Int. J. Mol. Sci. 2016, 17, 1259; doi: /ijms

Supplementary Figure 1. Soft fibrin gels promote growth and organized mesodermal differentiation. Representative images of single OGTR1 ESCs cultured

Supplementary Figure 1. Soft fibrin gels promote growth and organized mesodermal differentiation. Representative images of single OGTR1 ESCs cultured in 90-Pa 3D fibrin gels for 5 days in the presence

Supplementary Figure 1.

Supplementary Figure 1. Quantification of western blot analysis of fibroblasts (related to Figure 1) (A-F) Quantification of western blot analysis for control and IR-Mut fibroblasts. Data are expressed

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Han et al., http://www.jcb.org/cgi/content/full/jcb.201311007/dc1 Figure S1. SIVA1 interacts with PCNA. (A) HEK293T cells were transiently

Supplementary Data. Supplementary Methods Three-step protocol for spontaneous differentiation of mouse induced pluripotent stem (embryonic stem) cells

Supplementary Data Supplementary Methods Three-step protocol for spontaneous differentiation of mouse induced pluripotent stem (embryonic stem) cells Mouse induced pluripotent stem cells (ipscs) were cultured

Regulation of transcription by the MLL2 complex and MLL complex-associated AKAP95

Supplementary Information Regulation of transcription by the complex and MLL complex-associated Hao Jiang, Xiangdong Lu, Miho Shimada, Yali Dou, Zhanyun Tang, and Robert G. Roeder Input HeLa NE IP lot:

Directed Differentiation of Human Induced Pluripotent Stem Cells. into Fallopian Tube Epithelium

Directed Differentiation of Human Induced Pluripotent Stem Cells into Fallopian Tube Epithelium Nur Yucer 1,2, Marie Holzapfel 2, Tilley Jenkins Vogel 2, Lindsay Lenaeus 1, Loren Ornelas 1, Anna Laury

monoclonal antibody. (a) The specificity of the anti-rhbdd1 monoclonal antibody was examined in

Supplementary information Supplementary figures Supplementary Figure 1 Determination of the s pecificity of in-house anti-rhbdd1 mouse monoclonal antibody. (a) The specificity of the anti-rhbdd1 monoclonal

Table 1. Primers, annealing temperatures, and product sizes for PCR amplification.

Table 1. Primers, annealing temperatures, and product sizes for PCR amplification. Gene Direction Primer sequence (5 3 ) Annealing Temperature Size (bp) BRCA1 Forward TTGCGGGAGGAAAATGGGTAGTTA 50 o C 292

Supplementary Figure 1. Expressions of stem cell markers decreased in TRCs on 2D plastic. TRCs were cultured on plastic for 1, 3, 5, or 7 days,

Supplementary Figure 1. Expressions of stem cell markers decreased in TRCs on 2D plastic. TRCs were cultured on plastic for 1, 3, 5, or 7 days, respectively, and their mrnas were quantified by real time

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 1.138/NMAT3777 Biophysical regulation of epigenetic state and cell reprogramming Authors: Timothy L. Downing 1,2, Jennifer Soto 1,2, Constant Morez 2,3,, Timothee Houssin

SUPPLEMENTARY INFORMATION

DOI: 10.1038/ncb3562 In the format provided by the authors and unedited. Supplementary Figure 1 Glucose deficiency induced FH-ATF2 interaction. In b-m, immunoblotting or immunoprecipitation analyses were

Supplementary Figure 1. Characterization of hipscs derived from primary human fibroblasts. a,b. Morphology of hipscs. hipscs exhibit hesc-like

Supplementary Figure 1. Characterization of hipscs derived from primary human fibroblasts. a,b. Morphology of hipscs. hipscs exhibit hesc-like morphology in co-culture with mouse embryonic feeder fibroblasts

PI3K/mTORC2 regulates TGFβ/Activin signalling by modulating Smad2/3

Supplementary Information PI3K/mTORC2 regulates TGFβ/Activin signalling by modulating Smad2/3 activity via linker phosphorylation Jason S.L. Yu, 1 Thamil Selvee Ramasamy, 1,2 Nick Murphy, 1 Marie Holt,

