Advances in the Biology and Treatment of Myeloma Bone Disease. G. David Roodman MD PhD Indiana University Oct. 22, 2015
|
|
- Edmund Thornton
- 6 years ago
- Views:
Transcription
1 Advances in the Biology and Treatment of Myeloma Bone Disease G. David Roodman MD PhD Indiana University Oct. 22, 2015
2 Relationship between primary molecular cytogenetic abnormalities and specific CRAB feature at diagnosis Greenberg AJ et al. Leukemia 28:
3 Possible Myeloma from Nubia, ca. 200 AD American Museum of Natural History Study Collection of African Ethnology,
4 Bone Remodeling is Uncoupled in MM Normal Myeloma Adapted from Hattner R et al. Nature. 1965;206:489.
5 Treatment of MM Bone Disease Bisphosphonates Surgical procedures Vertebroplasty Balloon Kyphoplasty Radiotherapy Treatment of myeloma
6 Bisphosphonate Therapy in Myeloma Bisphosphonates (pamidronate and zoledronic acid) decrease pain and minimize bone-related complications Use in all patients with symptomatic myeloma, regardless of documented bone disease [1] Zoledronic acid has been reported to increase OS in the Myeloma IX trial [2] Monitor for renal dysfunction Monitor for osteonecrosis of the jaw Monitor vitamin D levels; consider vitamin D and calcium supplements 1. NCCN. Clinical practice guidelines in oncology: multiple myeloma. v Morgan G, et al. Lancet Oncol. 2011;12:
7 Fracture Incidence in Myeloma Patients Diagnosis During 1 st Rx 1 st Relapse Osteolytic Disease 284/400 (71%) SREs 167 (26%) 7 (1.8%) Fractures 104 (26%) 3/176 (1.7%) Surgery 21 (5.5%) XRT 21 (5.2%) 35/176 (20%) *Rx: Imid-43%, Bort-20%, VTD/RVD-28%, other-9% 369/400 BP treated. Median F/u 39 m Melton et al. JBMR 20:487, 2005 Terpos E, Blood 122,2013 abstract
8 Myeloma Bone Disease Myeloma cells Tumor-derived osteoclast activating factors Macrophage inflammatory protein 1a Interleukin-3 Stromal cells RANKL (+) (+) ( ) Interleukin-6 Tumor-derived osteoblast inhibitory factors DKK1, IL3, sfrp2, IL-7, TNF Sclerostin Osteoclasts Osteoblasts Bone Activin A Osteocytes Adapted from Roodman GD. N Engl J Med. 2004;350(16):
9 Randomized double-blind study of Denosumab versus Zol in the treatment of bone metastases in patients with advanced cancer (excluding breast and prostate cancer) or multiple myeloma Human monoclonal antibody that binds RANKL Inhibits formation and activation of osteoclasts Denosumab was non-inferior to Zol in delaying time to first SRE on study Overall survival for all patients similar, but inferior for MM subgroup ONJ rates similar Hypocalcemia more frequent with denosumab Henry, DH et al, JCO 29:1125, 2011
10 Issues with BP or Denosumab Osteonecrosis of the jaw Decrease skeletal events but patients still progress at slower rate Do not induce new bone formation or repair lytic lesions.
11 Optimal Therapy for Myeloma Bone Disease Targeting both Myeloma Cells Increased osteoclast activity/formation and osteoblast suppression
12 Osteoblast Inhibitors in Myeloma Soluble factors Dkk-1 Sclerostin sfrp-2 sfrp-3 TNF-α IL-3 IL-7 MIP-1α MIP-1β RANKL TNF-α IL-3 Direct cell-cell contact Notch Integrin Adapted from Roodman. N Engl J Med. 2004;350:1655.
13 DKK1 and sfrp-2 in Myeloma Bone Disease Inhibitors of the WNT signaling pathway WNT signaling is a critical pathway for OBL differentiation Secreted by myeloma cells Marrow plasma from patients with high levels of DKK1 or sfrp-2 inhibit murine OBL differentiation DKK1 gene expression levels correlated with extent of bone disease in MM patients Tian et al NEJM 349:2483,2003, Oshima T. et al.blood.;106:3160, 2005
14 BMD (% change) Anti-DKK1 Increases Bone Formation in the SCID-Rab Multiple Myeloma Model Control Anti-DKK1 Pre-Rx Final P<0.001 Control Bone resorption Anti-DKK1 Bone formation -20 Yaccoby S et al. Blood. 2007;109: BMD, bone mineral density
15 Phase I/II Study of BHQ880, an Anti-DKK1 Human Monoclonal Antibody, in Relapsed/Refractory MM Patients Treated with Zoledronic Acid and Anti- Myeloma Therapy and a Phase II Study in Smoldering Myeloma Have Been Completed.
