Received: 9 February 2014 / Accepted: 18 April Wageningen Academic Publishers

Transcription

1 World Myotoxin Journl, 215; 8 (2): SPECIAL ISSUE: Afltoxins in mize nd other rops Wgeningen Ademi P u l i s h e r s Climte hnge ftors nd Aspergillus flvus: effets on gene expression, growth nd fltoxin prodution Á. Medin 1, A. Rodríguez 1, Y. Sultn 2 nd N. Mgn 1* 1 Applied Myology Group, Crnfield Soil nd AgriFood Institute, Shool of Applied Siene, Crnfield University, Crnfield, Bedford MK43 AK, United Kingdom; 2 Deprtment of Food Toxins nd Contminnts, Ntionl Reserh Centre, Dokki, Ciro 12622, Egypt; n.mgn@rnfield..uk Astrt Reeived: 9 Ferury 214 / Aepted: 18 April Wgeningen Ademi Pulishers RESEARCH ARTICLE The ojetives of this study were to otin sientifi dt on the impt tht intertions etween wter stress (wter tivity ( w );.97,.95,.92), temperture (34, 37 C) nd exposure (35, 65, 1 ppm) my hve on the growth, gene expression of iosyntheti genes (fld, flr), nd phenotypi fltoxin B 1 (AFB 1 ) prodution y type strin of Aspergillus flvus on onduive medium. The study showed tht while w ffeted growth there ws no sttistilly signifint effet of temperture or exposure. The effet of these interting ftors on fld nd flr gene expression showed tht t 34 C there ws mximum reltive expression of fld under the ontrol onditions (34 C, 35 ppm) with derese in expression with elevted nd wter stress. For flr expression t 34 C, there ws signifint inrese in expression, ut only t.92 w nd 65 ppm. However, t 37 C, there ws signifint inrese in expression of oth fld nd flr t.95 nd.92 w nd 65 nd 1 ppm. There ws n ssoited inrese in AFB 1 in these tretments. In ontrst, t 34 C there were no signifint differenes for interting tretments. This is the first study to exmine these three-wy interting limti ftors on growth nd myotoxin prodution y strin of A. flvus. This provides dt tht re neessry to help predit the rel impts of limte hnge on myotoxigeni fungi. Keywords: Aspergillus flvus, growth, fltoxin B 1, temperture, wter stress elevted, limte hnge 1. Introdution There hs een lot of interest in the impt tht limte hnge senrios my hve on eonomilly importnt rops, myotoxigeni fungl infetion nd ontmintion with myotoxins (Mgn et l., 211; Pterson nd Lim, 21, 211; Wu et l., 211). Most limte hnge models suggest tht there will e mrked derese in summer preipittion nd inreses in temperture, whih will result in onomitnt drought stress episodes interspersed with periods of unusully high preipittion. The environment in whih rops will e grown in the next 1-2 yers my hnge mrkedly with tmospheri onentrtions expeted to doule or triple (from 35 to 7 or 9-1 ppm). Beuse of this inrese nd tht of other greenhouse gses, the glol temperture is expeted to inrese y etween 2-5 C. The effets hve een predited to e detrimentl or dvntgeous depending on the region. For exmple, in northern Europe men temperture inrese of C, with signifint inrese in preipittion of 3-4% is predited. Southern Europe is expeted to e hot spot for extreme temperture drought stress with onomitnt impts on rop yield nd fungl diseses, nd lso myotoxins. Similr hot spots hve een predited to our in prts of su-shrn Afri, South Ameri nd prts of Asi (IPCC, 27). A reent study hs predited tht, on glol sle, pests nd diseses re moving to the poles t the rte of 3 km/ yer (Beer et l., 213). However, this study did not inlude ny preditions of the spred of myotoxigeni fungi or myotoxins. Exmples of extreme wether regimes impting on myotoxins n e demonstrted y the 23/24 sesons in Northern Itly where drought nd ISSN print, ISSN online, DOI 1.392/WMJ

2 Á. Medin et l. extreme elevted tempertures resulted in swith from Fusrium vertiillioides nd ontmintion with fumonisins to signifint ontmintion of mize grin with fltoxins nd entry of fltoxin M 1 into the diry hin vi niml feed (Giorni et l., 27). However, there re only few onrete exmples of suh inidenes where limte hnge ftors hve een implited. While signifint mount of dt exists on the effet of intertions etween wter vilility nd temperture on the life yle of myotoxigeni fungi nd myotoxin prodution (Mgn nd Aldred, 27; Snhis nd Mgn, 24), there re prtilly no dt on the intertion etween wter vilility, temperture nd slightly elevted. Generlly, the fltoxin iosynthesis genes of A. flvus nd Aspergillus prsitius re highly homologous nd the order of the genes (pprox. 