SUPPLEMENTAL MATERIAL. Carvajal et al. Supplemental Table 1. List of quantitative PCR primers used for cdna analyses and

UPPLEMEAL MATERIAL Carvajal et al. upplemental Table 1. List of quantitative PCR primers used for cdna analyses and chromatin immunoprecipitation assays. Figure 1. DNA damage-induced transcriptional repression

Isolation, culture, and transfection of primary mammary epithelial organoids

Supplementary Experimental Procedures Isolation, culture, and transfection of primary mammary epithelial organoids Primary mammary epithelial organoids were prepared from 8-week-old CD1 mice (Charles River)

Supplementary Fig. 1

a FL (1-2266) NL (1-1190) CL (1191-2266) HA-ICE1: - HA-ICE1: - - - FLAG-ICE2: + + + + FLAG-ELL: + + + + + + IP: anti-ha FLAG-ICE2 HA-ICE1-FL HA-ICE1-NL HA-ICE1-CL FLAG-ICE2 b IP: anti-ha FL (1-2266) NL

Supplementary Information. Conversion of vascular endothelial cells into multipotent stem-like cells

Supplementary Information Conversion of vascular endothelial cells into multipotent stem-like cells Damian Medici 1, Eileen M. Shore 2,3,4, Vitali Y. Lounev 2,4, Frederick S. Kaplan 2,4,5, Raghu Kalluri

Cell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan).

1 2 3 4 5 6 7 8 Supplemental Materials and Methods Cell proliferation assay Cell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan). GCs were plated at 96-well

5.4 PERIODONTAL LIGAMENT STEM CELL (PDLSC) ISOLATION. Having validated that the isolated PDL stromal cells possessed the major phenotypic

5.4 PERIODONTAL LIGAMENT STEM CELL (PDLSC) ISOLATION Having validated that the isolated PDL stromal cells possessed the major phenotypic characteristics of their tissue of origin, we next focused on identifying

Supplementary Materials for

www.sciencesignaling.org/cgi/content/full/8/362/ra12/dc1 Supplementary Materials for FOXP1 potentiates Wnt/β-catenin signaling in diffuse large B cell lymphoma Matthew P. Walker, Charles M. Stopford, Maria

SUPPLEMENTARY INFORMATION

SUPPLEMENTRY INFORMTION DOI:.38/ncb Kdmb locus kb Long isoform Short isoform Long isoform Jmj XX PHD F-box LRR Short isoform XX PHD F-box LRR Target Vector 3xFlag Left H Neo Right H TK LoxP LoxP Kdmb Locus

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1. Functional assays of hepatocyte-like cells induced from H1 hescs (a) P450 and AAT staining, PAS staining, LDL uptake assay, and ICG uptake and release assay

WT Day 90 after injections

Supplementary Figure 1 a Day 1 after injections Day 9 after injections Klf5 +/- Day 1 after injections Klf5 +/- Day 9 after injections BLM PBS b Day 1 after injections Dermal thickness (μm) 3 1 Day 9 after

Supplementary Figure 1, related to Figure 1. GAS5 is highly expressed in the cytoplasm of hescs, and positively correlates with pluripotency.

Supplementary Figure 1, related to Figure 1. GAS5 is highly expressed in the cytoplasm of hescs, and positively correlates with pluripotency. (a) Transfection of different concentration of GAS5-overexpressing

Supplemental Information. Tissue Mechanics Orchestrate Wnt-Dependent. Human Embryonic Stem Cell Differentiation

Cell Stem Cell, Volume 19 Supplemental Information Tissue Mechanics Orchestrate Wnt-Dependent Human Embryonic Stem Cell Differentiation Laralynne Przybyla, Johnathon N. Lakins, and Valerie M. Weaver Supplemental

Supplemental Figure 1 (Figure S1), related to Figure 1 Figure S1 provides evidence to demonstrate Nfatc1Cre is a mouse line that directed gene