16 Activin and Bone Growth Osteoclast Osteoblast Activin stimulates osteoclasts Activin inhibits osteoblasts Activin Activin Activin Receptor Type IIA Activin Receptor Type IIA Increased bone resorption Activin decreases bone mineral density and strength Reduced bone formation
17 IL-3 induces Osteoclasts via Activin A Silbermann R, et al: Leukemia, 28(4):951-4,2013 Phase II Study of Sotatercept (Activin A Receptor Antagonist) on bone mass and turnover in patients with multiple myeloma
18 RAP-011 Prevents Development of Myeloma Bone Lesions Normal Mice Mice + tumor Mice + tumor + RAP-011 Croucher et al XIth International Myeloma Workshop
19 Phase IIA Sotatercept Study in Myeloma Abdulkadyrov KM et al. Br J Haematol. 2014,165:814-23
20 OBL Suppression in Myeloma What is the mechanism(s) responsible for long term osteoblast suppression in myeloma?
21 Fold change OBL differentiation by stromal cells from MM-injected mice is suppressed Saline No injection 5TGM1 5.0 Runx2 No injection Saline 2.5 5TGM1 * Reference sample 0.0 * Reg media Differentiating media D Souza S et al. Blood 118:6871,2011
22 Gfi1: growth factor independence 1 SNAG Domain Intermediate Domain Zinc Finger Domains Nuclear localization motif Histone modifying enzymes and corepressors DNA binding site Multiple putative Gfi1 binding sites [AA(T/G)C] are located on this portion of the Runx2 promoter, a master gene for osteoblast differentiation. Gfi1 is a transcriptional repressor that recruits histone modifying enzymes and co-repressors to target genes. Since Gfi1 can modify chromatin structure, Gfi1 is a good candidate to serve as a long-term Runx2 repressor.
23 Fold change Gfi-1 is upregulated in stromal cells from MM patients Normals MM patients * * * * Gfi-1 -actin Normal BMSC MM patients BMSC * * 0.0 C1 C2 C3 M1 M2 M3 M4 M5 M6 M7 D Souza S et al. Blood 118:6871,2011
24 Fold Change Fold Change Fold Change GFI1 knockdown increased Runx2, Ocn, and Bsp mrna in MM patient BMSC 4 Gfi1 Runx Normal MM 0 Normal MM No sirna sicon sigfi1 4 2 Ocn 4 2 Fold Change6 Bsp 0 Normal MM 0 Normal MM D Souza S et al. Blood 118:6871,2011
25 Gfi-1 Repression of the Runx2 Promoter is Independent of the Normal DNA Binding Site and Requires HDAC Activity
26 Adhesive Interactions Increase Myeloma Growth, Chemoresistance and Bone Destruction Myeloma cell Stromal Cell Osteoclast Osteoblasts
27 Multiple Signaling Pathways Are Activated via p62 in the MM Microenvironment p62
28 p62 Acts as a Platform for Formation of Multiple Signaling Complexes TNFa IL-1 NGF RANKL PKCz RIP1 TRAF SH2 PB1 ZZ p38 TBS UBA Erk PKCz p38 NF-kB
29 XRKF2 MW:363.5
30 Summary p62-zz Antagonist MM Viability OCL Formation Hematopoietic Cell Growth Stromal Cell Growth VCAM-1 Expression IL-6 Production No Effect No Effect PKCζ/NF-κB Signaling p38mapk Signaling No Effect Teramachi J et al, Leukemia Aug 19
31 XRKF2 Treatment Protocol XRKF2 Teramachi J et al, Leukemia Aug 19
32 XRK3 Induces Dramatic New Bone Formation in Myeloma Bearing Bones IT tumor +Vehicle Contralateral tibia + XRKF2 IT tumor + XRKF2
33 Histology of Bones from p62-zz Antagonist Treated Mice A B C D E F Teramachi J et al, Leukemia Aug 19
34 Bortezomib / Lenalidomide in MBD Roodman GD JCI :462-4
35 Novel Approaches for MM Bone Disease Target RANKL MIP-1 alpha DKK1/sFRP-2 Activin A Sclerostin GFI-1 Potential Therapy Denosumab CCR1 Receptor antagonist Anti-DKK1, Bortezomib ACE-011 Anti-Sclerostin HDAC1 inhibitors
36 Acknowledgements L Ehrlich R Silbermann A Huston N Giuliani S D Souza D Galson D DelPetre S Choi N Kurihara F Esteve Y Hiruma F Wang J Teramachi J Anderson X Xie J Eiseman J Beumer J Windle Funding: VA Merit Review, MMRF and NIH
Myeloma Bone Disease Current and Future Treatment. A Publication of The Bone and Cancer Foundation
Myeloma Bone Disease Current and Future Treatment A Publication of The Bone and Cancer Foundation What Is Multiple Myeloma? Multiple Myeloma is a cancer that results from a malignant change in a particular
More informationDenosumab for the prevention of skeletal related events in patients with multiple myeloma first line
NIHR Innovation Observatory Evidence Briefing: April 2017 Denosumab for the prevention of skeletal related events in patients with multiple myeloma first line NIHRIO (HSRIC) ID: 6619 NICE ID: 8815 LAY
More informationTreatment options in Myeloma. BritModis myeloma for the elderly care specialist
Treatment options in Myeloma myeloma for the elderly care specialist Dr Richard Soutar, Consultant in Haematology and Transfusion Medicine, Beatson Oncology Centre, Glasgow and The Scottish National Blood
More informationchronic leukemia lymphoma myeloma differentiated 14 September 1999 Transformed Pre- Ig Surface Surface Secreted B- ALL Macroglobulinemia Myeloma
Disease Usual phenotype acute leukemia precursor chronic leukemia lymphoma myeloma differentiated Pre- B-cell B-cell Transformed B-cell Plasma cell Ig Surface Surface Secreted Major malignant counterpart
More informationWhat do you do, with an M protein?