3) within the luster hs een shown to e the sme (Yu et l., 1995, 24). Adel-Hdi et l. (212) showed tht there ws reltionship etween the expression of the struturl gene fld, whih is erly in the iosyntheti pthwy, nd the regultory genes flr nd fls involved in trnsription tivtion in reltion to environmentl ftors. There is good orreltion etween the expression of fld nd fltoxin B 1 (AFB 1 ) (Adel- Hdi et l., 21), nd etween the rtio of flr nd fls under different interting environmentl ftors nd AFB 1 (Shmidt-Heydt et l., 29, 21). Indeed, Adel-Hdi et l. (212) showed tht interting onditions of wter tivity ( w ) temperture ffeted reltive expression of 1 genes in the iosyntheti pthwy of AFB 1 prodution nd ould e relted to oth growth nd toxin prodution. They were le to model nd vlidte this reltionship under elevted temperture nd drought stress onditions, ut elevted ws not inluded in these studies. Shmidt- Heydt et l. (28) lso demonstrted tht there ws stimultion of toxin iosyntheti gene expression in different myotoxigeni fungi when exposed to interting w temperture stresses. They suggested tht there were two peks of expression: one under optimum ioti interting onditions nd one when extreme stress ws pplied. Studies y Yu et l. (211) exmined the effet of elevted temperture on the reltive expression of the whole genome expression of the type strin of A. flvus to identify groups of up nd down regulted genes. Both these studies did not exmine how elevted might impt on these effets. Previous studies of the impt of hve een minly in reltion to the utilistion of modified tmosphere storge of stple food ommodities, where >5% ws neessry to inhiit growth nd AFB 1 nd ohrtoxin A prodution on mize grin nd in dried vine fruits respetively (Giorni et l., 28; Pterki et l., 27). However, there is need to exmine the three wy intertion etween w temperture elevted on oth growth nd the iosynthesis of myotoxins to etter understnd the potentil impt of limte hnge senrios (Mgn et l., 211). The ojetives of this study were to exmine the effet of wter tivity ( w ), temperture nd elevted (35 vs. 65 nd 1 ppm) on () growth, () the reltive expression of two genes involved in fltoxin iosynthesis, fld (struturl gene) nd flr (regultory gene), nd () AFB 1 prodution y type strin of A. flvus on onduive medium for the first time. 2. Mterils nd methods Fungl strin An A. flvus type strin (NRRL3357) provided y Dr. D. Bhtngr (USDA Agriulturl Reserh Servie, New Orlens, LA, USA) ws used in this study. The strin hs een previously used for moleulr eology studies (Adel- Hdi et l., 21, 212) with onsistent results. It ws stored t 4 C or su-ultured on mlt extrt gr (MEA; CM59, Oxoid Ltd., Bsingstoke, UK) when required. Medi preprtion, inoultion nd inution Yest extrt surose gr (YES; 2% yest extrt, 15% surose,.5% MgSO 4 7H 2 ) ws used. The gr medium ws modified with glyerol to djust the wter vilility to.97,.95,.92 w s desried previously (Medin nd Mgn, 211). The ury of the modifitions ws onfirmed using n Aqul 3TE instrument (Degon, Pullmn, WA, USA) nd found to e within ±.5 of the trget w. The gr pltes were overlid with sterile ellophne diss (85 mm dimeter). The replites nd tretments were entrlly inoulted with n gr dis tken from A. flvus ultures previously spred plted nd inuted for 24 h. Thus germlings (germinting onidi) ould e used to initite olony growth. Replites of the sme w tretment were pled in polyethylene plsti hmers (25 litres) whih ontined inlet nd outlet tues with vlve swithes. These were ompnied y 2 5 ml ekers of glyerol/wter solution of the sme w s the tretment ondition to mintin the equilirium reltive humidity during inution. The hmers, fter tretment with tmospheri ir, 65 or 1 ppm were seled nd inuted in temperture-ontrolled rooms t 34 nd 37 C. Modified tmosphere The polyethylene hmers ontining the tretments nd replites were flushed with the required onentrtions of tmospheri ir (35 ppm), syntheti ir with the onentrtion speifition of 65 ppm nd 1 ppm provided y the British Oxygen Compny 172 World Myotoxin Journl 8 (2)