Developmental Cell, Volume 25 Supplemental Information Brg1 Governs a Positive Feedback Circuit in the Hair Follicle for Tissue Regeneration and Repair Yiqin Xiong, Wei Li, Ching Shang, Richard M. Chen,

Combinatorial microenvironmental regulation of liver progenitor differentiation by Notch ligands, TGFβ, and extracellular matrix

Combinatorial microenvironmental regulation of liver progenitor differentiation by Notch ligands, TGFβ, and extracellular matrix Authors Kerim B. Kaylan, 1,2 Viktoriya Ermilova, 1,2 Ravi Chandra Yada,

Supplementary Information

Supplementary Information Sam68 modulates the promoter specificity of NF-κB and mediates expression of CD25 in activated T cells Kai Fu 1, 6, Xin Sun 1, 6, Wenxin Zheng 1, 6, Eric M. Wier 1, Andrea Hodgson

ASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG

Supplemental Materials and Methods Plasmids: the following plasmids were used in the supplementary data: pwzl-myc- Lats2 (Aylon et al, 2006), pretrosuper-vector and pretrosuper-shp53 (generous gift of

Notch1 (forward: 5 -TGCCTGTGCACACCATTCTGC-3, reverse: Notch2 (forward: 5 -ATGCACCATGACATCGTTCG-3, reverse:

Supplementary Information Supplementary Methods. RT-PCR. For mouse ES cells, the primers used were: Notch1 (forward: 5 -TGCCTGTGCACACCATTCTGC-3, reverse: 5 -CAATCAGAGATGTTGGAATGC-3 ) 1, Notch2 (forward:

Supplementary Fig. 1. (A) Working model. The pluripotency transcription factor OCT4

SUPPLEMENTARY FIGURE LEGENDS Supplementary Fig. 1. (A) Working model. The pluripotency transcription factor OCT4 directly up-regulates the expression of NIPP1 and CCNF that together inhibit protein phosphatase

Supplementary Figure 1. Isolation of GFPHigh cells.

Supplementary Figure 1. Isolation of GFP High cells. (A) Schematic diagram of cell isolation based on Wnt signaling activity. Colorectal cancer (CRC) cell lines were stably transduced with lentivirus encoding

a KYSE270-CON KYSE270-Id1

a KYSE27-CON KYSE27- shcon shcon sh b Human Mouse CD31 Relative MVD 3.5 3 2.5 2 1.5 1.5 *** *** c KYSE15 KYSE27 sirna (nm) 5 1 Id2 Id2 sirna 5 1 sirna (nm) 5 1 Id2 sirna 5 1 Id2 [h] (pg per ml) d 3 2 1

Supplementary Materials for

www.sciencesignaling.org/cgi/content/full/10/496/eaam6291/dc1 Supplementary Materials for Regulation of autophagy, NF-κB signaling, and cell viability by mir-124 in KRAS mutant mesenchymal-like NSCLC cells

A cost-effective system for differentiation of intestinal epithelium from human induced pluripotent stem cells

A cost-effective system for differentiation of intestinal epithelium from human induced pluripotent stem cells Soichiro Ogaki 1, 2, 3, 4, 5, *, ayu orooka 1,*, Kaito Otera 1, 1, 3 and Shoen Kume Supplementary

SUPPLEMENTARY INFORMATION

DOI: 10.1038/ncb3363 Supplementary Figure 1 Several WNTs bind to the extracellular domains of PKD1. (a) HEK293T cells were co-transfected with indicated plasmids. Flag-tagged proteins were immunoprecipiated

Supplementary Figure 1. Wnt10a mutation causes aberrant molar tooth development and formation of an ectopic M4 molar. (a,b) Smaller molar teeth with

Supplementary Figure 1. Wnt10a mutation causes aberrant molar tooth development and formation of an ectopic M4 molar. (a,b) Smaller molar teeth with blunted cusp formation, and presence of an ectopic molar

SUPPLEMENTARY DATA. Supplementary Table 1. Sequences of the primers and TaqMan probes

Supplementary Table 1. Sequences of the primers and TaqMan probes Gene (GenBank accession) Oligonucleotide sequence (5-3 ) ARG1 (NM_000045) TACTAGGAAGAAAGAAAAGGCCAATTC GTAGCCCTGTTTTGTAGATTTCTTCTGT TaqMan

Fig. S1. eif6 expression in HEK293 transfected with shrna against eif6 or pcmv-eif6 vector.

