Molecular Modeling and Simulation

Size: px
Start display at page:

Download "Molecular Modeling and Simulation"

Transcription

1 Tamar Schlick Molecular Modeling and Simulation An Interdisciplinary Guide With 147 Full-Color Illustrations Springer

2 Contents About the Cover Book URLs Preface Prelude List of Figures List of Tables Acronyms, Abbreviations, and Units v ix xi xix xxxi xxxviii xli 1 Biomolecular Structure and Modeling: Historical Perspective A Multidisciplinary Enterprise Consilience What is Molecular Modeling? Need For Critical Assessment Text Overview Molecular Mechanics Pioneers Simulation Perspective Experimental Progress Protein Crystallography 12

3 xxii Contents DNA Structure Crystallography NMR Spectroscopy Modern Era Biotechnology PCR and Beyond Genome Sequencing Sequencing Overview Human Genome 27 2 Biomolecular Structure and Modeling: Problem and Application Perspective Computational Challenges Bioinformatics Structure From Sequence Protein Folding Folding Views Folding Challenges Folding Simulations Chaperones Unstructured Proteins Protein Misfolding Prions Infectious Proteins? Hypotheses Other Misfolding Processes Function From Structure Practical Applications Drug Design AIDS Drugs Other Drugs A Long Way To Go Better Genes Designer Foods Designer Materials Cosmeceuticals 59 3 Protein Structure Introduction Machinery of Life From Tissues to Hormones Size and Function Variability Chapter Overview Amino Acid Building Blocks Basic C Q Unit Essential and Nonessential Amino Acids 67

4 Contents xxiii Linking Amino Acids The Amino Acid Repertoire Sequence Variations in Proteins Globular Proteins Membrane and Fibrous Proteins Emerging Patterns from Genome Databases Sequence Similarity Protein Conformation Framework The Flexible 4> and ip and Rigid w Dihedral Angles Rotameric Structures Ramachandran Plots Conformational Hierarchy 86 Protein Structure Hierarchy Structure Hierarchy Helices Classic a-helix io and TT Helices Left-Handed a-helix Collagen Helix /3-Sheets: A Common Secondary Structural Element Turns and Loops Supersecondary and Tertiary Structure Complex 3D Networks Classes in Protein Architecture Classes are Further Divided into Folds a-class Folds Bundles Folded Leafs Hairpin Arrays /3-Class Folds Anti-Parallel (3 Domains Parallel and Antiparallel Combinations a//3 and a+/3-class Folds a//3 Barrels Open Twisted a//3 Folds Leucine-Rich a/(3 Folds a+(3 Folds Number of Folds Finite Number? Concerted Target Selection: Structural Genomics Quaternary Structure Viruses From Ribosomes to Dynamic Networks Structure Classification Ill

5 xxiv Contents 5 Nucleic Acids Structure Minitutorial DNA, Life's Blueprint The Kindled Field of Molecular Biology DNA Processes Challenges in Nucleic Acid Structure Chapter Overview Basic Building Blocks Nitrogenous Bases Hydrogen Bonds Nucleotides Polynucleotides Stabilizing Polynucleotide Interactions Chain Notation Atomic Labeling Torsion Angle Labeling Conformational Flexibility The Furanose Ring Backbone Torsional Flexibility The Glycosyl Rotation Sugar/Glycosyl Combinations Basic Helical Descriptors Base-Pair Parameters Canonical DNA Forms B-DNA A-DNA Z-DNA Comparative Features Topics in Nucleic Acids Structure Introduction DNA Sequence Effects Local Deformations Orientation Preferences in Dinucleotide Steps Intrinsic DNA Bending in A-Tracts Sequence Deformability Analysis Continues DNA Hydration and Ion Interactions Resolution Difficulties Basic Patterns DNA/Protein Interactions Variations on a Theme Hydrogen Bonding Patterns in Polynucleotides Hybrid Helical/Nonhelical Forms Overstretched and Understretched DNA RNA Structure RNA Chains Fold Upon Themselves 175

6 Contents xxv RNA's Diversity RNA at Atomic Resolution Emerging Themes in RNA Structure and Folding Cellular Organization of DNA Compaction of Genomic DNA Coiling of the DNA Helix Itself Chromosomal Packaging of Coiled DNA Mathematical Characterization of DNA Supercoiling DNA Topology and Geometry Computational Treatments of DNA Supercoiling DNA as a Flexible Polymer Elasticity Theory Framework Simulations of DNA Supercoiling Theoretical and Computational Approaches to Biomolecular Structure Merging of Theory and Experiment Exciting Times for Computationalists! The Future of Biocomputations Chapter Overview QM Foundations The Schrodinger Wave Equation The Born-Oppenheimer Approximation Ab Initio Semi-Empirical QM Recent Advances in Quantum Mechanics From Quantum to Molecular Mechanics Molecular Mechanics Principles The Thermodynamic Hypothesis Additivity : Transferability Molecular Mechanics Formulation Configuration Space Functional Form Some Current Limitations Force Fields Formulation of the Model and Energy Normal Modes Characteristic Motions Spectra of Biomolecules Spectra As Force Constant Sources In-Plane and Out-of-Plane Bending Bond Length Potentials Harmonic Term 233

7 xxvi Contents Morse Term Cubic and Quartic Terms Bond Angle Potentials Harmonic and Trigonometric Terms Cross Bond Stretch / Angle Bend Terms Torsional Potentials Origin of Rotational Barriers Fourier Terms Torsional Parameter Assignment Improper Torsion Cross Dihedral/Bond Angle and Improper/Improper Dihedral Terms van der Waals Potential Rapidly Decaying Potential Parameter Fitting From Experiment Two Parameter Calculation Protocols Coulomb Potential Coulomb's Law: Slowly Decaying Potential Dielectric Function Partial Charges Parameterization A Package Deal Force Field Performance Nonbonded Computations Computational Bottleneck Reducing Computational Cost Simple Cutoff Schemes Ewald and Multipole Schemes Spherical Cutoff Techniques Technique Categories Guidelines for Cutoff Functions General Cutoff Formulations Potential Switch Force Switch Shift Functions Ewald Method Periodic Boundary Conditions Ewald Sum and Crystallography Morphing A Conditionally Convergent Sum Finite-Dielectric Correction Ewald Sum Complexity Resulting Ewald Summation Practical Implementation Multipole Method 284

