Traceability of Animals and Products of Animals from stable to table and back

Transcription

1 Overview on food-chain surveillance of Carpathian Euro-region Establishment and introduction of European Food-chain Parliament Hungary, Visegrád, of November 2008 Traceability of Animals and Products of Animals from stable to table and back Prof. Dr.Gottfried Brem Veterinary University Vienna

2 A pressing question: where did my dinner meat come from? =??? The solution: 100% traceable food origins by applying DNA Genotyping Resulting in - substantially reduced health concerns - significantly more reliable product quality 2

3 Applications of DNA Genotyping and analyses Important for Food Security DNA-based identification / traceability (of animals and meat products) DNA analyses of disease resistance / susceptibility genes (Scrapie, BSE) Important for Animal Breeding and Production DNA/RNA/antigene analyses for epidemic eradication (BVDV) DNA analyses of hereditary defects and breeding traits DNA analyses for future phamacogenetic applications 3

4 The first and most important step: Collection of samples for DNA Genotyping Essential Questions: Storage? Can you store your samples at room temperature for years without deterioration? Handling? Is there still the need of a veterinarian? Do you still collect blood samples? Identification of the sample? Is there a manual step necessary? Hand writing always readable? How many mistakes can you accept? Transport and refrigeration? Can you mail your samples without refrigeration? Data transfer? Have you ever had problems or errors (wrong transfer of hand writing)? Cost? Is your sample collection method economical 4 even for large sample volumes?

5 Blood Samples Hair Root Samples Milk Samples Disadvantages of conventional collected samples: - Collection of blood requires a veterinarian - Cooling of samples required (even during transportation) - Additional sticker with number and barcode has to be fixed on the container and the data transferred manually (high risk of sample confusion and errors) - Collection takes some minutes. - Collection is expensive - Conventional sampling results in many mistakes 5

6 Our Vision und Mission: Genotyping of all cattle within the European Community The situation: > 100 million cattle in the EU > 27 countries > 300,000 farms Separate sampling is: - too complicated - too error prone - too time-consuming and inefficient - too expensive The solution: An Innovative Genetic Sample Collection and Conservation System 6

7 Today: Conventional Ear-tagging : visual (and electronic) identification No Sampling Standard ear tag Future: TypiFix -System (TFS ) TFS Ear-tagging: visual (and electronic) identification + Sampling Punchpoint Tissue sample Drying materials 7

8 A modified ear tag - an additional sample container makes the difference Common ear tag New! contains a granulate for preservation Male tag part Female tag part Sample container All parts are laser engraved with identical numbers and barcodes 8

9 TypiFix TM -System sample collection ear tags Standard ear tag -without sampling of tissue TypiFix -System with sampling of tissue conical metal punch cuts ear tissue conical plug predefined breaking point After the sampling process, the plug resides in the sample container and seals it hermetically. 9

10 Perforation process Standard ear tag TypiFix ear tag Spike perforation - torn, inflamed edges with splits TFS clean-cut incision smooth, healed edges 10

11 Typical failure rates (No-tissue sample inside the sample container; untrained operator): < 0.5 % [sheep] < 0.1 % [pigs] < 0.1 % [bovine] 11

12 Secure and efficient storage system Arrival Placing TFS containers in the storage strips Simple archiving - Placement on storage strips without special order - Long-term storage at room temperature Secure sample scanning - Fast - Error-free Fast sample retrieval AGROBIOGEN Sample Administration Scanning the ID-numbers Sample number: TGD Thüringen 182 The selected sample can be identified as follows: Entry of the selected sample Shelf storage at room temperature Rack number of the selected sample Rack Tray Strip Position Tray number of the selected sample Strip number of the selected sample Position of the selected sample on the storage strip 12