3 Climte hnge nd fltoxins (Guildford, UK). The hmers were flushed every two dys with the required onentrtions t 2 l/min to reple 3 the volume of the inution hmer. This ws done immeditely fter growth mesurements were mde. The syntheti ir moisture ws ontrolled y inserting uling devie, ontining n w ontrolled solution of wter/glyerol, just prior the inlet vlve when flushing eh tretment hmer. The vlves were seled nd the hmers inuted t the trget tretment tempertures. Myelil growth mesurements nd growth rte lultions The dimeter of the olonies ws mesured in two diretions perpendiulr to eh other every two dys for period of 1 dys. The dimetri growth rte (mm/dy) of the A. flvus olonies under the different set of environmentl ftors ws omputed y plotting the dimeter of the olonies ginst time. Regression lines were mde of the time points whih represented the liner phse of the growth urves using Mirosoft Exel. The slope of the liner eqution with n ssoited orreltion oeffiient of not <R 2 =.98 ws onsidered the mximum growth rte. Experiments were rried out with five replites per tretment nd the experiments rried out twie. Gene expression studies For gene expression studies, smpling ws performed fter 1 dys in triplite nd repeted one. This time frme ws hosen euse previous studies with oth A. flvus nd A. prsitius suggested tht gene expression of mny of the iosyntheti genes ws optiml fter 8-1 dys growth, lthough there does pper to e sequentil expression of groups of the fltoxin iosyntheti genes (Shmidt- Heydt et l., 28, 29, 21). We hve ompromised nd used 1 dys in this study so tht we n otin growth dt, moleulr informtion nd toxin dt. The fungl olonies were destrutively smpled. The ellophne disks ontining whole olonies were hrvested under sterile onditions, quikly frozen in liquid nitrogen nd stored t -8 C until RNA extrtion. RNA extrtion Totl RNA ws extrted ording to the method desried y Chomzynski nd Shi (1987) with some modifitions. A smple of 15 mg of frozen iomss ws ground to powder in mortr with pestle in presene of liquid nitrogen nd pled in 2 ml extrtion tue. The resulting powder ws used for isoltion of totl RNA, resuspended in 1 ml of TRI Regent (Life Tehnologies Ltd., Pisley, UK) supplemented with 1 µl of β-merptoethnol. After quik vortex, the tues were inuted t room temperture for 1 min. Next, 2 µl hloroform ws dded nd mixed vigorously y mens of vortex for 15 s. Then, the smple ws entrifuged t 12, rpm for 15 min t 4 C, nd the superntnt ws trnsferred into new 2 ml extrtion tue with 5 μl old isopropnol to preipitte RNA, vortexed, nd inuted t -2 C for 1 h. This ws followed y entrifugtion t 12, rpm for 1 min t 4 C, nd the superntnt ws removed. After dding 1 ml old solute ethnol nd entrifuging t 7,5 rpm for 5 min t 4 C, the superntnt ws disrded nd RNA pellet ws ir-dried for 5-1 min. Finlly, RNA ws eluted in 5 µl RNse-free wter nd kept t -8 C until used s templte. The RNA integrity ws heked on n grose gel (2% w/v) nd the RNA onentrtion nd purity (A26/ A28 rtio) were determined spetrophotometrilly using 2.5 µl liquot on the Piodrop (Spetr Servies, In., Ontrio, NY, USA). Rel-time qpcr ssys nd reltive quntifition Rel-time quntittive PCR (RT-qPCR) ssys were used to mplify the struturl gene nor-1 (fld) nd the regultory gene flr of the fltoxin iosyntheti pthwy s trget genes nd, the β-tuulin gene s ontrol gene. The fld qpcr ws previously optimised y Adel-Hdi et l. (21). The flr ws optimised in house y using the method desried for fld. Primers nd proes Nuleotide sequenes of primers nd proes used in this study re inluded in Tle 1. The primer pirs nortq-1/ nortq2 nd flrtq1/flrtq2, nd the hydrolysis proes norproe nd AflRproe were respetively designed from the fld nd flr genes involved in the fltoxin iosyntheti pthwy. The design of primer pir entq1/entq2 nd the hydrolysis proe enproe were relied on the β-tuulin gene. The norproe nd AflRproe were lelled t the 5 end with the reporter moleule 6-roxyfluoresein (FAM) nd t the 3 end with the quenher Blk Hole Quenher 2 (BHQ2). However, enproe ws lelled t the 5 end with the reporter ynine-5 (CY5) nd t the 3 end with the quenher BHQ2. DNA synthesis DNA ws synthesised using 5 µl totl RNA (5 ng) ording to the Omnisript RT kit protool (Qigen, Hilden, Germny) s desried y the mnufturer nd it ws susequently used for qpcr. Reltive gene expression using qpcr retions The Rotor-Gene Q system (Qigen) ws used to rry out two RT-qPCR ssys, one of them optimised to mplify the trget fld nd the housekeeping β-tuulin genes (Adel- Hdi et l., 21), nd the other one to quntify the flr gene expression using s ontrol the β-tuulin gene. They World Myotoxin Journl 8 (2) 173