8 Contents xxvii Basic Hierarchical Strategy Historical Perspective Expansion in Spherical Coordinates Biomolecular Implementations Other Variants Continuum Solvation Need for Simplification! Potential of Mean Force Stochastic Dynamics Continuum Electrostatics Multivariate Minimization in Computational Chemistry Optimization Applications Algorithmic Understanding Needed Chapter Overview Fundamentals Problem Formulation Independent Variables Function Characteristics Local and Global Minima Derivatives Hessian Matrix Basic Algorithms Greedy Descent Line Searches Trust Region Methods Convergence Criteria Newton's Method Newton in One Dimension Newton's Method for Minimization Multivariate Newton Large-Scale methods Quasi-Newton (QN) Conjugate Gradient (CG) Truncated-Newton (TN) Simple Example Software Popular Newton and CG CHARMM'sABNR CHARMM'sTN Comparative Performance on Molecular Systems Recommendations Future Outlook 342

9 xxviii Contents 11 Monte Carlo Techniques Monte Carlo Popularity A Winning Combination From Needles to Bombs Chapter Overview Importance of Error Bars Random Number Generators What is Random? Properties of Generators? Linear Congruential Generators Other Generators Artifacts Recommendations Gaussian Random Variates Manipulation of Uniform Random Variables Normal Variates in Molecular Simulations Odeh/Evans Box/Muller/Marsaglia Monte Carlo Means Expected Values ErrorBars Batch Means Monte Carlo Sampling Probability Density Function Equilibria or Dynamics Ensembles Importance Sampling Hybrid MC MCandMD Basic Idea Variants and Other Hybrid Approaches Molecular Dynamics: Basics Introduction Why Molecular Dynamics? Background Outline of MD Chapters Laplace's Vision The Dream Deterministic Mechanics Neglect of Electronic Motion Critical Frequencies Electron/Nuclear Treatment Basics Following Motion 392

10 Contents xxix Trajectory Quality Initial System Settings Trajectory Sensitivity Simulation Protocol High-Speed Implementations Analysis and Visualization Reliable Numerical Integration Computational Complexity Verlet Algorithm Position and Velocity Propagation Leapfrog, Velocity Verlet, and Position Verlet Constrained Dynamics Various MD Ensembles Ensemble Types Simple Algorithms Extended System Methods Molecular Dynamics: Further Topics Introduction Symplectic Integrators Symplectic Transformation Harmonic Oscillator Example Linear Stability Timestep-Dependent Rotation in Phase Space Resonance Condition for Periodic Motion Resonance Artifacts Multiple-Timestep (MTS) Methods Basic Idea Extrapolation Impulses Resonances in Impulse Splitting Resonance Artifacts in MTS Resonance Consequences Langevin Dynamics Uses Heat Bath Effect of Generalized Verlet for Langevin Dynamics LN Method Brownian Dynamics (BD) Brownian Motion Brownian Framework General Propagation Framework Hydrodynamics BD Propagation 450

11 xxx Contents 13.6 Implicit Integration Implicit vs. Explicit Euler Intrinsic Damping Computational Time Resonance Artifacts Future Outlook Integration Ingenuity Current Challenges Similarity and Diversity in Chemical Design Introduction to Drug Design Chemical Libraries Early Days Rational Drug Design Automated Technology Chapter Overview Database Problems Database Analysis Similarity and Diversity Sampling Bioactivity General Problem Definitions TheDataset The Compound Descriptors Biological Activity The Target Function Scaling Descriptors The Similarity and Diversity Problems Data Compression and Cluster Analysis PCA compression SVD compression PCA and SVD Projection Application Example Future Perspectives 492 Epilogue 497 Appendix A. Molecular Modeling Sample Syllabus 499 Appendix B. Article Reading List 501 Appendix C. Supplementary Course Texts 505 Appendix D. Homework Assignments 511 Index 621

Protein Folding Problem I400: Introduction to Bioinformatics

Protein Folding Problem I400: Introduction to Bioinformatics Protein Folding Problem I400: Introduction to Bioinformatics November 29, 2004 Protein biomolecule, macromolecule more than 50% of the dry weight of cells is proteins polymer of amino acids connected into

More information

BIOINFORMATICS Introduction

BIOINFORMATICS Introduction BIOINFORMATICS Introduction Mark Gerstein, Yale University bioinfo.mbb.yale.edu/mbb452a 1 (c) Mark Gerstein, 1999, Yale, bioinfo.mbb.yale.edu What is Bioinformatics? (Molecular) Bio -informatics One idea

More information

Structure formation and association of biomolecules. Prof. Dr. Martin Zacharias Lehrstuhl für Molekulardynamik (T38) Technische Universität München

Structure formation and association of biomolecules. Prof. Dr. Martin Zacharias Lehrstuhl für Molekulardynamik (T38) Technische Universität München Structure formation and association of biomolecules Prof. Dr. Martin Zacharias Lehrstuhl für Molekulardynamik (T38) Technische Universität München Motivation Many biomolecules are chemically synthesized

More information

Structural Bioinformatics (C3210) DNA and RNA Structure

Structural Bioinformatics (C3210) DNA and RNA Structure Structural Bioinformatics (C3210) DNA and RNA Structure Importance of DNA/RNA 3D Structure Nucleic acids are essential materials found in all living organisms. Their main function is to maintain and transmit

More information

Gene Expression - Transcription

Gene Expression - Transcription DNA Gene Expression - Transcription Genes are expressed as encoded proteins in a 2 step process: transcription + translation Central dogma of biology: DNA RNA protein Transcription: copy DNA strand making

