Lef Rust in Brley 211 Bckground, Aims nd Method Bckground Lef rust in rley (Puccini hordei) occurred t epidemic levels in 21 cross mny res of northern NSW nd southern Qld. This epidemic ws driven y comintion
More informationtheir response to inoculation with the bacterium which causes walnut blight. Tested germplasm was selectedj for its unusual
WALNUT BLIGHT: SUSCEPTIBILITY OF GERMPLASM AND THE RETENTION OF OVERWINTERING PATHOGN POPULATIONS Keith Woeste, Gle McGrnhn, Roy Yri nd M.N. Schroth ABSTRACT Aspects of the susceptibility of English wlnu~
More informationEffect of Dispersed Phase Particle Dispersion on the Thermal Stability of Recycled Poly(ethylene terephthalate)/polypropylene Blend
Effet of Dispersed Phse Prtile Dispersion on the Therml Stility of Reyled Poly(ethylene terephthlte)/polypropylene Blend Yew Wei Leong 1*, Hiroyuki Inoy 2, Supphorn Thumsorn 1 nd Hiroyuki Hmd 1 1 Deprtment
More informationSTOP THE ROT!! Exploring the Relationship Between Nitrogen and Bacterial Diseases of Onions. Introduction. Acknowledgements.
3/16/1 Cornell Coopertive Extension Vegetle Progrm STOP THE ROT!! Exploring the Reltionship etween Nitrogen nd cteril Diseses of Onions Christy Hoepting Cornell Coopertive Extension Vegetle Progrm cteril
More informationPERSISTENCE OF SOME WEED SPECIES FROM WHEAT (TRITICUM AESTIVUM L.) MONOCULTURE VIA SOIL SEED RESERVES
Pk. J. Bot., 44(4): 137-1379, 1. PERSISTENCE OF SOME WEED SPECIES FROM WHEAT (TRITICUM AESTIVUM L.) MONOCULTURE VIA SOIL SEED RESERVES SEEMA MAHMOOD *, ASMA HUSSAIN AND SAEED AHMAD MALIK Institute of Pure
More informationFactors Associated with Populations of Plant-Parasitic Nematodes in Bentgrass Putting Greens in Oklahoma
Ftors Assoited with Popultions of Plnt-Prsiti Nemtodes in Bentgrss Putting Greens in Oklhom N. R. Wlker, Deprtment of Entomology nd Plnt Pthology; C. L. God, Deprtment of Sttistis; H. Zhng, Deprtment of
More informationStudy on Tolerance and Accumulation Potential of Biofuel Crops for Phytoremediation of Heavy Metals
Interntionl Journl of Environmentl Siene nd Development, Vol. 4, No. 2, April 2013 Study on Tolerne nd Aumultion Potentil of Biofuel Crops for Phytoremedition of Hevy Metls Kokyo Oh, To Li, Hongyn Cheng,
More informationReport to the Southwest Florida Water Management District. Effects of Microsprinkler Irrigation Coverage on Citrus Performance
Report to the Southwest Florid Wter Mngement District Effects of Microsprinkler Irrigtion Coverge on Citrus Performnce L. R. Prsons University of Florid Institute of Food nd Agriculturl Sciences Citrus
More information