What do you do, with an M protein? Cancer Day for Primary Care Emily Rimmer MD FRCPC January 31, 2014 emily.rimmer@cancercare.mb.ca Disclosure of Potential for Conflict of Interest Name of presenter: Emily
More informationManagement of Multiple Myeloma: The Changing Paradigm
Management of Multiple Myeloma: The Changing Paradigm Relapsed/Refractory Disease Jeffrey A. Zonder, MD Karmanos Cancer Institute Objectives Discuss use of standard myeloma therapies when used as therapy
More informationTreatment of Multiple Myeloma with Stem Cell Transplantation (SCT)
Treatment of Multiple Myeloma with Stem Cell Transplantation (SCT) Görgün Akpek, MD, MHS Director, SCT and Cellular Therapy Program Banner MD Anderson Cancer Center GAkpek@mdanderson.org MULTIPLE MYELOMA
More informationSupplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Mateos M-V, Hernández M-T, Giraldo P, et al. Lenalidomide plus
More informationManagement of Multiple Myeloma: The Changing Paradigm
Management of Multiple Myeloma: The Changing Paradigm Myeloma 101: Disease Overview Hans Lee, MD Assistant Professor Department of Lymphoma/Myeloma University of Texas MD Anderson Cancer Center No Disclosures
More informationNICE guideline Published: 10 February 2016 nice.org.uk/guidance/ng35
Myeloma: diagnosis and management NICE guideline Published: 10 February 2016 nice.org.uk/guidance/ng35 NICE 2017. All rights reserved. Subject to Notice of rights (https://www.nice.org.uk/terms-and-conditions#notice-ofrights).
More informationLeading Voices. Jonathan Montgomery, Chair of the Health Research Authority (HRA) Patient Experience David Corrin My Myeloma Story
Summer 2016 www.myeloma.org.uk Leading Voices Jonathan Montgomery, Chair of the Health Research Authority (HRA) Patient Experience David Corrin My Myeloma Story Medical MattersMyelo Myeloma NICE guidelines
More informationMyeloma Primary Care. Dr R Lovell Feb 2015
Myeloma Primary Care Dr R Lovell Feb 2015 Aims Balance of pathophysiology and cases Explain diagnostic changes (minimal) Staging UK influence Autologous stem cell transplants Primary care myeloma problems
More informationMinimal Residual Disease assessment in Multiple Myeloma by Next-Generation Sequencing
Minimal Residual Disease assessment in Multiple Myeloma by Next-Generation Sequencing Prof Hervé AVET-LOISEAU, : MD, PhD Institut Universitaire du Cancer Toulouse, France MRD Meta-Analysis in Myeloma Nikhil
More informationDiagnosis and Follow-up of Multiple Myeloma and Related Disorders: The role of the laboratory
Diagnosis and Follow-up of Multiple Myeloma and Related Disorders: The role of the laboratory Anne L Sherwood, PhD Director of Scientific Affairs The Binding Site, Inc. Learning Objectives Compare traditional
More informationSureSilencing sirna Array Technology Overview
SureSilencing sirna Array Technology Overview Pathway-Focused sirna-based RNA Interference Topics to be Covered Who is SuperArray? Brief Introduction to RNA Interference Challenges Facing RNA Interference
More informationHot Topic. Disclosures. None
Hot Topic Multiple Myeloma Testing at Mayo Medical Laboratories HOT TOPIC / 2017 MFMER 1 Our speaker for this program is Dragan Jevremovic, MD, PhD Assistant Professor, Division of Hematopathology at Mayo
More informationThe Multiple Myeloma Research Foundation Webinar Series Improving the Overall Understanding of Immunotherapy in Multiple Myeloma
Improving the Overall Understanding of Immunotherapy in Multiple Myeloma Webinar 1, August 13, 2015 Antibodies: The Body s Foot Soldiers in the Battle Against Disease Speakers Moderator: Joseph Mikhael,
More informationMyeloma. Anne Grace, myeloma survivor. Support for this publication provided by
Myeloma Anne Grace, myeloma survivor Support for this publication provided by Revised 2017 Publication Update Myeloma The Leukemia & Lymphoma Society wants you to have the most up-to-date information about
More informationTo learn more about the MMRF, visit or call Accredited by: 2015 Multiple Myeloma Reseach Foundation
ABOUT THE MULTIPLE MYELOMA RESEARCH FOUNDATION Shortly after being diagnosed with multiple myeloma, Kathy Giusti and her sister Karen Andrews, a successful corporate attorney, founded the MMRF in 1998
More informationFour Experts Debate Aggressive Treatment Approaches and the Goal of Complete Response Recorded on April 19, 2014
Patient Power Knowledge. Confidence. Hope. Toward a Cure for Multiple Myeloma: Four Experts Debate Aggressive Treatment Approaches and the Goal of Complete Response Recorded on April 19, 2014 Gareth Morgan,
More informationTumor Growth Suppression Through the Activation of p21, a Cyclin-Dependent Kinase Inhibitor