13 High Through Put- Extraction of Ear Tissue Samples out of the Sample Containers Capacity: 1 million/year 13

14 Changing meat production and revolutionizing animal IDs: the TypiFix -System Tissue sampling and conservation: - Quick and secure sampling Animal producers can sample without veterinarians (no blood) - Pre-identified sample No confusion possible All parts are pre labeled with the same number and barcode No errors or test failures during the analysis or genotyping process Data Transfer by scanners - Sealed and preserved sample No deterioration of or loss of samples during transportation Storage at room temperature for years Easy to transport (no cooling necessary) - Very economical (no additional work) 14

15 TypiFix - the link between animal and lab Typifix TM -System Cattle Global meat supply chain 15

16 Absolute confidence Consumer protection and information throughout the food chain: Complete traceability of meat products. The System enables 100% verifiable control of animal and meat origin during every stage or process in the production or consumption (e.g. farms, breeding centers, stockyards, feedlots, processing plants, butcher shops, restaurants, dinner tables). Advantages for Breeding Societies: optimization of breeding programs, screening for hereditary defects, genetic merit evaluation, parentage and/or lineage control. Advantages for public authorities: traceability of livestock and meat products (including 100% verifiable border control) - a powerful instrument for prevention of and detection of subsidy fraud. 16

17 DNA Isolation Nexttec Advantages Conventional Preparation steps technology Nexttec 1 Prepare samples 5 min. 5 min. 2 Add lysis buffers 1 min. 1 min. 3 Incubate to lyse several hours till overnight Add binding buffer 11 min. 4 min. 5 Add ethanol, mix 1 min. 6 Apply sample to column, discard flow-through 2 min. 7 Add wash buffer 1 2 min. 8 Add wash buffer 2 2 min. 9 Centrifuge column 4 min. 10 Add elution buffer, incubate, 3 min. 1 min. centrifuge min. 5 min. (only 20%) Steps not necessary using Nexttec Technology! Using nexttec Technology 96 Well Technology, 1 Technician can Isolate more than 1 Million DNA Samples Without Robotics or Automation! 17

18 Preservation of the DNA with the TypiFix system TypiFix samples from pigs: sampling in March 2003 Storage 18 months at RT Sample processing (DNA isolation) October 2004 Electrophoretic separation of DNA in 1% agarose gel high molecular DNA (approx. 20 kb) 1-40 = 5 µl DNA from TypiFix samples (storage 18 months) DNA isolation with nexttec clean columns (total volume of DNA = 120 µl) M = DNA Marker ( kb)

19 Proof of DNA-Microsatellites in cooked meat Vienese escalope Wiener Schnitzel (veal) DNA-Microsatellites-proof (5 Marker in 5plex-PCR) Extraktion of DNA Fried beef and onions Zwiebelrostbraten Sausage Frankfurter

20 Minced Meat (>50 Animals/Batch) Qualified Sampling method Traceability possible

21 Comparison of DNA Profiles (Microsatellite Analyses ETH03 ETH225 BM1824 Minced meat Carcass Cattle Comparison Meat = Animal = Minced meat Comparison

22 Probe Comparison of DNA-Profiles Minced meat - Animal - Meatsample TGLA227 1 TGLA227 2 BM BM TGLA53 1 TGLA53 2 ETH10 1 ETH10 2 SPS115 1 SPS115 2 TGLA122 1 TGLA122 2 Hackfleischprobe Tier 01/03/16-L-R-Hip-70.04A Fleisch 01/03/15-L-R-HIP-37.35B Hackfleischprobe Tier 01/03/16-L-R-Hip-70.27A Fleisch 01/03/15-L-R-HIP-37.09B Hackfleischprobe Tier 01/03/16-L-R-Hip-70.29A Fleisch 01/03/15-L-R-HIP-37.07B Hackfleischprobe Tier 01/03/16-L-R-Hip-70.33A Fleisch 01/03/15-L-R-HIP-37.15B Hackfleischprobe Tier 01/03/16-L-R-Hip-70.25A Fleisch 01/03/15-L-R-HIP-37.23B Hackfleischprobe Tier 01/03/16-L-R-Hip-70.30A Fleisch 01/03/15-L-R-HIP-37.33B Hackfleischprobe Tier 01/03/16-L-R-Hip-70.25A Fleisch 01/03/15-L-R-HIP-37.23B Hackfleischprobe Tier 01/03/16-L-R-Hip-70.06A Fleisch 01/03/15-L-R-HIP-37.16B Hackfleischprobe Tier 01/03/16-L-R-Hip-70.27A Fleisch 01/03/15-L-R-HIP-37.09B Kontrolltier ETH03 1 ETH03 2 ETH225 1 ETH225 2 BM BM Batches of minced meat, 40 animals each 80 samples of minced meat could be allocated specifically to animals