Fig. S1. eif6 expression in HEK293 transfected with shrna against eif6 or pcmv-eif6 vector. (a) Western blotting analysis and (b) qpcr analysis of eif6 expression in HEK293 T cells transfected with either

supplementary information

DOI: 10.1038/ncb2116 Figure S1 CDK phosphorylation of EZH2 in cells. (a) Comparison of candidate CDK phosphorylation sites on EZH2 with known CDK substrates by multiple sequence alignments. (b) CDK1 and

Supplementary Fig. 1. Schematic structure of TRAIP and RAP80. The prey line below TRAIP indicates bait and the two lines above RAP80 highlight the

Supplementary Fig. 1. Schematic structure of TRAIP and RAP80. The prey line below TRAIP indicates bait and the two lines above RAP80 highlight the prey clones identified in the yeast two hybrid screen.

Supplemental material

Supplemental material THE JOURNAL OF CELL BIOLOGY Taylor et al., http://www.jcb.org/cgi/content/full/jcb.201403021/dc1 Figure S1. Representative images of Cav 1a -YFP mutants with and without LMB treatment.

Fig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.

Fig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.SCUBE2, E-cadherin.Myc, or HA.p120-catenin was transfected in a combination

supplementary information

Figure S1 ZEB1 full length mrna. (a) Analysis of the ZEB1 mrna using the UCSC genome browser (http://genome.ucsc.edu) revealed truncation of the annotated Refseq sequence (NM_030751). The probable terminus

Control + SDS + 2BME. Control + SDS. Control

Supplementary Figure 1 2BME:2-mercaptoethanol Control Control + SDS Control + SDS + 2BME Control Control + SDS Control + SDS + 2BME Control Control + SDS Control + SDS + 2BME Ephrin-B2 Oligomers Ephrin-B2

Electromagnetic Fields Mediate Efficient Cell Reprogramming Into a Pluripotent State

Electromagnetic Fields Mediate Efficient Cell Reprogramming Into a Pluripotent State Soonbong Baek, 1 Xiaoyuan Quan, 1 Soochan Kim, 2 Christopher Lengner, 3 Jung- Keug Park, 4 and Jongpil Kim 1* 1 Lab

Table S1. Primers used in RT-PCR studies (all in 5 to 3 direction)

Table S1. Primers used in RT-PCR studies (all in 5 to 3 direction) Epo Fw CTGTATCATGGACCACCTCGG Epo Rw TGAAGCACAGAAGCTCTTCGG Jak2 Fw ATCTGACCTTTCCATCTGGGG Jak2 Rw TGGTTGGGTGGATACCAGATC Stat5A Fw TTACTGAAGATCAAGCTGGGG

SUPPLEMENTARY INFORMATION

DOI: 10.1038/ncb3240 Supplementary Figure 1 GBM cell lines display similar levels of p100 to p52 processing but respond differentially to TWEAK-induced TERT expression according to TERT promoter mutation

(a) Immunoblotting to show the migration position of Flag-tagged MAVS

Supplementary Figure 1 Characterization of six MAVS isoforms. (a) Immunoblotting to show the migration position of Flag-tagged MAVS isoforms. HEK293T Mavs -/- cells were transfected with constructs expressing

Confocal immunofluorescence microscopy

Confocal immunofluorescence microscopy HL-6 and cells were cultured and cytospun onto glass slides. The cells were double immunofluorescence stained for Mt NPM1 and fibrillarin (nucleolar marker). Briefly,