Tumor Growth Suppression Through the Activation of p21, a Cyclin-Dependent Kinase Inhibitor Nicholas Love 11/28/01 A. What is p21? Introduction - p21 is a gene found on chromosome 6 at 6p21.2 - this gene
More informationPatient Case and Question
Management of Multiple Myeloma: The Changing Paradigm Relapsed/Refractory Disease Kenneth H. Shain, MD, PhD Assistant Member H. Lee Moffitt Cancer Center Assistant Professor University of South Florida
More informationNanotechnology: A Brief History and Its Convergence with Medicine. Weston Daniel, PhD Director of Program Management
Nanotechnology: A Brief History and Its Convergence with Medicine Weston Daniel, PhD Director of Program Management Outline Introduction The Nanoscale Applications Realization of a Vision There s Plenty
More informationMyeloma bone disease and bisphosphonates Myeloma Infoguide Series
Myeloma bone disease and bisphosphonates Myeloma Infoguide Series Symptoms and complications This Infoguide has been made possible thanks to the generosity of Myeloma UK supporters. To find out how you
More informationSupplemental figure 1. Dys-regulated signal pathways in MSCs from TNF-Tg. mice. 965 dys-regulated genes were uploaded to IPA and David bioinformatics
Supplemental figure 1. Dys-regulated signal pathways in MSCs from TN-Tg mice. 965 dys-regulated genes were uploaded to IPA and David bioinformatics esources software. The top 53 and top 11 dys-regulated
More informationUpdates to the NIH Guidelines for Research Involving Recombinant DNA Molecules (NIH Guidelines)
Updates to the NIH Guidelines for Research Involving Recombinant DNA Molecules (NIH Guidelines) Jacqueline Corrigan-Curay, J.D. M.D. Acting Director Office of Biotechnology Activities National Institute
More informationPPAR-γ - Peroxisome proliferator-ac4vated receptor gamma
PPAR-γ - Peroxisome proliferator-ac4vated receptor gamma PPAR-γ - Peroxisome proliferator-ac4vated receptor gamma C/EBPalpha - CCAAT/enhancer-binding protein alpha C/EBPα contains: - a func)onally related
More informationSmouldering myeloma. Myeloma Infosheet Series. Other related conditions. Infoline:
Smouldering myeloma This Infosheet provides information on what smouldering myeloma is, how it is diagnosed, what the treatment is and will explain the link between smouldering myeloma and active myeloma.
More informationExam MOL3007 Functional Genomics
Faculty of Medicine Department of Cancer Research and Molecular Medicine Exam MOL3007 Functional Genomics Tuesday May 29 th 9.00-13.00 ECTS credits: 7.5 Number of pages (included front-page): 5 Supporting
More informationImmunotherapy in myeloma
Immunotherapy in myeloma This Horizons Infosheet contains information on immunotherapy, a type of treatment being investigated in myeloma. The Horizons Infosheet series provides information relating to
More informationRCPA Foundation Postgraduate Research Fellowship Final Report Dr Pasquale Fedele The Walter and Eliza Hall Institute of Medical Research
RCPA Foundation Postgraduate Research Fellowship Final Report 2015 Dr Pasquale Fedele The Walter and Eliza Hall Institute of Medical Research I would like to thank the RCPA Foundation for their generous
More informationGUGAUAAUGGAGCGAGAUUUUCUGUUGUGCUUGAUCUAACCAUGUGCUUGCGAGGUAUGA GAAAAACAUGGUUCCGUCAAGCACCAUGGAACGUCACGCAGCUUUCUACA
Precursor mmu-mir-8- GUGAUAAUGGAGCGAGAUUUUCUGUUGUGCUUGAUCUAACCAUGUGCUUGCGAGGUAUGA GAAAAACAUGGUUCCGUCAAGCACCAUGGAACGUCACGCAGCUUUCUACA Precursor mmu-mir-8- GACCAGUUGCCGCGGGGCUUUCCUUUGUGCUUGAUCUAACCAUGUGGUGGAACGAUGGAA
More informationTreatment strategies for relapsing and refractory myeloma
Treatment strategies for relapsing and refractory myeloma Dr Guy Pratt #MyelomaInfodays This talk will cover What is relapse and refractory myeloma Treatment options for relapse Treatment options for refractory
More informationStrategies for Assessment of Immunotoxicology in Preclinical Drug Development
Strategies for Assessment of Immunotoxicology in Preclinical Drug Development Rebecca Brunette, PhD Scientist, Analytical Biology SNBL USA Preclinical Immunotoxicology The study of evaluating adverse effects
More informationLiving With Myeloma Treatment and Side Effects Management
Slide 1: Welcome & Introductions OPERATOR: Hello, everyone, and welcome to Living With Myeloma Treatment and Side Effects Management, a free telephone/web education program. It is my pleasure to introduce
More informationGoldman Sachs Health Care Conference
Goldman Sachs Health Care Conference Laguna Niguel, California June 14, 2006 George Morrow Executive Vice President Global Commercial Operations Safe Harbor Statement This presentation contains forward-looking