23 Digitale DNA-Signature C -> T CC 10 TT 01 CT 11 GTCAGTGGGGTGGCTGAGCTGACAGAGGGGAGGGAGCCCATCTAAGGAAAGATACCAGAA GACTCAAGAAGAGTGTGAGGTGAAGAGGTGGACCAGAGCCCTGGAGCTGCTCAGTCTCTG CATCAAGCCAGGTCTCAAGCCAGAGACAGTGTCAGATTTCCCAATTGGGAGATCCCATAA ATTCTTCCTCTTTTGCTTAAGTTACATCGAGTTAGTTTTCTGTCACTTACAATCTAATGG A -> G AA 10 GG 01 AG 11 C/T ACTGGTTTGTTTGCCCAAACCCAGACCCCAGGCTCTGAGGATCTTCACGGGCCCTATTTA ATCATTTCATTAATAGTTGTTTATTTTATCTGTAAAGATCTTCAAAGAAGAGCATCTAAC TCACCAGCCACAGAGCCCCAGAAGGTCACCCTTCATCACCCTTCAAAGTAGCCGCACATC TGGCGCTGGGATTAGTGACATTTGGTGCAGCATCATGAATGAATTCACAGGTTTAGTGAT GCTGTCTTGCTGTCTGTTTTCTCTTAAGTGAATCATTTAGGGCCAAGATCATGAAATAAT CTTTAGAAAGGCAATTGCCTAGCTTGAGGGGAAAGCCCACTAAACTTCTTTCACTCTTTT A -> T AA 10 TT 01 AT 11 C -> A CC 10 AA 01 CA 11 Individual 1 : CT AA TT CA : Individual 2 : TT AA AT CA : Individual 3 : CT GG AT CA :

24 Detection of fragment length of DNA-Microsatellites or single point mutations (SNPs) DNA PCR analyses Evaluation Multiplex-PCR Simultaneous amplification of several markers in one reaction -saves time -saves costs -reduces mistakes TFS samples Fluorescence detection in automated sequence analyses Using sophisticated technology 1 SNP can be analysed for less than 5 cent 24

25 25

26 Traceability of meat by genetic fingerprints/dna Signatures Meat production and Quality Control (Slaughter-house) Sample identification for traceability Genetic Fingerprints Animal identification and sample collection With ear tag Farm Without ear tag 26

27 brand name breeding meat organizations first sample (Typi-Fix ) second sample preparation of DNA DNA-based individual typing genotyping and elektrophoresis individual-specific pattern coverage comparison in meat production for traceability information Identity Control Sample-number Test-number Results results 27

28 Benefits Farm to Fork Safety all the Way Conventional Ear Tags 1.Consumer protection Animal Identification Collection of samples Preservation of samples Archiving of samples Extraction of samples DNA isolation Analyses of samples 2. Animal care TypiFix 3. Animal breeding TypiFix -System Traceability and Verification BVDV, Scrapie, BSE, Pharmacogenetics Analyses for genetic and breeding purposes 28

29 Cost of establishing a traceability system in cattle based on DNA sampling using ear tags and DNA analytic in the whole Carpathian Euro-region 1O EURO per animal to start a pilot project, 2 years Per Kilogramm sold meat Incl. Ear tags for tissue sampling + DNA-Isolation + DNA-Analytic + DNA-Data base of all cattle Running Cost: 0,03 /kg meat sold (cattle)