More information

BIRKBECK COLLEGE (University of London)

BIRKBECK COLLEGE (University of London) BIRKBECK COLLEGE (University of London) SCHOOL OF BIOLOGICAL SCIENCES M.Sc. EXAMINATION FOR INTERNAL STUDENTS ON: Postgraduate Certificate in Principles of Protein Structure MSc Structural Molecular Biology

More information

RNA does not adopt the classic B-DNA helix conformation when it forms a self-complementary double helix

RNA does not adopt the classic B-DNA helix conformation when it forms a self-complementary double helix Reason: RNA has ribose sugar ring, with a hydroxyl group (OH) If RNA in B-from conformation there would be unfavorable steric contact between the hydroxyl group, base, and phosphate backbone. RNA structure

More information

The Integrated Biomedical Sciences Graduate Program

The Integrated Biomedical Sciences Graduate Program The Integrated Biomedical Sciences Graduate Program at the university of notre dame Cutting-edge biomedical research and training that transcends traditional departmental and disciplinary boundaries to

More information

Chapter 1 Structure of Nucleic Acids DNA The structure of part of a DNA double helix

Chapter 1 Structure of Nucleic Acids DNA The structure of part of a DNA double helix Chapter 1 Structure of Nucleic Acids DNA The structure of part of a DNA double helix Deoxyribonucleic acid ) (DNA) is a nucleic acid that contains the genetic instructions used in the development and functioning

More information

Introduction to Proteins

Introduction to Proteins Introduction to Proteins Lecture 4 Module I: Molecular Structure & Metabolism Molecular Cell Biology Core Course (GSND5200) Matthew Neiditch - Room E450U ICPH matthew.neiditch@umdnj.edu What is a protein?

More information

The Double Helix. DNA and RNA, part 2. Part A. Hint 1. The difference between purines and pyrimidines. Hint 2. Distinguish purines from pyrimidines

The Double Helix. DNA and RNA, part 2. Part A. Hint 1. The difference between purines and pyrimidines. Hint 2. Distinguish purines from pyrimidines DNA and RNA, part 2 Due: 3:00pm on Wednesday, September 24, 2014 You will receive no credit for items you complete after the assignment is due. Grading Policy The Double Helix DNA, or deoxyribonucleic

More information

BIOTECHNOLOGY. Course Syllabus. Section A: Engineering Mathematics. Subject Code: BT. Course Structure. Engineering Mathematics. General Biotechnology

BIOTECHNOLOGY. Course Syllabus. Section A: Engineering Mathematics. Subject Code: BT. Course Structure. Engineering Mathematics. General Biotechnology BIOTECHNOLOGY Subject Code: BT Course Structure Sections/Units Section A Section B Unit 1 Unit 2 Unit 3 Unit 4 Unit 5 Unit 6 Unit 7 Section C Section D Section E Topics Engineering Mathematics General

More information

Nucleic Acids, Proteins, and Enzymes

Nucleic Acids, Proteins, and Enzymes 3 Nucleic Acids, Proteins, and Enzymes Chapter 3 Nucleic Acids, Proteins, and Enzymes Key Concepts 3.1 Nucleic Acids Are Informational Macromolecules 3.2 Proteins Are Polymers with Important Structural

More information

Structural bioinformatics

Structural bioinformatics Structural bioinformatics Why structures? The representation of the molecules in 3D is more informative New properties of the molecules are revealed, which can not be detected by sequences Eran Eyal Plant

More information

CSE : Computational Issues in Molecular Biology. Lecture 19. Spring 2004

CSE : Computational Issues in Molecular Biology. Lecture 19. Spring 2004 CSE 397-497: Computational Issues in Molecular Biology Lecture 19 Spring 2004-1- Protein structure Primary structure of protein is determined by number and order of amino acids within polypeptide chain.

More information

356 Index. NLSGM nanorods, 124

356 Index. NLSGM nanorods, 124 Index A Ab initio pseudopotentials, 35 Acoustic phonon dispersion, 330, 336 Acoustic pressure, 337 Anodic alumina, 206 Armchair CNT chirality, 93 Asymptotic stiffness, 83 B Band gap, 174, 190, 201, 211,

More information

All Rights Reserved. U.S. Patents 6,471,520B1; 5,498,190; 5,916, North Market Street, Suite CC130A, Milwaukee, WI 53202

All Rights Reserved. U.S. Patents 6,471,520B1; 5,498,190; 5,916, North Market Street, Suite CC130A, Milwaukee, WI 53202 Secondary Structure In the previous protein folding activity, you created a hypothetical 15-amino acid protein and learned that basic principles of chemistry determine how each protein spontaneously folds

More information

Protein Structure Databases, cont. 11/09/05

Protein Structure Databases, cont. 11/09/05 11/9/05 Protein Structure Databases (continued) Prediction & Modeling Bioinformatics Seminars Nov 10 Thurs 3:40 Com S Seminar in 223 Atanasoff Computational Epidemiology Armin R. Mikler, Univ. North Texas

More information

Data Mining and Applications in Genomics

Data Mining and Applications in Genomics Data Mining and Applications in Genomics Lecture Notes in Electrical Engineering Volume 25 For other titles published in this series, go to www.springer.com/series/7818 Sio-Iong Ao Data Mining and Applications

More information

Fundamentals of Protein Structure

Fundamentals of Protein Structure Outline Fundamentals of Protein Structure Yu (Julie) Chen and Thomas Funkhouser Princeton University CS597A, Fall 2005 Protein structure Primary Secondary Tertiary Quaternary Forces and factors Levels

More information

MCB 110:Biochemistry of the Central Dogma of MB. MCB 110:Biochemistry of the Central Dogma of MB

MCB 110:Biochemistry of the Central Dogma of MB. MCB 110:Biochemistry of the Central Dogma of MB MCB 110:Biochemistry of the Central Dogma of MB Part 1. DNA replication, repair and genomics (Prof. Alber) Part 2. RNA & protein synthesis. Prof. Zhou Part 3. Membranes, protein secretion, trafficking

More information

What Are the Chemical Structures and Functions of Nucleic Acids?