4 Á. Medin et l. Tle 1. Nuleotide sequenes of primers for RT-qPCR ssys designed on the sis of the fld, flr nd β-tuulin genes. Primer pirs Gene Nuleotide sequenes (5-3 ) Position nortq1 AlfD GTCCAAGCAACAGGCCAAGT 516 nortq2 TCGTGCATGTTGGTGATGGT 562 norproe [FAM]TGTCTTGATCGCGCCCG[BHQ2] 537 AflRTq1 AflR TCGTCCTTATCGTTCTCAAGG 1,646 AflRTq2 ACTGTTGCTACAGCTGCCACT 1,735 AflRproe [FAM]AGCAGGCACCCAGTGTACCTCAAC[BHQ2] 1,689 Bentq1 β-tuulin CTTGTTGACCAGGTTGTCGAT 65 Bentq2 GTCGCAGCCCTCAGCCT 99 enproe [CY5]CGATGTTGTCCGTCGCGAGGCT[BHQ2] 82 Positions re in ordne with the pulished sequene of the AflD gene of Aspergillus flvus (GeneBnk ession no. XM_ ). Positions re in ordne with the pulished sequenes of AflR gene of Aspergillus flvus (GeneBnk ession no. AF ). Positions re in ordne with the pulished sequenes of β-tuulin (ena56) gene of Aspergillus flvus (GeneBnk ession no. AF3683.1). were prepred in triplites of 12.5 µl retion mixture in strip Sfe-Lok tues (.1 ml) (Qigen). Three replites of RNA ontrol smple together with templte-free negtive ontrol were lso inluded in the runs. The TqMn system with different primers nd proes were used in ll ses. Both retion mixtures onsisted of 6.25 µl Premix Ex TqTM (Tkr Bio, In., Otsu, Jpn), 83 nm of eh primer, 33 nm of eh proe, nd 1.5 µl of DNA templte in finl volume of 12.5 µl. The optiml therml yling onditions inluded n initil step of 1 min t 95 C nd ll 45 yles t 95 C for 15 s, 55 C for 2 s nd 72 C for 3 s. Ct determintions were utomtilly performed y the instrument using defult prmeters. Dt nlysis ws rried out using the softwre Rotor- Gene Q Series Softwre (Qigen). Reltive quntifition of the expression of fld nd flr genes ws performed using the housekeeping gene β-tuulin s n endogenous ontrol to normlise the quntifition of the mrna trget for differenes in the mount of totl DNA dded to eh retion in the reltive quntifition ssys nd used for ll tretments. The expression rtio ws lulted s previously desried y Livk nd Shmittgen (21). Before using the ove method, it ws tested to show tht experimentl tretments did not influene expression of the internl ontrol gene; the mplifition effiienies of the trget nd referene genes were prtilly equl (87.5% for fld nd 92.1% for β-tuulin, nd 93.1% for flr nd 95.2% for β-tuulin genes, respetively). This method llows lultion of the expression rtio of trget gene etween tested smple nd its reltive lirtor ( ontrol smple). In this study, the lirtor orresponded to grown ultures treted with tmospheri ir (35 ppm ) t the different tempertures nd w tested. High performne liquid hromtogrphy Extrtion of fltoxins from ultures Afltoxins were extrted from gr plugs ut out with the help of 3 mm dimeter ork orer ross the dimeter of the olony. The plugs were susequently pled in preweighed 2 ml Eppendorff tues (Sigm-Aldrih Chemie GmH, Steinheim, Germny) nd weighed. Five-hundred µl of high performne liquid hromtogrhphy (HPLC) grde hloroform ws dded to the tues nd the mixture shken in rotry shker for 3 min. The hloroform portion of the mixture ws pipetted into fresh tues nd evported to dryness overnight. Preprtion of stndrds 2 µl fltoxin (R-Biophrm Rhône Ltd., Drmstdt, Germny) stok solution omprising of 2 ng AFB 1 ws prepred. The stok solution ws pipetted into 2 ml Eppendorf tues nd left to evporte to dryness overnight inside fume upord, nd therefter derivtised s desried susequently. Derivtistion, detetion nd quntifition of fltoxins y HPLC Firstly, 2 µl hexne ws dded to the residue followed y the ddition of 5 µl triflouroeti id (TFA). The mixture ws then vortexed for 3 s nd then left for 5 min. Therefter, mixture of wter:etonitrile (9:1, v/v) ws dded nd the entire ontents of the tue were vortexed for 3 s, fter whih the mixture ws left for 1 min to llow for thorough seprtion of lyers. The hexne lyer ws disrded nd the queous lyer filtered through syringe nylon filters (13 mm.22 μm; Jytee Biosienes Ltd., Herne By, UK) diretly into mer slinized 2 ml HPLC 174 World Myotoxin Journl 8 (2)

5 Climte hnge nd fltoxins vils (Agilent Tehnologies, In., Plo Alto, CA, USA) for HPLC nlysis. All nlytil regents used were of HPLC grde. A reversed-phse HPLC with fluoresene detetion ws used to onfirm the identity nd lso quntify AFB 1. An Agilent 12 series HPLC system ws used. It onsisted of n in-line degsser, utosmpler, inry pump nd fluoresene detetor (exittion nd emission wvelength of 36 nd 44 nm, respetively). Seprtion ws hieved through the use of C18 olumn (Phenomenex Gemini; , 3 μm prtile size; Phenomenex, Torrne, CA, USA) preeded y Phenomenex Gemini C18 3 mm, 3 μm gurd rtridge. Isorti elution with methnol:wter:etonitrile (3:6:1, v/v/v) s moile phse ws performed t flow rte of 1. ml/min. The injetion volume ws 2 µl. A set of stndrds ws injeted (1 to 5 ng AFB 1, fltoxin B 2, G 1 nd G 2 per injetion) nd stndrd urves generted y plotting the re underneth the peks ginst the mounts of AFB 1 stndrd injeted. Liner regression ws performed in order to estlish orreltion reltionship (orreltion oeffiient, R 2 =.99). Sttistil nlysis Sttistil nlysis ws performed