More informationChromatin and Transcription
Chromatin and Transcription Chromatin Structure Chromatin Represses Transcription Nucleosome Positioning Histone Acetylation Chromatin Remodeling Histone Methylation CHIP Analysis Chromatin and Elongation
More informationImmuno-Oncology Opportunities and Challenges In Moving Toward a Cure for Multiple Myeloma
Immuno-Oncology Opportunities and Challenges In Moving Toward a Cure for Multiple Myeloma Stanley R. Frankel, MD, FACP Corporate Vice President, Clinical R & D Head, Immuno-Oncology Celgene Cancer Progress
More informationStructure/function relationship in DNA-binding proteins
PHRM 836 September 22, 2015 Structure/function relationship in DNA-binding proteins Devlin Chapter 8.8-9 u General description of transcription factors (TFs) u Sequence-specific interactions between DNA
More informationGSK 916: anti-bcma ADC An exciting potential advance in the treatment of Multiple Myeloma
GSK 916: anti-bcma ADC An exciting potential advance in the treatment of Multiple Myeloma 12 December 2017 Cautionary statement regarding forward-looking statements This presentation may contain forward-looking
More informationCytomics in Action: Cytokine Network Cytometry
Cytomics in Action: Cytokine Network Cytometry Jonni S. Moore, Ph.D. Director, Clinical and Research Flow Cytometry and PathBioResource Associate Professor of Pathology & Laboratory Medicine University
More informationBrian GM Durie. Black Swan Research Initiative (BSRI) Purpose
Black Swan Research Initiative Brian GM Durie Saturday August 22, 2015 1 Black Swan Research Initiative (BSRI) Purpose The Black Swan Research Initiative (BSRI) is a global collaborative approach Which
More informationAntibody Structure. Antibodies
Antibodies Secreted by B lymphocytes Great diversity and specificity: >10 9 different antibodies; can distinguish between very similar molecules Tag particles for clearance/destruction Protect against
More informationAntibody Structure supports Function
Antibodies Secreted by B lymphocytes Great diversity and specificity: >10 9 different antibodies; can distinguish between very similar molecules Tag particles for clearance/destruction Protect against
More informationMultiple Myeloma (MM): Diagnosis, Treatment and Side Effects Management. Transcript. Slide Name & Number
Question 1) Multiple myeloma is a disease of: a) Hematopoietic stem cells b) Reticulocytes c) Plasma cells d) Mature lymphocytes 2) What is the acronym for the criteria used to guide therapy initiation
More informationDNA Binding Domains: Structural Motifs. Effector Domain. Zinc Fingers. Zinc Fingers, continued. Zif268
DNA Binding Domains: Structural Motifs Studies of known transcription factors have found several motifs of protein design to allow sequence-specific binding of DNA. We will cover only three of these motifs:
More informationPV92 PCR Bio Informatics
Purpose of PCR Chromosome 16 PV92 PV92 PCR Bio Informatics Alu insert, PV92 locus, chromosome 16 Introduce the polymerase chain reaction (PCR) technique Apply PCR to population genetics Directly measure
More informationGalea GL et al, J Biol Chem Supplementary Figure 1
Galea GL et al, J Biol Chem Supplementary Figure 1 Supplementary Figure 1: Characterisation of long bone osteoblastic cells derived from mouse long bone diaphyses. A) clbobs treated with or without differentiation
More informationCell culture and drug treatment. Lineage - Sca-1+ CD31+ EPCs were cultured on
Supplemental Material Detailed Methods Cell culture and drug treatment. Lineage - Sca-1+ CD31+ EPCs were cultured on 5µg/mL human fibronectin coated plates in DMEM supplemented with 10% FBS and penicillin/streptomycin
More informationSupplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate
Supplementary Figure Legends Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate BC041951 in gastric cancer. (A) The flow chart for selected candidate lncrnas in 660 up-regulated
More informationTHE PATH TO PRECISION MEDICINE IN MULTIPLE MYELOMA. themmrf.org
THE PATH TO PRECISION MEDICINE IN MULTIPLE MYELOMA themmrf.org ABOUT THE MULTIPLE MYELOMA RESEARCH FOUNDATION The Multiple Myeloma Research Foundation (MMRF) was established in 1998 by identical twin sisters
More informationA Phase I/IIa Study of Human Anti-CD38 Antibody MOR03087 in Relapsed/Refractory Multiple Myeloma
1 von 5 10.12.2013 10:33 A service of the U.S. National Institutes of Health Trial record 1 of 1 for: MOR202C101 Previous Study Return to List Next Study A Phase I/IIa Study of Human Anti-CD38 Antibody
More informationThis Infosheet explains what Monoclonal Gammopathy of Undetermined Significance (MGUS) is and how it is diagnosed and managed.