What Are the Chemical Structures and Functions of Nucleic Acids? THE NUCLEIC ACIDS What Are the Chemical Structures and Functions of Nucleic Acids? Nucleic acids are polymers specialized for the storage, transmission, and use of genetic information. DNA = deoxyribonucleic

More information

DNA Structure & the Genome. Bio160 General Biology

DNA Structure & the Genome. Bio160 General Biology DNA Structure & the Genome Bio160 General Biology Lecture Outline I. DNA A nucleic acid II. Chromosome Structure III. Chromosomes and Genes IV. DNA vs. RNA I. DNA A Nucleic Acid Structure of DNA: Remember:

More information

RNA Structure Prediction and Comparison. RNA Biology Background

RNA Structure Prediction and Comparison. RNA Biology Background RN Structure Prediction and omparison Session 1 RN Biology Background Robert iegerich Faculty of Technology robert@techfak.ni-bielefeld.de October 13, 2013 Robert iegerich Overview of lecture topics The

More information

TERTIARY MOTIF INTERACTIONS ON RNA STRUCTURE

TERTIARY MOTIF INTERACTIONS ON RNA STRUCTURE 1 TERTIARY MOTIF INTERACTIONS ON RNA STRUCTURE Bioinformatics Senior Project Wasay Hussain Spring 2009 Overview of RNA 2 The central Dogma of Molecular biology is DNA RNA Proteins The RNA (Ribonucleic

More information

Sequence Analysis '17 -- lecture Secondary structure 3. Sequence similarity and homology 2. Secondary structure prediction

Sequence Analysis '17 -- lecture Secondary structure 3. Sequence similarity and homology 2. Secondary structure prediction Sequence Analysis '17 -- lecture 16 1. Secondary structure 3. Sequence similarity and homology 2. Secondary structure prediction Alpha helix Right-handed helix. H-bond is from the oxygen at i to the nitrogen

More information

Types of nucleic acid

Types of nucleic acid RNA STRUCTURE 1 Types of nucleic acid DNA Deoxyribonucleic acid RNA ribonucleic acid HOCH 2 O OH HOCH 2 O OH OH OH OH (no O) ribose deoxyribose 2 Nucleic acids consist of repeating nucleotide that have

More information

Introduction to Bioinformatics

Introduction to Bioinformatics Introduction to Bioinformatics Contents Cell biology Organisms and cells Building blocks of cells How genes encode proteins? Bioinformatics What is bioinformatics? Practical applications Tools and databases

More information

Nucleic Acids: Structure and Function

Nucleic Acids: Structure and Function ucleic Acids: Structure and Function Components of ucleotides The building blocks (monomers) of the nucleic acids are called nucleotides. ydrolysis of nucleotides gives phosphoric acid, a pentose sugar,

More information

Lecture 2: Central Dogma of Molecular Biology & Intro to Programming

Lecture 2: Central Dogma of Molecular Biology & Intro to Programming Lecture 2: Central Dogma of Molecular Biology & Intro to Programming Central Dogma of Molecular Biology Proteins: workhorse molecules of biological systems Proteins are synthesized from the genetic blueprints

More information

Understanding DNA Structure

Understanding DNA Structure Understanding DNA Structure I619 Structural Bioinformatics Molecular Biology Basics + Scale total length of DNA in a human cell is about 2m DNA is compacted in length by a factor of 10000 the compaction

More information

Nanobiotechnology. Place: IOP 1 st Meeting Room Time: 9:30-12:00. Reference: Review Papers. Grade: 50% midterm, 50% final.

Nanobiotechnology. Place: IOP 1 st Meeting Room Time: 9:30-12:00. Reference: Review Papers. Grade: 50% midterm, 50% final. Nanobiotechnology Place: IOP 1 st Meeting Room Time: 9:30-12:00 Reference: Review Papers Grade: 50% midterm, 50% final Midterm: 5/15 History Atom Earth, Air, Water Fire SEM: 20-40 nm Silver 66.2% Gold

More information

BETA STRAND Prof. Alejandro Hochkoeppler Department of Pharmaceutical Sciences and Biotechnology University of Bologna

BETA STRAND Prof. Alejandro Hochkoeppler Department of Pharmaceutical Sciences and Biotechnology University of Bologna Prof. Alejandro Hochkoeppler Department of Pharmaceutical Sciences and Biotechnology University of Bologna E-mail: a.hochkoeppler@unibo.it C-ter NH and CO groups: right, left, right (plane of the slide)

More information

How Do You Clone a Gene?

How Do You Clone a Gene? S-20 Edvo-Kit #S-20 How Do You Clone a Gene? Experiment Objective: The objective of this experiment is to gain an understanding of the structure of DNA, a genetically engineered clone, and how genes are

More information

UNIT 24: Nucleic Acids Essential Idea(s): The structure of DNA allows efficient storage of genetic information.

UNIT 24: Nucleic Acids Essential Idea(s): The structure of DNA allows efficient storage of genetic information. UNIT 24: Nucleic Acids Name: Essential Idea(s): The structure of DNA allows efficient storage of genetic information. IB Assessment Statements 2.6.U1 The nucleic acids DNA and RNA are polymers of nucleotides.