using the pkge JMP 9 (SAS Institute, In., Cry, NC, USA). Dt sets on mximum growth rte, toxin prodution nd gene expression were tested for normlity using the Shpiro-Wilk test. All sets of dt filed the normlity test nd vrile trnsformtion ws performed to improve normlity or homogenise the vrines with no suess. Therefore, dt nlyses were performed using non-prmetri tests (Wiloxon or Kruskl-Wllis rnk sum test depending on the vrile levels) for testing whether distriutions ross ftor levels were entred t the sme lotion. When sttistil signifint differenes were found, post ho non-prmetri omprisons for eh pir using Wiloxon method were performed to study the reltionships etween the different ftor levels. For the study of the gene expression dtsets, post-ho non-prmetri omprison using the method of Steel with ontrol ws used. With this method ftor level is seleted s ontrol nd the reltionship with other ftors levels ompred. 3. Results Effet of w temperture elevted on growth Figure 1 shows the effet of hnging exposure levels t two tempertures nd three levels of wter stress on growth. The growth of A. flvus is reltively unffeted y the hnges in t w t 34 C. At 37 C, there is slight inrese in growth rte t 65 nd 1 ppm levels t.97 nd.95 w. There is slower growth t.92 w Dimetri growth rte (mm/dy) Dimetri growth rte (mm/dy) C C (3 levels, ppm) t eh wter tivity Figure 1. Effet of wter tivity (.97,.95,.92) elevted levels (35, 65, 1 ppm) on reltive growth rtes of n Aspergillus flvus strin on onduive YES medium t 34 nd 37 C. Brs indite stndrd errors. nd ll tretments t 37 C. Overll, there is reltively only slight hnge in the growth rtes of the strin of A. flvus when exposed to these three-wy intertions of environmentl ftors. Sttistil nlyses showed tht there ws signifint effet of w (P<.1) ut no effet of ny other individul ftors. Effet of w temperture on reltive expression of fld nd flr genes The effet of the three-wy interting tretments on the expression of the fld struturl nd flr regultory genes is shown in Figures 2 nd 3. For fld t 34 C, the reltive expression t 35 ppm is generlly higher thn t elevted levels t ll three wter stress levels (P<.5). However, t 37 C there ws hnge in the reltive expression. At 65 nd 1 ppm t oth.97 nd.95 w, there ws stimultion of fld expression (P<.5). Under the driest ondition tested (.92 w ) there ws signifint stimultion of the fld expression t 1 ppm 37 C (P=.326; Tle 2). For the regultory gene flr expression (Figure 3, Tle 2) t 34 C, there were similr expression levels in ll tretments t.97 w. However, t.92 nd.95 w there ws some sttistilly signifint inrese in expression t either 65 (P=.394) or 1 (P=.394) ppm exposure, respetively. At 37 C, there ws signifint stimultion of World Myotoxin Journl 8 (2) 175

6 Á. Medin et l. Reltive fld gene expression , 34 C Reltive flr gene expression , 34 C, Reltive fld gene expression C Reltive flr gene expression 1,8 1, C (3 levels, ppm) t eh wter tivity (3 levels, ppm) t eh wter tivity Figure 2. Effet of wter tivity (.97,.95,.92) elevted levels (35, 65, 1 ppm) t 34 nd 37 C on the reltive expression of the fld struturl gene on onduive YES medium. Different letters indite signifint differenes from the ontrol. Figure 3. Effet of wter tivity (.97,.95,.92) elevted levels (35, 65, 1 ppm) t 34 nd 37 C on the reltive expression of the flr regultory gene on onduive YES medium. Different letters indite signifint differenes from the ontrol. Tle 2. Reltive fld nd flr gene expression nd fltoxin B 1 t 65 nd 1 ppm with regrd to those otined from ultures treted with tmospheri ir (35 ppm ) t the different tempertures nd w tested. Temperture w (ppm) fld flr AFB 1 34 C = 1 = = 1 = = = = = = 1 = ( 3.6) = = ( 24.4) ( 2.6) 1 = ( 2.) ( 2.) 37 C ( 4.6) = ( 3.7) 1 ( 6.5) = ( 23.8) ( 6.4) ( 14.6) ( 79.2) 1 ( 3.2) ( 43.9) ( 78.5) = ( 4.4) ( 15.1) 1 ( 22.5) ( 168) ( 23.8) 1 = : vrition lower thn 2-fold. : vrition higher thn 2-fold, numers etween rkets refer to the fold-vrition with respet to the ontrol. the expression of the flr gene, espeilly t.95 nd.92 w t oth 65 nd 1 ppm (P<.5). This suggests tht the intertion of these three limte hnge ioti ftors stimultes expression of this regultory gene. Effets of w temperture elevted on fltoxin B 1 prodution Figure 4 shows the impt of hnging temperture, w nd ftors on AFB 1 prodution. At 34 C, there were similr mounts of AFB 1 prodution t.97 w, regrdless 176 World Myotoxin Journl 8 (2)