Supplementary Figure 1 Validate the expression of mir-302b after bacterial infection by northern

Supplementary Figure 1 Validate the expression of mir-302b after bacterial infection by northern blot. Northern blot analysis of mir-302b expression following infection with PAO1, PAK and Kp in (A) lung

Supplementary information for: Ten-Eleven Translocation-2 (Tet2) Is Involved in Myogenic Differentiation of Skeletal Myoblast Cells in

Supplementary information for: Ten-Eleven Translocation-2 (Tet2) Is Involved in Myogenic Differentiation of Skeletal Myoblast Cells in Vitro Xia Zhong*, Qian-Qian Wang*, Jian-Wei Li, Yu-Mei Zhang, Xiao-Rong

Why Doing Live-Cell Imaging?

Why Doing Live-Cell Imaging? The Snapshot Bias Different Endpoint = Different Result IncuCyte System Key Advantages IncuCyte Live-Cell Imaging System Software Advantage: Distributed Access NETWORK Unlimited

A) B) Ladder. Supplementary Figure 1. Recombinant calpain 14 purification analysis. A) The general domain structure of classical

A) B) Ladder C) r4 r4 Nt- -Ct 78 kda Supplementary Figure 1. Recombinant calpain 14 purification analysis. A) The general domain structure of classical calpains is shown. The protease core consists of

TRIM31 is recruited to mitochondria after infection with SeV.

Supplementary Figure 1 TRIM31 is recruited to mitochondria after infection with SeV. (a) Confocal microscopy of TRIM31-GFP transfected into HEK293T cells for 24 h followed with SeV infection for 6 h. MitoTracker

Emanuela Tumini, Sonia Barroso, Carmen Pérez Calero and Andrés Aguilera

SUPPLEMENTARY INFORMATION Roles of human POLD1 and POLD3 in genome stability Emanuela Tumini, Sonia Barroso, Carmen Pérez Calero and Andrés Aguilera SUPPLEMENTARY METHODS Cell proliferation After sirna

Supplementary Figure 1, Wiel et al

Supplementary Figure 1, Wiel et al Supplementary Figure 1 ITPR2 increases in benign tumors and decreases in aggressive ones (a-b) According to the Oncomine database, expression of ITPR2 increases in renal

Supplementary Figure Legends

Supplementary Figure Legends Supplementary Fig. 1. The third PDZ domain of PAR-3 and the C-terminal PDZ domain binding motif of VE-cadherin mediate the recruitment of PAR-3 to cell-cell contacts in cells.

SUPPLEMENTARY MATERIALS

SUPPLEMENTARY MATERIALS Supplementary Table S1: List of primers used for ChIP analysis and Oligo-pull-down assay. Genes Sequence mppargc1a FW 5 -GCGAGGTTTCTGCTTAGTCA-3 (-2317) RV 5 -ACAATGACTAAGCAGAAACCTCG-3

Supplementary Materials for

www.sciencesignaling.org/cgi/content/full/6/282/ra53/dc1 Supplementary Materials for Estrogen Alters the Splicing of Type 1 Corticotropin-Releasing Hormone Receptor in Breast Cancer Cells Suchita Lal,

Khaled_Fig. S MITF TYROSINASE R²= MITF PDE4D R²= Variance from mean mrna expression

Khaled_Fig. S Variance from mean mrna expression.8 2 MITF.6 TYROSINASE.4 R²=.73.2.8.6.4.2.8.6.4.2.8.6.4.2 MALME3M SKMEL28 UACC257 MITF PDE4D R²=.63 4.5 5 MITF 3.5 4 PDE4B 2.5 3 R²=.2.5 2.5.8.6.4.2.8.6.4.2

Supplementary Table, Figures and Videos

Supplementary Table, Figures and Videos Table S1. Oligonucleotides used for different approaches. (A) RT-qPCR study. (B) qpcr study after ChIP assay. (C) Probes used for EMSA. Figure S1. Notch activation

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1.