More information

2/23/16. Protein-Protein Interactions. Protein Interactions. Protein-Protein Interactions: The Interactome

2/23/16. Protein-Protein Interactions. Protein Interactions. Protein-Protein Interactions: The Interactome Protein-Protein Interactions Protein Interactions A Protein may interact with: Other proteins Nucleic Acids Small molecules Protein-Protein Interactions: The Interactome Experimental methods: Mass Spec,

More information

Examination Assignments

Examination Assignments Bioinformatics Institute of India H-109, Ground Floor, Sector-63, Noida-201307, UP. INDIA Tel.: 0120-4320801 / 02, M. 09818473366, 09810535368 Email: info@bii.in, Website: www.bii.in INDUSTRY PROGRAM IN

More information

Homology Modelling. Thomas Holberg Blicher NNF Center for Protein Research University of Copenhagen

Homology Modelling. Thomas Holberg Blicher NNF Center for Protein Research University of Copenhagen Homology Modelling Thomas Holberg Blicher NNF Center for Protein Research University of Copenhagen Why are Protein Structures so Interesting? They provide a detailed picture of interesting biological features,

More information

Péter Antal Ádám Arany Bence Bolgár András Gézsi Gergely Hajós Gábor Hullám Péter Marx András Millinghoffer László Poppe Péter Sárközy BIOINFORMATICS

Péter Antal Ádám Arany Bence Bolgár András Gézsi Gergely Hajós Gábor Hullám Péter Marx András Millinghoffer László Poppe Péter Sárközy BIOINFORMATICS Péter Antal Ádám Arany Bence Bolgár András Gézsi Gergely Hajós Gábor Hullám Péter Marx András Millinghoffer László Poppe Péter Sárközy BIOINFORMATICS The Bioinformatics book covers new topics in the rapidly

More information

Bi 8 Lecture 7. Ellen Rothenberg 26 January Reading: Ch. 3, pp ; panel 3-1

Bi 8 Lecture 7. Ellen Rothenberg 26 January Reading: Ch. 3, pp ; panel 3-1 Bi 8 Lecture 7 PROTEIN STRUCTURE, Functional analysis, and evolution Ellen Rothenberg 26 January 2016 Reading: Ch. 3, pp. 109-134; panel 3-1 (end with free amine) aromatic, hydrophobic small, hydrophilic

More information

Protein Structure and Function: From Sequence to Consequence 1. From Sequence to Structure

Protein Structure and Function: From Sequence to Consequence 1. From Sequence to Structure Protein Structure and Function: From Sequence to Consequence Gregory A. Petsko and Dagmar Ringe, Brandeis University Published by New Science Press Ltd and distributed in the United States and Canada by

More information

Astronomy picture of the day (4/21/08)

Astronomy picture of the day (4/21/08) Biol 205 Spring 2008 Astronomy picture of the day (4/21/08) http://antwrp.gsfc.nasa.gov/apod/ap080421.html Are viruses alive? http://serc.carleton.edu/microbelife/yellowstone/viruslive.html 1 Week 3 Lecture

More information

Proteins Higher Order Structures

Proteins Higher Order Structures Proteins Higher Order Structures Dr. Mohammad Alsenaidy Department of Pharmaceutics College of Pharmacy King Saud University Office: AA 101 msenaidy@ksu.edu.sa Previously on PHT 426!! Protein Structures

More information

Proteins the primary biological macromolecules of living organisms

Proteins the primary biological macromolecules of living organisms Proteins the primary biological macromolecules of living organisms Protein structure and folding Primary Secondary Tertiary Quaternary structure of proteins Structure of Proteins Protein molecules adopt

More information

Methods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology -

Methods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology - Methods of Biomaterials Testing Lesson 3-5 Biochemical Methods - Molecular Biology - Chromosomes in the Cell Nucleus DNA in the Chromosome Deoxyribonucleic Acid (DNA) DNA has double-helix structure The

More information

NUCLEIC ACIDS: DNA AND RNA. HLeeYu Jsuico Junsay Department of Chemistry School of Science and Engineering Ateneo de Manila University

NUCLEIC ACIDS: DNA AND RNA. HLeeYu Jsuico Junsay Department of Chemistry School of Science and Engineering Ateneo de Manila University NUCLEIC ACIDS: DNA AND RNA HLeeYu Jsuico Junsay Department of Chemistry School of Science and Engineering Ateneo de Manila University 1 BUILDING BLOCKS OF NUCLEIC ACIDS 2 Nucleic Acids are important for

More information

Lecture Four. Molecular Approaches I: Nucleic Acids

Lecture Four. Molecular Approaches I: Nucleic Acids Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single

More information

Review of ORGANIC CHEMISTRY

Review of ORGANIC CHEMISTRY Nucleic Acids: DNA Review of ORGANIC CHEMISTRY Definition: Contains CARBON (C) and Hydrogen (H) Large polymers can be made of smaller individual monomers. Ex: For carbohydrates, polysaccharides are large

More information

DNA vs. RNA B-4.1. Compare DNA and RNA in terms of structure, nucleotides and base pairs.

DNA vs. RNA B-4.1. Compare DNA and RNA in terms of structure, nucleotides and base pairs. DNA vs. RNA B-4.1 Compare DNA and RNA in terms of structure, nucleotides and base pairs. Key Concepts l Nucleic Acids: l deoxyribonucleic acid (DNA) l ribonucleic acid (RNA) l Nucleotides: l nitrogen base,

More information

Genes - DNA - Chromosome. Chutima Talabnin Ph.D. School of Biochemistry,Institute of Science, Suranaree University of Technology

Genes - DNA - Chromosome. Chutima Talabnin Ph.D. School of Biochemistry,Institute of Science, Suranaree University of Technology Genes - DNA - Chromosome Chutima Talabnin Ph.D. School of Biochemistry,Institute of Science, Suranaree University of Technology DNA Cellular DNA contains genes and intragenic regions both of which may

More information

Chapter 9: DNA: The Molecule of Heredity

Chapter 9: DNA: The Molecule of Heredity Chapter 9: DNA: The Molecule of Heredity What is DNA? Answer: Molecule that carries the blueprint of life General Features: DNA is packages in chromosomes (DNA + Proteins) Gene = Functional segment of

More information

Protein Structure Prediction by Constraint Logic Programming

Protein Structure Prediction by Constraint Logic Programming MPRI C2-19 Protein Structure Prediction by Constraint Logic Programming François Fages, Constraint Programming Group, INRIA Rocquencourt mailto:francois.fages@inria.fr http://contraintes.inria.fr/ Molecules