MGUS This Infosheet explains what Monoclonal Gammopathy of Undetermined Significance (MGUS) is and how it is diagnosed and managed. What is MGUS? Monoclonal gammopathy of undetermined significance, or
More informationSYNODOS: A CALL TO ACTION IN THE FIGHT AGAINST SCHWANNOMATOSIS
SYNODOS: A CALL TO ACTION IN THE FIGHT AGAINST SCHWANNOMATOSIS BACKGROUND Schwannomatosis is the rarest and least studied form of neurofibromatosis, affecting 1 in approximately 40,000 individuals, with
More informationA Level. A Level Biology. DNA Technology Questions. AQA, OCR, Edexcel. Name: Total Marks: Page 1
AQA, OCR, Edexcel A Level A Level Biology DNA Technology Questions Name: Total Marks: Page 1 Q1.(a) (i) A mutation of a tumour suppressor gene can result in the formation of a tumour. Explain how.........(2)
More informationNeural Induction. Chapter One
Neural Induction Chapter One Fertilization Development of the Nervous System Cleavage (Blastula, Gastrula) Neuronal Induction- Neuroblast Formation Cell Migration Mesodermal Induction Lateral Inhibition
More informationFluorescent in-situ Hybridization
Fluorescent in-situ Hybridization Presented for: Presented by: Date: 2 Definition In situ hybridization is the method of localizing/ detecting specific nucleotide sequences in morphologically preserved
More informationMultiple Myeloma: Treatment Options for Newly Diagnosed Patients in Bangladesh Perspective
Multiple Myeloma: Treatment Options for Newly Diagnosed Patients in Bangladesh Perspective *Rahman MM, 1 Aziz MA, 2 Islam MM, 3 Zaman AM, 4 Afrose S, 5 Khan MA 6 Treatment of multiple myeloma, a plasma
More informationMICB688L/MOCB639 Advanced Cell Biology Exam II
MICB688L/MOCB639 Advanced Cell Biology Exam II May 10, 2001 Name: 1. Briefly describe the four major classes of cell surface receptors and their modes of action (immediate downstream only) (8) 2. Please
More informationDr Guy Pratt Consultant Haematologist, Heart of England NHS Foundation Trust. Natural course of myeloma. Some definitions. First relapse.
Outlook for myeloma patients has improved Treatment for relapsed and/or refractory myeloma Dr Guy Pratt Consultant Haematologist, Heart of England NHS Foundation Trust Senior Lecturer, University of Birmingham
More informationAt the conclusion of this lesson you should be able to:
Learning Objectives At the conclusion of this lesson you should be able to: Understand the key terms and definitions regarding stem cells Differentiate between the adult and embryonic stem cells Differentiate
More informationThe science behind Betalutin : why is it unique? Roy H. Larsen PhD Sciencons AS, Oslo, Norway
The science behind Betalutin : why is it unique? Roy H. Larsen PhD Sciencons AS, Oslo, Norway Speaker credentials Roy H. Larsen, PhD >25 years of experience in research on targeted radionuclide therapy
More informationHypofractionated Radiation Therapy for Prostate Cancer
Hypofractionated Radiation Therapy for Prostate Cancer Jeff Michalski, MD, MBA, FASTRO The Carlos A. Perez Distinguished Professor of Radiation Oncology Washington University School of Medicine Improving
More informationGenomics And Pharmacogenomics In Anticancer Drug Development And Clinical Response (Cancer Drug Discovery And Development)
Genomics And Pharmacogenomics In Anticancer Drug Development And Clinical Response (Cancer Drug Discovery And Development) Strategies for modern biomarker and drug - Oct 3, 2014 Sequencing the cancer genome
More informationREGULATION OF PROTEIN SYNTHESIS. II. Eukaryotes
REGULATION OF PROTEIN SYNTHESIS II. Eukaryotes Complexities of eukaryotic gene expression! Several steps needed for synthesis of mrna! Separation in space of transcription and translation! Compartmentation
More informationInt. J. Mol. Sci. 2016, 17, 1259; doi: /ijms