Supplementary Figure 1. Characterization and high expression of Lnc-β-Catm in liver CSCs. (a) Heatmap of differently expressed lncrnas in Liver CSCs (CD13 + CD133 + ) and non-cscs (CD13 - CD133 - ) according

supplementary information

DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /

Supplemental Tables Supplemental Table 1. Phenotypic profile of different HSC lines. Marker d0 mhsc d7 mhsc 8B LX2 CD11b 3.61% 2.21% 2.16% 3.77% F4/80 4.54% 2.05% 0.127% 1.44% Elastin 3.90% 2.95% 4.23%

Supplementary Table 1. Sequences for BTG2 and BRCA1 sirnas.

Supplementary Table 1. Sequences for BTG2 and BRCA1 sirnas. Target Gene Non-target / Control BTG2 BRCA1 NFE2L2 Target Sequence ON-TARGET plus Non-targeting sirna # 1 (Cat# D-001810-01-05) sirna1: GAACCGACAUGCUCCCGGA

transcription and the promoter occupancy of Smad proteins. (A) HepG2 cells were co-transfected with the wwp-luc reporter, and FLAG-tagged FHL1,

Supplementary Data Supplementary Figure Legends Supplementary Figure 1 FHL-mediated TGFβ-responsive reporter transcription and the promoter occupancy of Smad proteins. (A) HepG2 cells were co-transfected

Supplementary information Activation of AMP-activated protein kinase

Supplementary information Activation of AMP-activated protein kinase 2 by nicotine instigates formation of abdominal aortic aneurysms in mice in vivo Shuangxi Wang 1,2,5, Cheng Zhang 1,2,5, Miao Zhang

Positive selection gates for the collection of LRCs or nonlrcs had to be drawn based on the location and

Determining positive selection gates for LRCs and nonlrcs Positive selection gates for the collection of LRCs or nonlrcs had to be drawn based on the location and shape of the Gaussian distributions. For

Supplementary Fig. S1. Schematic representation of mouse lines Pax6 fl/fl and mrx-cre used in this study. (A) To generate Pax6 fl/ fl

Supplementary Fig. S1. Schematic representation of mouse lines Pax6 fl/fl and mrx-cre used in this study. (A) To generate Pax6 fl/ fl, loxp sites flanking exons 3-6 (red arrowheads) were introduced into

Supplementary Figure 1. (A) Cell proliferative ability and (B) the invasiveness of

LEGEND FOR SUPPLEMENTARY FIGURES Supplementary Figure 1. (A) Cell proliferative ability and (B) the invasiveness of LLC-1, LLC-3, and LLC-5 cell line series were quantified by BrdU assay after 72 h of

TALEN mediated targeted editing of GM2/GD2-synthase gene modulates anchorage independent growth by reducing anoikis resistance in mouse tumor cells

Supplementary Information for TALEN mediated targeted editing of GM2/GD2-synthase gene modulates anchorage independent growth by reducing anoikis resistance in mouse tumor cells Barun Mahata 1, Avisek

Supplementary Figure 1. Localization of MST1 in RPE cells. Proliferating or ciliated HA- MST1 expressing RPE cells (see Fig. 5b for establishment of

Supplementary Figure 1. Localization of MST1 in RPE cells. Proliferating or ciliated HA- MST1 expressing RPE cells (see Fig. 5b for establishment of the cell line) were immunostained for HA, acetylated

Marilyn G. Rimando, Hao-Hsiang Wu, Yu-An Liu, Chien-Wei Lee, Shu-Wen Kuo, Yin-

Supplementary Information Glucocorticoid receptor and Histone Deacetylase 6 mediate the differential effect of dexamethasone during osteogenesis of Mesenchymal stromal cells (MSCs) Marilyn G. Rimando,

Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling

Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Glendining KA 1, Markie D 2, Gardner RJM 4, Franz EA 3, Robertson SP 4, Jasoni CL 1 Supplementary

Supplementary

Supplementary information Supplementary Material and Methods Plasmid construction The transposable element vectors for inducible expression of RFP-FUS wt and EGFP-FUS R521C and EGFP-FUS P525L were derived