More information

Chapter 5 DNA and Chromosomes

Chapter 5 DNA and Chromosomes Chapter 5 DNA and Chromosomes DNA as the genetic material Heat-killed bacteria can transform living cells S Smooth R Rough Fred Griffith, 1920 DNA is the genetic material Oswald Avery Colin MacLeod Maclyn

More information

BIOCHEMISTRY Nucleic Acids

BIOCHEMISTRY Nucleic Acids BIOCHEMISTRY Nucleic Acids BIOB111 CHEMISTRY & BIOCHEMISTRY Session 17 Session Plan Types of Nucleic Acids Nucleosides Nucleotides Primary Structure of Nucleic Acids DNA Double Helix DNA Replication Types

More information

The structure, type and functions of a cell are all determined by chromosomes:

The structure, type and functions of a cell are all determined by chromosomes: DNA Basics The structure, type and functions of a cell are all determined by chromosomes: They are found in the nucleus of a cell. These chromosomes are composed of DNA, the acronym for deoxyribonucleic

More information

PERFORMANCE MODELING OF AUTOMATED MANUFACTURING SYSTEMS

PERFORMANCE MODELING OF AUTOMATED MANUFACTURING SYSTEMS PERFORMANCE MODELING OF AUTOMATED MANUFACTURING SYSTEMS N. VISWANADHAM Department of Computer Science and Automation Indian Institute of Science Y NARAHARI Department of Computer Science and Automation

More information

AGRO/ANSC/BIO/GENE/HORT 305 Fall, 2016 Overview of Genetics Lecture outline (Chpt 1, Genetics by Brooker) #1

AGRO/ANSC/BIO/GENE/HORT 305 Fall, 2016 Overview of Genetics Lecture outline (Chpt 1, Genetics by Brooker) #1 AGRO/ANSC/BIO/GENE/HORT 305 Fall, 2016 Overview of Genetics Lecture outline (Chpt 1, Genetics by Brooker) #1 - Genetics: Progress from Mendel to DNA: Gregor Mendel, in the mid 19 th century provided the

More information

What is Bioinformatics? Bioinformatics is the application of computational techniques to the discovery of knowledge from biological databases.

What is Bioinformatics? Bioinformatics is the application of computational techniques to the discovery of knowledge from biological databases. What is Bioinformatics? Bioinformatics is the application of computational techniques to the discovery of knowledge from biological databases. Bioinformatics is the marriage of molecular biology with computer

More information

Homology modeling and structural validation of tissue factor pathway inhibitor

Homology modeling and structural validation of tissue factor pathway inhibitor www.bioinformation.net Hypothesis Volume 9(16) Homology modeling and structural validation of tissue factor pathway inhibitor Piyush Agrawal, Zoozeal Thakur & Mahesh Kulharia* Centre for Bioinformatics,

More information

NUCLEIC ACIDS Genetic material of all known organisms DNA: deoxyribonucleic acid RNA: ribonucleic acid (e.g., some viruses)

NUCLEIC ACIDS Genetic material of all known organisms DNA: deoxyribonucleic acid RNA: ribonucleic acid (e.g., some viruses) NUCLEIC ACIDS Genetic material of all known organisms DNA: deoxyribonucleic acid RNA: ribonucleic acid (e.g., some viruses) Consist of chemically linked sequences of nucleotides Nitrogenous base Pentose-

More information

Paper : 03 Structure and Function of Biomolecules II Module: 02 Nucleosides, Nucleotides and type of Nucleic Acids

Paper : 03 Structure and Function of Biomolecules II Module: 02 Nucleosides, Nucleotides and type of Nucleic Acids Paper : 03 Structure and Function of Biomolecules II Module: 02 Nucleosides, Nucleotides and type of Nucleic Acids Principal Investigator Paper Coordinators Prof. Sunil Kumar Khare, Professor, Department

More information

Molecular Biology I. The Chemical Nature of DNA. Dr. Obaidur rahman

Molecular Biology I. The Chemical Nature of DNA. Dr. Obaidur rahman Molecular Biology I The Chemical Nature of DNA Dr. Obaidur rahman Characteristics of Genetic Material The coding instructions of all living organisms are written in the same genetic language that of nucleic

More information

Final exam. Please write your name on the exam and keep an ID card ready.

Final exam. Please write your name on the exam and keep an ID card ready. Biophysics of Macromolecules Prof. R. Jungmann and Prof. J. Lipfert SS 2017 Final exam Final exam First name: Last name: Student number ( Matrikelnummer ): Please write your name on the exam and keep an

More information

Chapter 3 Nucleic Acids, Proteins, and Enzymes

Chapter 3 Nucleic Acids, Proteins, and Enzymes 3 Nucleic Acids, Proteins, and Enzymes Chapter 3 Nucleic Acids, Proteins, and Enzymes Key Concepts 3.1 Nucleic Acids Are Informational Macromolecules 3.2 Proteins Are Polymers with Important Structural

More information

CHAPTER 4, Part 1: LECTURE TOPICS: DNA and RNA - MOLECULES OF HEREDITY

CHAPTER 4, Part 1: LECTURE TOPICS: DNA and RNA - MOLECULES OF HEREDITY Chapter 4 Notes: Part 1 Biochemistry 461 Fall 2010 CHAPTER 4, Part 1: LECTURE TOPICS: DNA and RNA - MOLECULES OF HEREDITY 1) DNA/RNA structures, nomenclature, shorthand conventions 2) DNA and RNA as genetic

More information

RNA Secondary Structure Prediction

RNA Secondary Structure Prediction RNA Secondary Structure Prediction Outline 1) Introduction: RNA structure basics 2) Dynamic programming for RNA secondary structure prediction The Central Dogma of Molecular Biology DNA CCTGAGCCAACTATTGATGAA

More information

Independent Study Guide The Blueprint of Life, from DNA to Protein (Chapter 7)

Independent Study Guide The Blueprint of Life, from DNA to Protein (Chapter 7) Independent Study Guide The Blueprint of Life, from DNA to Protein (Chapter 7) I. General Principles (Chapter 7 introduction) a. Morse code distinct series of dots and dashes encode the 26 letters of the