7 Climte hnge nd fltoxins ng AFB 1 /g of gr ng AFB 1 /g of gr 3, 25, 2, 15, 1, 5, 1,6 1,2 8 4 of level. There ws higher prodution of AFB 1 t.95 w under ll onditions ompred to.97 w when more freely ville wter ws present. Under the driest onditions, AFB 1 prodution ws lowest with slightly higher mounts t 65 nd 1 ppm. Overll, the sttistil nlysis showed tht, t this temperture, w (P<.1) ws the min ftor ounting for the vriility of AFB 1 prodution while no differenes were found with regrd to the levels. At 37 C, generlly muh lower mounts of AFB 1 were produed when ompred to 34 C. However, t oth.97 nd.95 w there ws sttistilly signifint effet of t 65 nd 1 ppm, where the mounts of AFB 1 produed inresed when ompred to the ontrols (P<.5). At.92 w, the driest ondition tested, there ws no signifint differene, lthough the trend suggested n inrese with onentrtion. 4. Disussion 34 C This is the first study ttempting to exmine the effet of interting ftors of wter stress temperture elevted on growth, iosyntheti gene expression nd AFB 1 prodution. This suggests tht, when the three limte hnge ftors re interting, there re responses tht re not otined when exmining w x temperture onditions only. Thus, while growth is reltively unffeted y the 37 C (3 levels, ppm) t eh wter tivity Figure 4. Effet of wter tivity (.97,.95,.92) elevted levels (35, 65, 1 ppm) on fltoxin B 1 (AFB 1 ) prodution y strin of Aspergillus flvus on YES medium t 34 nd 37 C. Different letters indite signifint differenes from the ontrol. ddition of 2 nd 3 existing levels t 37 C under the different wter stress tretments used, this is not the se with myotoxin prodution. The reltive inresed expression of oth the struturl fld nd the regultory flr genes suggest tht there is signifint impt on the iosyntheti pthwys involved in seondry metolite prodution y the strin of A. flvus. This ws espeilly so t 37 o C nd under wter stress (.95,.92 w ; Tle 2) where more hnges were oserved. This ws onfirmed y the nlyses of AFB 1 prodution. While muh less AFB 1 ws produed t 37 thn 34 C, the reltive omprisons shown in Tle 2 indite tht there is indeed strong stimultion of myotoxin prodution (from 15.1 to 79.2 depending on the onditions). Previous studies hve shown tht fld expression is good inditor of A. flvus tivity under different w x temperture nd time onditions for strins isolted from penuts (Adel-Hdi et l., 21). However, with the results otined in this study it n e seen how the reltive expression of the regultory gene flr experienes more drmti hnges when the level inreses 2 nd 3 the urrent tmospheri onentrtion under the higher temperture nd intermedite nd dryer onditions. When the three ftors re interting, inreses in AFB 1 onentrtion nnot e explined y the fld expression lone. Thus, under elevted onditions the flr expression ould e etter inditor under wter stress, nd the fld expression when more freely ville wter (.97 w ) is present. These results show tht the onentrtion n hve signifint effet on the regultion of the AFB 1 prodution pthwy. The question rises s to whether this is generl stress response or whether the presene of elevted results in its inorportion into the iosyntheti pthwys for enzyme prodution nd seondry metolite prodution. Perhps new studies need to e rried out with the ell wll integrity nd high-osmolrity glyerol pthwys to exmine whether these pthwys re lso triggered y stimuli of the three interting ftors of wter stress temperture elevted (Hyes et l., 214). In our study, only the expression of two genes hs een studied ut further reserh is needed to eluidte whether the genes tht re onsidered prmount under urrent environmentl onditions will still eing importnt in the ner future or other genes my eome more importnt nd thus e used s AFB 1 prodution inditors. More reently, Adel-Hdi et l. (212) exmined the integrtion of growth, gene expression of multiple fltoxin genes nd AFB 1 prodution y using mixed seondry metolite model. This model ws vlidted t 37 nd 4 C nd different wter stress levels, nd predited AFB 1 prodution t 37 C under wter stress onditions ut none t 4 C. However, ws not inluded in this model. World Myotoxin Journl 8 (2) 177