Supplementary Figure 1. ips_3y+mir-302b. ips_3y+mir-372. ips_3y+mir-302b + mir-372. ips_4y. ips_4y+mir-302b. ips_4y + mir-372

Supplementary Figure 1 ips_3y+mir-32b ips_3y+ ips_3y+mir-32b + ips_4y ips_4y+mir-32b ips_4y + Nature Biotechnology: doi:1.138/nb.t.1862 TRA-1-6 DAPI Oct3/4 Supplementary Figure 1: ips cells derived from

Thyroid peroxidase gene expression is induced by lipopolysaccharide involving Nuclear Factor (NF)-κB p65 subunit phosphorylation

1 2 3 4 5 SUPPLEMENTAL DATA Thyroid peroxidase gene expression is induced by lipopolysaccharide involving Nuclear Factor (NF)-κB p65 subunit phosphorylation Magalí Nazar, Juan Pablo Nicola, María Laura

Supplementary Data. Supplementary Table S1.

Supplementary Data Supplementary Table S1. Primer Sequences for Real-Time Reverse Transcription-Polymerase Chain Reaction Gene Forward 5?3 Reverse 3?5 Housekeeping gene 36B4 TCCAGGCTTTGGGCATCA CTTTATCAGCTGCACATCACTCAGA

14_integrins_EGFR

α1 Integrin α1 -/- fibroblasts from integrin α1 knockout animals Figure S1. Serum-starved fibroblasts from α -/- 1 and +/+ mice were stimulated with 10% FBS for 30 min. (FBS) or plated on collagen I (CI)

Supplementary Information: ITGAV and ITGA5 diversely regulate proliferation and adipogenic differentiation of human adipose derived stem cells

Supplementary Information: ITGAV and ITGA5 diversely regulate proliferation and adipogenic differentiation of human adipose derived stem cells E. M. Morandi, R. Verstappen, M. E. Zwierzina, S. Geley, G.

Supplemental Information. Mitophagy Controls the Activities. of Tumor Suppressor p53. to Regulate Hepatic Cancer Stem Cells

Molecular Cell, Volume 68 Supplemental Information Mitophagy Controls the Activities of Tumor Suppressor to Regulate Hepatic Cancer Stem Cells Kai Liu, Jiyoung Lee, Ja Yeon Kim, Linya Wang, Yongjun Tian,

Supplementary Figure 1 PARP1 is involved in regulating the stability of mrnas from pro-inflammatory cytokine/chemokine mediators.

Supplementary Figure 1 PARP1 is involved in regulating the stability of mrnas from pro-inflammatory cytokine/chemokine mediators. (a) A graphic depiction of the approach to determining the stability of

At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in

Supplementary Materials and Methods Barrier function assays At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in acidic X-gal mix (100 mm phosphate buffer at ph4.3, 3 mm

Sélection Internationale Ens Ulm 2012, Cell Biology

Sélection Internationale Ens Ulm 2012, Cell Biology Please read the whole subject before starting. Questions 1-8 and 12-14 are general biology questions. In questions 9, 10, 11 and15, we ask you to interpret

Supplementary Figures and Legends.

Supplementary Figures and Legends. Supplementary Figure 1: Impact of injury on Rb1 and PPARϒ expression. Following ipsilateral axotomy injury, adult DRG expression of Rb1 mrna declined (*p

Supplementary Figure S1. Expression of complement components in E4 chick eyes. (a) A

Supplementary Figure S1. Expression of complement components in E4 chick eyes. (a) A schematic of the eye showing the ciliary margin (CM) of the anterior region, and the neuroepithelium (NE) and retinal

Nature Methods: doi: /nmeth Supplementary Figure 1. Schematics of SAM, dcas9-suntag and dcas9-vpr.