More information

Solution Structure of the DNA-binding Domain of GAL4 from Saccharomyces cerevisiae

Solution Structure of the DNA-binding Domain of GAL4 from Saccharomyces cerevisiae Vol. 14, No. 1-4 175 Solution Structure of the DNA-binding Domain of GAL4 from Saccharomyces cerevisiae James D. Baleja, V. Thanabal, Ted Mau, and Gerhard Wagner Department of Biological Chemistry and

More information

Analysis of Statically Determinate Structures. W.M.Onsongo. 11~1~~ii~1 ~il~~i~i~',r,~jrll. Nairobi University Press

Analysis of Statically Determinate Structures. W.M.Onsongo. 11~1~~ii~1 ~il~~i~i~',r,~jrll. Nairobi University Press Analysis of Statically Determinate Structures W.M.Onsongo 11~1~~ii~1 ~il~~i~i~',r,~jrll 04965208 Nairobi University Press CONTENTS Preface xiii CHAPTER INTRODUCTION I 1.1 Structures 1.2 Loads 1.3 Analysis

More information

DNA and RNA. Chapter 12

DNA and RNA. Chapter 12 DNA and RNA Chapter 12 History of DNA Late 1800 s scientists discovered that DNA is in the nucleus of the cell 1902 Walter Sutton proposed that hereditary material resided in the chromosomes in the nucleus

More information

translation The building blocks of proteins are? amino acids nitrogen containing bases like A, G, T, C, and U Complementary base pairing links

translation The building blocks of proteins are? amino acids nitrogen containing bases like A, G, T, C, and U Complementary base pairing links The actual process of assembling the proteins on the ribosome is called? translation The building blocks of proteins are? Complementary base pairing links Define and name the Purines amino acids nitrogen

More information

Overview. Secondary Structure. Tertiary Structure

Overview. Secondary Structure. Tertiary Structure Protein Structure Disclaimer: All information and images were taken from outside sources and the author claims no legal ownership of any material. Sources for images are linked on each slide and the information

More information

Nucleic Acids and the RNA World. Pages Chapter 4

Nucleic Acids and the RNA World. Pages Chapter 4 Nucleic Acids and the RNA World Pages 74-89 Chapter 4 RNA vs. Protein Chemical Evolution stated that life evolved from a polymer called a protein. HOWEVER, now many scientists question this. There is currently

More information

Nucleic Acids: DNA and RNA

Nucleic Acids: DNA and RNA Nucleic Acids: DNA and RNA Living organisms are complex systems. Hundreds of thousands of proteins exist inside each one of us to help carry out our daily functions. These proteins are produced locally,

More information

MATH 5610, Computational Biology

MATH 5610, Computational Biology MATH 5610, Computational Biology Lecture 2 Intro to Molecular Biology (cont) Stephen Billups University of Colorado at Denver MATH 5610, Computational Biology p.1/24 Announcements Error on syllabus Class

More information

Nucleic Acid Structure. Nucleic Acid Sequence Abbreviations. Sequence Abbreviations, con t.

Nucleic Acid Structure. Nucleic Acid Sequence Abbreviations. Sequence Abbreviations, con t. BC 4054 Spring 2001 Chapter 11 & 12 Review Lecture otes Slide 1 ucleic Acid Structure Linear polymer of nucleotides Phosphodiester linkage between 3 and 5 positions See Figure 11.17 Slide 2 ucleic Acid

More information

Protein Structure Prediction. christian studer , EPFL

Protein Structure Prediction. christian studer , EPFL Protein Structure Prediction christian studer 17.11.2004, EPFL Content Definition of the problem Possible approaches DSSP / PSI-BLAST Generalization Results Definition of the problem Massive amounts of

More information

GENETICS الفريق الطبي االكاديمي. DNA Genes & Chromosomes. DONE BY : Buthaina Al-masaeed & Yousef Qandeel. Page 0

GENETICS الفريق الطبي االكاديمي. DNA Genes & Chromosomes. DONE BY : Buthaina Al-masaeed & Yousef Qandeel. Page 0 GENETICS ومن أحياها DNA Genes & Chromosomes الفريق الطبي االكاديمي DNA Genes & Chromosomes DONE BY : Buthaina Al-masaeed & Yousef Qandeel Page 0 T(0:44 min) In the pre lecture we take about the back bone

More information

Folding simulation: self-organization of 4-helix bundle protein. yellow = helical turns

Folding simulation: self-organization of 4-helix bundle protein. yellow = helical turns Folding simulation: self-organization of 4-helix bundle protein yellow = helical turns Protein structure Protein: heteropolymer chain made of amino acid residues R + H 3 N - C - COO - H φ ψ Chain of amino

More information

Introduction to Microarray Data Analysis and Gene Networks. Alvis Brazma European Bioinformatics Institute

Introduction to Microarray Data Analysis and Gene Networks. Alvis Brazma European Bioinformatics Institute Introduction to Microarray Data Analysis and Gene Networks Alvis Brazma European Bioinformatics Institute A brief outline of this course What is gene expression, why it s important Microarrays and how

More information

Genome Architecture Structural Subdivisons

Genome Architecture Structural Subdivisons Lecture 4 Hierarchical Organization of the Genome by John R. Finnerty Genome Architecture Structural Subdivisons 1. Nucleotide : monomer building block of DNA 2. DNA : polymer string of nucleotides 3.

More information

The Structure of Materials

The Structure of Materials The Structure of Materials Samuel M. Allen Edwin L. Thomas Massachusetts Institute of Technology Cambridge, Massachusetts / John Wiley & Sons, Inc. New York Chichester Weinheim Brisbane Singapore Toronto

More information

Characterization of Aptamer Binding using SensíQ SPR Platforms

Characterization of Aptamer Binding using SensíQ SPR Platforms Characterization of Aptamer Binding using SensíQ SPR Platforms APPLICATION NOTE INTRODUCTION Aptamers have the potential to provide a better solution in diagnostics and other research areas than traditional

More information

Nucleic acids. What important polymer is located in the nucleus? is the instructions for making a cell's.