8 Á. Medin et l. The results otined suggest tht this model inluding the expression of multiple genes, environmentl ftors nd myotoxin prodution ould e extended to inlude this prmeter nd e very interesting tool to help in prediting the impt of limte hnge senrios with experimentl dt sets s opposed to eing sed on historil dt sets. The present study ws rried out in vitro on onduive medium. Some relevne from the present study n e inferred from the hnges in w of mize kernels during silking. At the erly dough stge, the moisture ontent (m..) is out 4% (=.99 w ) with no wter stress effets; this dereses to 3-35% m.. t the mid-dough stge (=.95 w ) nd to 2-25% ( w ) t full mturity over period of out 4-6 weeks (Brooking, 199). This will influene infetion nd olonistion y A. flvus. Thus the impts of limte hnge now need to e exmined t the interfe etween the ripening mize kernels with infetion y A. flvus to etter understnd the implition of limte hnge senrios on fltoxin ontmintion of this eonomilly importnt stple rop. There re some exmples of previous studies using dt on drought stress x temperture effets on A. flvus to predit impts of interting environmentl ftors. Work y Chuhn et l. (28, 21) demonstrted tht it is possile to utilise n Agriulturl Prodution Systems Simultor to lulte n Afltoxin Risk Index (ARI) in oth mize nd penuts in Austrli. For mize, they relted sesonl temperture nd soil moisture during the ritil silking period to determine the ARI. They showed tht oth dry nd hot limtes mde mize prone to muh higher fltoxin ontmintion risk. For penuts, they used the frtionl mounts of ville soil wter during the ruil pod-filling period to determine the ARI. This showed tht historilly there hs een n inrese in fltoxin ontmintion of penuts in Austrli relted to inreses in mient temperture nd dereses in rinfll. This hs een developed into we-interfe tool for prtilly reltime use of this model. This pproh is very vlule to predit low nd high risk yers in reltion to limti fluxes nd my hve pplition in West Afri where mize is lso n importnt stple rop. However, these models my need modifition to provide urte preditions under limte hnge senrios. Reently, Bttilni et l. (213) developed mehnisti wether-driven model sed on the infetion yle of A. flvus on mize to predit the risk of fltoxin ontmintion in field on dily sis from silk emergene to hrvest. This inluded proility index to exeed the mximum level of 5 µg/kg mize for AFB 1 in the Europen Union. They suggested tht this pproh n e used for predition of A. flvus infetion nd fltoxin ontmintion during the growing seson nd t hrvest. It my e possile to input the type of dt from the present study to mke this pproh more urte nd improve the preditions of reltive risk to tke ount of limte hnges. Mny of the reent reviews tht hve exmined spets of the impt of limte hnge hve foused on plnt reeding, plnt diseses nd myotoxins in Europe, Austrli, Afri nd the USA (Boken et l., 28; Chuhn et l., 28, 21; Wu et l., 211). These hve predominntly exmined the existing or historil informtion nd tools relevnt to the impts on rop yield, the impt of drought episodes nd lk of wter or elevted tempertures. Mgn et l. (211) exmined the impts of w temperture stress on potentil hnges in myotoxin prodution when the temperture ws hnged y +3 nd +5 C nd under different wter stress regimes. Other reviews hve used these dt (Ptterson nd Lim, 21, 211) to mke their predition of potentil impts. However, these previous studies did not inlude the three-wy intertions etween w temperture x elevted. This study hs shown tht for A. flvus, while growth is not signifintly ffeted y the three-wy intertions of limte hnge ftors, the reltive expression of genes in the iosyntheti pthwy of fltoxin prodution re stimulted y these interting ftors resulting in n inrese in phenotypi AFB 1 eing produed. In onlusion, we elieve tht this re of reserh requires more detiled tul dt sets for individul myotoxigeni fungi lone nd on stple food rops. This type of dt n then e inputted into the predition models to provide muh more urte preditions thn those sed on historil dt only. Aknowledgements We re grteful to Dr D. Bhtngr (USDA Agriulturl Reserh Servie, New Orlens, LA, USA) for the supply of the A. flvus strin. Dr Y. Sultn is grteful for postdotorl fellowship from the Egyptin Government. Referenes Adel-Hdi, A., Crter, D. nd Mgn, N., 21. Temporl monitoring of the nor-1 (fld) gene of Aspergillus flvus in reltion to fltoxin B 1 prodution during storge of penuts under different environmentl onditions. Journl of Applied Miroiology 19: Adel-Hdi, A., Shmidt-Heydt, M., Prr, R., Geisen, R. nd Mgn, N., 212. A systems pproh to model the reltionship etween fltoxin gene luster expression, environmentl ftors, growth nd toxin prodution y Aspergillus flvus. Journl of the Royl Soiety Interfe 9: Bttilni, P., Cmrdo Leggieri, M., Rossi, V. nd Giorni, P., 213. AFLA-mize, mehnisti model for Aspergillus flvus infetion nd fltoxin B 1 ontmintion in mize. Journl of Computers nd Eletronis in Agriulture 94: World Myotoxin Journl 8 (2)