Supplementary Figure 1 Schematics of SAM, dcas9-suntag and dcas9-vpr. (a) Schematics of SAM. SAM consists of two chimeric proteins, dcas9 fused with VP64 and MS2-coat protein fused with p65 and HSF1 activator

Supplemental Materials. Matrix Proteases Contribute to Progression of Pelvic Organ Prolapse in Mice and Humans

Supplemental Materials Matrix Proteases Contribute to Progression of Pelvic Organ Prolapse in Mice and Humans Madhusudhan Budatha, Shayzreen Roshanravan, Qian Zheng, Cecilia Weislander, Shelby L. Chapman,

Supplementary Figure 1.

Supplementary Figure 1. (A) UCSC Genome Browser view of region immediately downstream of the NEUROG3 start codon. All candidate grna target sites which meet the G(N 19 )NGG constraint are aligned to illustrate

Supplementary Figure 1. Drawing of spinal cord open-book preparations and DiI tracing. Nature Neuroscience: doi: /nn.3893

Supplementary Figure 1 Drawing of spinal cord open-book preparations and DiI tracing. Supplementary Figure 2 In ovo electroporation of dominant-negative PlexinA1 in commissural neurons induces midline

mir-24-mediated down-regulation of H2AX suppresses DNA repair

Supplemental Online Material mir-24-mediated down-regulation of H2AX suppresses DNA repair in terminally differentiated blood cells Ashish Lal 1,4, Yunfeng Pan 2,4, Francisco Navarro 1,4, Derek M. Dykxhoorn

Supplementary Fig. 1. A, Upper panel shows schematic molecular representation of mutation- and SNP-replacement with FANCA-c-HDAdV in FANCA-corrected

Supplementary Fig. 1. A, Upper panel shows schematic molecular representation of mutation- and SNP-replacement with FANCA-c-HDAdV in FANCA-corrected FA-iPSC line (C-FA-iPSCs). Lower panels show the sequencing

Primers used for PCR of conductin, SGK1 and GAPDH have been described in (Dehner et al,

Supplementary METHODS Flow Cytometry (FACS) For FACS analysis, trypsinized cells were fixed in ethanol, rehydrated in PBS and treated with 40μg/ml propidium iodide and 10μ/ml RNase for 30 min at room temperature.

Supplementary Figure S1 Evi/Wls and Wnt3 are overexpressed in epithelial cells in colon cancers. (a) Validation of the specificity of the Wnt3

Supplementary Figure S1 Evi/Wls and Wnt3 are overexpressed in epithelial cells in colon cancers. (a) Validation of the specificity of the Wnt3 antibody. HCT116 cells were reverse transfected with sicontrol

Supplementary Figure 1 a. d 0.8 CON LPS PAN. 2nd ab nephrin podocin CON LPS PAN. upar. -tubulin. upar. upar / -tubulin CON LPS PAN

Supplementary Figure 1 a Efferent arteriole Podocytes Afferent arteriole FP Endothelium GBM Glomerular filtration barrier b 188kD HEK + GFP HEK + GFP-Nphs1 Differentiated Podocytes HEK + GFP HEK + GFP-Nphs2

Nature Biotechnology: doi: /nbt Supplementary Figure 1

Supplementary Figure 1 Schematic and results of screening the combinatorial antibody library for Sox2 replacement activity. A single batch of MEFs were plated and transduced with doxycycline inducible

Supplemental Figure 1: CIP2A and SET levels are increased in some. primary human pancreatic cancer samples. (A) CIP2A mrna levels were

Supplemental Figure Legends and Figures: Supplemental Figure 1: CIP2A and SET levels are increased in some primary human pancreatic cancer samples. (A) CIP2A mrna levels were measured in 3 benign (non-cancer)

Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table.

Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of

Supplementary Figure 1 Characterization of sirna-onv stability. (a) Fluorescence recovery curves of SQ-siRNA-ONV and SQ-ds-siRNA in 1 TAMg buffer

Supplementary Figure 1 Characterization of sirna-onv stability. (a) Fluorescence recovery curves of SQ-siRNA-ONV and SQ-ds-siRNA in 1 TAMg buffer containing 10% serum The data error bars indicate means