Nucleic acids. What important polymer is located in the nucleus? is the instructions for making a cell's. Nucleic acids DNA - The Double Helix Recall that the nucleus is a small spherical, dense body in a cell. It is often called the "control center" because it controls all the activities of the cell including

More information

RNA Secondary Structure Prediction Computational Genomics Seyoung Kim

RNA Secondary Structure Prediction Computational Genomics Seyoung Kim RNA Secondary Structure Prediction 02-710 Computational Genomics Seyoung Kim Outline RNA folding Dynamic programming for RNA secondary structure prediction Covariance model for RNA structure prediction

More information

Canonical B-DNA CGCGTTGACAACTGCAGAATC GC AT CG TA AT GC TA TA CG AT 20 Å. Minor Groove 34 Å. Major Groove 3.4 Å. Strands are antiparallel

Canonical B-DNA CGCGTTGACAACTGCAGAATC GC AT CG TA AT GC TA TA CG AT 20 Å. Minor Groove 34 Å. Major Groove 3.4 Å. Strands are antiparallel DNA Canonical B-DNA 20 Å GC AT CG TA CGCGTTGACAACTGCAGAATC 34 Å AT GC TA Minor Groove 3.4 Å TA CG AT Major Groove Strands are antiparallel CG GC GC Canonical B DNA First determined experimentally by fiber

More information

THE CELLULAR AND MOLECULAR BASIS OF INHERITANCE

THE CELLULAR AND MOLECULAR BASIS OF INHERITANCE Umm AL Qura University THE CELLULAR AND MOLECULAR BASIS OF INHERITANCE Dr. Neda Bogari www.bogari.net EMERY'S ELEMENTS OF MEDICAL GENETICS Peter Turnpenny and Sian Ellard 13 th edition 2008 COURSE SYLLABUS

More information

Bioinformatics (Globex, Summer 2015) Lecture 1

Bioinformatics (Globex, Summer 2015) Lecture 1 Bioinformatics (Globex, Summer 2015) Lecture 1 Course Overview Li Liao Computer and Information Sciences University of Delaware Dela-where? 2 Administrative stuff Syllabus and tentative schedule Workload

More information

Nucleic Acids: Structure and Function

Nucleic Acids: Structure and Function ucleic Acids: Structure and Function Components of ucleotides The building blocks (monomers) of the nucleic acids are called nucleotides. ucleotides are made up of: phosphoric acid, a pentose sugar, and

More information

simplified deployment of structurebased models in GROMACS

simplified deployment of structurebased models in GROMACS Published online 4 June 2010 Nucleic Acids Research, 2010, Vol. 38, Web Server issue W657 W661 doi:10.1093/nar/gkq498 SMOG@ctbp: simplified deployment of structurebased models in GROMACS Jeffrey K. Noel

More information

DNA: The Molecule of Heredity How did scientists discover that genes are made of DNA?

DNA: The Molecule of Heredity How did scientists discover that genes are made of DNA? DNA: The Molecule of Heredity How did scientists discover that genes are made of DNA? By the late 1800s, scientists knew that genetic information existed as distinct units called genes. hapter 11 By the

More information

RNA is a single strand molecule composed of subunits called nucleotides joined by phosphodiester bonds.

RNA is a single strand molecule composed of subunits called nucleotides joined by phosphodiester bonds. The Versatility of RNA Primary structure of RNA RNA is a single strand molecule composed of subunits called nucleotides joined by phosphodiester bonds. Each nucleotide subunit is composed of a ribose sugar,

More information

6- Important Molecules of Living Systems. Proteins Nucleic Acids Taft College Human Physiology

6- Important Molecules of Living Systems. Proteins Nucleic Acids Taft College Human Physiology 6- Important Molecules of Living Systems Proteins Nucleic Acids Taft College Human Physiology Proteins Proteins- made from: C, H, O, N, and S. Proteins are very large molecules composed of long chains

More information

The replication of DNA Kornberg 1957 Meselson and Stahl 1958 Cairns 1963 Okazaki 1968 DNA Replication The driving force for DNA synthesis. The addition of a nucleotide to a growing polynucleotide

More information

CMPS 6630: Introduction to Computational Biology and Bioinformatics. Secondary Structure Prediction

CMPS 6630: Introduction to Computational Biology and Bioinformatics. Secondary Structure Prediction CMPS 6630: Introduction to Computational Biology and Bioinformatics Secondary Structure Prediction Secondary Structure Annotation Given a macromolecular structure Identify the regions of secondary structure

More information

Answers to Module 1. An obligate aerobe is an organism that has an absolute requirement of oxygen for growth.

Answers to Module 1. An obligate aerobe is an organism that has an absolute requirement of oxygen for growth. Answers to Module 1 Short Answers 1) What is an obligate aerobe? An obligate aerobe is an organism that has an absolute requirement of oxygen for growth. What about facultative anaerobe? 2) Distinguish

More information

Investigating Protein Stability with the Optical Tweezer

Investigating Protein Stability with the Optical Tweezer Investigating Protein Stability with the Optical Tweezer I. Introduction. Various experimental and computational techniques have been developed to study the process by which proteins go from a linear sequence

More information

Introduction to Bioinformatics

Introduction to Bioinformatics Introduction to Bioinformatics http://1.51.212.243/bioinfo.html Dr. rer. nat. Jing Gong Cancer Research Center School of Medicine, Shandong University 2011.10.19 1 Chapter 4 Structure 2 Protein Structure

More information

Nucleic acids and protein synthesis

Nucleic acids and protein synthesis THE FUNCTIONS OF DNA Nucleic acids and protein synthesis The full name of DNA is deoxyribonucleic acid. Every nucleotide has the same sugar molecule and phosphate group, but each nucleotide contains one

More information