9 Climte hnge nd fltoxins Beer, D.P., Rmotowski, M.A.T. nd Gurr, S.J., 213. Crop pests nd pthogens move polewrd in wrming world. Nture Climte Chnge 3: Boken, V.K., Hoogenoom, G., Willims, J.H., Dirr, B., Dione, S. nd Esson, G.L., 28. Monitoring penut ontmintion in Mli (Afri) using the AVHRR stellite dt nd rop simultion model. Interntionl Journl of Remote Sensing 29: Brooking, I.B., 199. Mize er moisture during gin-filling, nd its reltion to physiologil mturity nd grin drying. Field Crops Reserh 23: Chuhn, Y.S., Wright, G.C. nd Rhputi, N.C., 28. Modelling limti risks of fltoxinj ontmintion in mize. Austrlin Journl of Experimentl Agriulture 48: Chuhn, Y.S., Wright, G.C., Rhputi, R.C.N., Holzworth, D., Broome, A., Krosh, S. nd Roertson, M.J., 21. Applition of model to ssess fltoxin risk in penuts. Journl of Agriulturl Siene 148: Chomzynski, P. nd Shi, N., Single-step method of RNA isoltion y id gunidinium thioynte-phenol-hloroform extrtion. Anlytil Biohemistry 162: Giorni, P., Bttilni, P., Pietri, A. nd Mgn, N., 28. Effet of ontrolled tmospheres on growth nd fltoxin prodution in vitro nd in stored mize. Interntionl Journl of Food Miroiology 122: Giorni, P., Mgn, N., Pietri, A., Bertuzzi, T. nd Bttilni, P., 27. Studies on Aspergillus setion Flvi isolted in northern Itly from mize. Interntionl Journl of Food Miroiology 113: Hyes, B.M.E., Anderson, M.A., Trven, A., Vn der Weerden, N.L. nd Blekley, M.R., 214. Ativtion of stress signlling pthwys enhnes tolerne of fungi to hemil fungiides nd ntifungl proteins. Cellulr nd Moleulr Life Sienes 71: Intergovernmentl Pnel on Climte Chnge (IPCC), 27. Climte hnge 27: synthesis report. IPCC, Genev, Switzerlnd. Livk, K.J. nd Shmittgen, T.D., 21. Anlysis of reltive gene expression dt using reltime quntittive PCR nd the 2 ( ΔΔCT) method. Methods 25: Mgn, N. nd Aldred, D., 27. Environmentl fluxes nd fungl intertions: mintining ompetitive edge. In: Vn West, P., Avery, S. nd Strtford, M. (eds.) Stress in yests nd filmentous fungi. Elsevier Ltd., Amsterdm, the Netherlnds, pp Mgn, N., Medin, A. nd Aldred, D., 211. Possile limte hnge effets on myotoxin ontmintion of food rops pre- nd posthrvest. Plnt Pthology 6: Medin, A. nd Mgn, N., 211. Temperture nd wter tivity effets on prodution of T-2 nd HT-2 y Fusrium lngsethie strins from north Europen ountries. Food Miroiology 28: Pterki, M., Dekne, A., Mithell, D., Lydkis, D. nd Mgn, N., 27. Effiy of sulphur dioxide, ontrolled tmospheres nd wter vilility on in vitro germintion, growth nd ohrtoxin A prodution y strins of Aspergillus ronrius from grpes nd vine fruits. Posthrvest Biology nd Tehnology 44: Pterson, R. nd Lim, N., 21. How will limte hnge ffet myotoxins in food? Food Reserh Interntionl 43: Ptterson, R. nd Lim, N., 211. Further myotoxin effets from limte hnge. Food Reserh Interntionl 44: Snhís, V. nd Mgn, N., 24. Environmentl profiles for growth nd myotoxin prodution. In: Mgn, N. nd Olsen, M. (eds.) Myotoxins in food: detetion nd ontrol. Woodhed Pulishing Ltd., Cmridge, UK, pp Shmidt-Heydt, M., Adel-Hdi, A., Mgn, N. nd Geisen, R., 29. Complex regultion of the fltoxin iosynthesis gene luster of A. flvus in reltion to vrious omintions of wter tivity nd temperture. Interntionl Journl of Food Miroiology 135: Shmidt-Heydt, M., Mgn, N. nd Geisen, R., 28. Stress indution of myotoxin iosynthesis genes in reltion to ioti ftors. FEMS Miroiology Letters 284: Shmidt-Heydt, M., Rüfer, C.E., Adel-Hdi, A., Mgn, N. nd Geisen, R., 21. The prodution of fltoxin B 1 or G 1 y Aspergillus prsitius t vrious omintions of temperture nd wter tivity is relted to the rtio of fls to flr expression. Myotoxin Reserh 26: Wu, F., Bhtngr, D., Bui-Klimke, T., Crone, I., Hellmih, R., Munkvold, G., Pyne, G. nd Tkle, E., 211. Climte hnge impts on myotoxin risks in US mize. World Myotoxin Journl 4: Yu, J., Chng, J.W., Wright, M., Bhtngr, D., Clevelnd, T.E., Pyne, G.A. nd Linz, J.E., 1995 Comprtive mpping of fltoxin pthwy gene lusters in Aspergillus prsitius nd Aspergillus flvus. Applied nd Environmentl Miroiology 61: Yu, J., Chng, P.K., Ehrlih, K.C., Cry, J.W., Bhtngr, D., Clevelnd, T.E., Pyne, G.A., Linz, J.E., Woloshuk, C.P. nd Bennett, J.W., 24. Clustered pthwy genes in fltoxin iosynthesis. Applied nd Environmentl Miroiology 7: Yu, J., Fedorov, N.D., Montlno, B.G. nd Bhtngr, D., 211. Tight ontrol of myotoxin iosynthesis gene expression in Aspergillus flvus y temperture s reveled y RNA-Seq. FEMS Miroiology Letters 322: World Myotoxin Journl 8 (2) 179

10