S1 of S5 Supplementary Materials: Fibroblast-Derived Extracellular Matrix Induces Chondrogenic Differentiation in Human Adipose-Derived Mesenchymal Stromal/Stem Cells in Vitro Kevin Dzobo, Taegyn Turnley,
More informationsupplementary information
DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /
More informationREIMAGINING DRUG DEVELOPMENT:
Biology Reconstructed REIMAGINING DRUG DEVELOPMENT: Accurate Disease Modeling To Drive Successful Therapies Julia Kirshner, CEO julia@zpredicta.com 1 SUCCESS RATES OF DRUG DEVELOPMENT ARE LOW, " PARTICULARLY
More informationTreatment strategies for relapsing and refractory myeloma
Treatment strategies for relapsing and refractory myeloma Prof Gordon Cook Professor of Haematology and Myeloma Studies University of Leeds & Leeds Cancer Centre #MyelomaInfodays This talk will cover The
More informationWe are committed to translating ground-breaking science into genomic therapies that transform patients lives
We are committed to translating ground-breaking science into genomic therapies that transform patients lives Liver-based expression of the human alpha-galactosidase A gene (GLA) in a murine Fabry model
More informationA Study of Serum Protein Electrophoresis in Patients with Multiple Myeloma
MULTIPLE THE IRAQI POSTGRADUATE MYELOMA MEDICAL JOURNAL A Study of Serum Protein Electrophoresis in Patients with Multiple Myeloma Hind Shakir Ahmed ABSTRACT: BACKGROUND: Multiple myeloma (MM) is caused
More informationMurine TGFβ-antagonist (RAP-1332) Inhibits Fibrosis in a Murine Model of Myelofibrosis. Rajasekhar NVS Suragani, PhD
Murine TGFβ-antagonist (RAP-1332) Inhibits Fibrosis in a Murine Model of Myelofibrosis Rajasekhar NVS Suragani, PhD Polycythemia Vera (PV), Essential Thrombocythemia (ET) and Primary Myelofibrosis (PMF)
More informationDifferential Gene Expression
Biology 4361 Developmental Biology Differential Gene Expression September 28, 2006 Chromatin Structure ~140 bp ~60 bp Transcriptional Regulation: 1. Packing prevents access CH 3 2. Acetylation ( C O )
More informationElevated Immunoglobulins and Paraproteins
Elevated Immunoglobulins and Paraproteins NWL Pathology GP Study Afternoon Thursday 19 th October 2017 Dr Aristeidis Chaidos Consultant Haematologist and Honorary Senior Clinical Lecturer Hammersmith Hospital,
More informationDeveloping an Accurate and Precise Companion Diagnostic Assay for Targeted Therapies in DLBCL
Developing an Accurate and Precise Companion Diagnostic Assay for Targeted Therapies in DLBCL James Storhoff, Ph.D. Senior Manager, Diagnostic Test Development World Cdx, Boston, Sep. 10th Molecules That
More informationClinical Commissioning Policy: Eculizumab for the treatment of refractory antibody mediated rejection post kidney transplant
Clinical Commissioning Policy: Eculizumab for the treatment of refractory antibody mediated rejection post kidney transplant January 2014 Reference: NHS ENGLAND A07/P/c NHS England Clinical Commissioning
More informationDARATUMUMAB, A CD38 MONOCLONAL ANTIBODY IN PATIENTS WITH MULTIPLE MYELOMA Data from the dose-escalation part of the FIH study Abstract #8512
DARATUMUMAB, A CD38 MONOCLONAL ANTIBODY IN PATIENTS WITH MULTIPLE MYELOMA Data from the dose-escalation part of the FIH study Abstract #8512 Henk Lokhorst, Torben Plesner, Peter Gimsing, Hareth Nahi, Monique
More informationGuidelines for the diagnosis and management of Myeloma within AngCN
Guidelines for the diagnosis and management of Myeloma within AngCN Ref: AngCN-SSG-Ha5 Cancer Standards Measure: N/A Page 1 of 11 Approved and Published: March 2013 1 Introduction These brief guidelines
More informationPlatelet Refractoriness: The Basics. Martin H. Bluth, MD, PhD
Platelet Refractoriness: The Basics Martin H. Bluth, MD, PhD Complete Toxicology Laboratories, LLC Objectives Define platelet refractoriness and associated conditions that may cause platelet refractoriness.
More informationMyeloma treatment algorithm 1999
Outlook for myeloma patients has improved Treatment for relapsed and/or refractory myeloma Dr Guy Pratt Consultant Haematologist, Heart of England NHS Foundation Trust Senior Lecturer, University of Birmingham
More informationOPT-302: a VEGF-C/VEGF-D Trap for wet AMD
OPT-302: a VEGF-C/VEGF-D Trap for wet AMD Ophthalmology Innovation Summit, Nov 12 2015 Circadian Technologies (ASX:CIR, OTCQX:CKDXY) Megan Baldwin PhD, CEO & MD megan.baldwin@opthea.com 2 Disclaimer Investment
More informationDNA Microarray Technology
CHAPTER 1 DNA Microarray Technology All living organisms are composed of cells. As a functional unit, each cell can make copies of itself, and this process depends on a proper replication of the genetic
More informationThis talk will cover. Treatment for relapsed and/or refractory myeloma. What is relapsed myeloma and refractory myeloma. Treatment options for relapse
This talk will cover Treatment for relapsed and/or refractory myeloma Dr Guy Pratt Consultant Haematologist Heart of England NHS Trust and Senior Lecturer in Haematology University of Birmingham What is
More informationPCR Arrays. An Advanced Real-time PCR Technology to Empower Your Pathway Analysis
PCR Arrays An Advanced Real-time PCR Technology to Empower Your Pathway Analysis 1 Table of Contents 1. Introduction to the PCR Arrays 2. How PCR Arrays Work 3. Performance Data from PCR Arrays 4. Research
More informationLecture 23: Clinical and Biomedical Applications of Proteomics; Proteomics Industry
Lecture 23: Clinical and Biomedical Applications of Proteomics; Proteomics Industry Clinical proteomics is the application of proteomic approach to the field of medicine. Proteome of an organism changes
More informationleading the way in research & development
leading the way in research & development people. passion. possibilities. ABBVIE 2 immunology AbbVie Immunology has a demonstrated record of success in identifying and developing both small molecule and
More informationMultiple Myeloma Research Foundation 2014 Research Fellow Award Program Guidelines
Multiple Myeloma Research Foundation 2014 Research Fellow Award Program Guidelines Program Description: MULTIPLE MYELOMA RESEARCH FOUNDATION 2014 RESEARCH FELLOW AWARD The Multiple Myeloma Research Foundation
More informationA Caregiver s Guide to Helping Myeloma Patients. Webinar 1, February 23, 2017 The New Normal for Caregivers of Patients With Multiple Myeloma
A Caregiver s Guide to Helping Myeloma Patients The New Normal for Caregivers of Patients With Multiple Myeloma Speakers Moderator: Mary DeRome Multiple Myeloma Research Foundation Norwalk, Connecticut
More informationMicroarray-Based Gene Expression Profile Testing for Multiple Myeloma Risk Stratification
Microarray-Based Gene Expression Profile Testing for Multiple Myeloma Risk Stratification Applies to all products administered or underwritten by Blue Cross and Blue Shield of Louisiana and its subsidiary,
More informationFocus Application. Cell Migration. Featured Study: Inhibition of Cell Migration by Gene Silencing. xcelligence System Real-Time Cell Analyzer
xcelligence System Real-Time Cell Analyzer Focus Application Cell Migration Featured Study: Inhibition of Cell Migration by Gene Silencing Markus Greiner and Richard Zimmermann Department of Medical Biochemistry
More informationLessons learned: NCI s FLT F-18 IND and F-18 NaF NDA. Paula M. Jacobs, Ph.D. Deputy Associate Director, DCTD. NCI Cancer Imaging Program
Lessons learned: NCI s FLT F-18 IND and F-18 NaF NDA Paula M. Jacobs, Ph.D. Deputy Associate Director, DCTD. NCI Cancer Imaging Program April 13, 2010 Disclaimers Opinions are mine alone NCI, NIH, and
More informationINTERIM RESULTS AS OF MARCH 31, 2017
INTERIM RESULTS AS OF MARCH 31, 2017 1 FORWARD-LOOKING STATEMENTS This presentation includes forward-looking statements that involve risks, uncertainties and other factors, many of which are outside of
More informationFirst Annual Biomarker Symposium Quest Diagnostics Clinical Trials
First Annual Biomarker Symposium Quest Diagnostics Clinical Trials Terry Robins, Ph.D. Director Biomarker R&D and Scientific Affairs Quest Diagnostics Clinical Trials Key Considerations: Biomarker Development
More informationIntroduction State the objectives of the work and provide adequate background, avoiding a detailed literature survey or a summary of the results.
Format requirements for IJBCB articles For each article type, IJBCB has its own requirements regarding the article format. Please ensure you follow the exact guidelines (included below) for the specific
More informationQIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd
QIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd 1 Our current NGS & Bioinformatics Platform 2 Our NGS workflow and applications 3 QIAGEN s
More informationDifferential Gene Expression
Biology 4361 Developmental Biology Differential Gene Expression June 19, 2008 Differential Gene Expression Overview Chromatin structure Gene anatomy RNA processing and protein production Initiating transcription:
More informationREGULATION OF GENE EXPRESSION
REGULATION OF GENE EXPRESSION Each cell of a living organism contains thousands of genes. But all genes do not function at a time. Genes function according to requirements of the cell. Genes control the
More informationAn Overview of Chimeric Antigen Receptor T-cells: CAR-T-ing Away Cancer
An Overview of Chimeric Antigen Receptor T-cells: CAR-T-ing Away Cancer Maxwell Brown, PharmD Clinical Pharmacy Manager, Hematopoietic Stem Cell Transplantation NewYork-Presbyterian/Weill Cornell Medical
More information