SUPPLEMENTARY INFORMATION
|
|
- Ami Lawson
- 6 years ago
- Views:
Transcription
1 Soft fibrin gels promote selection and growth of tumorigenic cells Jing Liu $, Youhua Tan $, Huafeng Zhang, Yi Zhang, Pingwei Xu, Junwei Chen, Yeh-Chuin Poh, Ke Tang, Ning Wang*, Bo Huang* $ These authors contributed equally. *Correspondence should be addressed to: Ning Wang (nwangrw@illinois.edu) or Bo Huang (tjhuangbo@hotmail.com) List of Contents 1. Additional methods (page 2-5) 2. Table S1 and S2, Figure S1-S22 with legends (page 6-29) NATURE MATERIALS 1
2 1. Additional methods Conventional 2D rigid dish and 3D fibrin gel cell culture of tumour cells Before seeded into 3D fibrin gels, B16-F1 cells were maintained in the standard culture conditions as mentioned above. After 0.25% trypsin treatment (Sigma-Aldrich, St. Louis, MO), cells were detached and suspended in MEM (10% FBS) and cell density was adjusted to 10 4 cells/ml. Fibrinogen was diluted into 2 mg/ml with T7 buffer (ph 7.4, 50 mm Tris, 150 mm NaCl). 1:1 fibrinogen and cell solution mixture was made by mixing the same volume of the fibrinogen solution and the cell solution, resulting in 1 mg/ml fibrinogen and 5000 cells/ml in the mixture. 250 µl cell/fibrinogen mixtures was seeded into each well of 24 well-plate and mixed well with pre-added 5 µl thrombin (0.1 U/µl). The cell culture plate was then moved into 37 C cell culture incubator and incubated for 10 min. Finally, 1 ml MEM medium containing 10% FBS and antibiotics were added. Similar procedures were applied to EL4, H22 cells, HepG2, A2780 and P815 cells, which were cultured in RPMI-1640 cell culture medium (Invitrogen) with 10% FBS. 2D fibrin gels were prepared following the same protocol of 3D fibrin gels but without premixing cells with fibrinogen solution. After the gels were polymerized, B16-F1 cells were seeded on top of fibrin gels. α v β 3 blocking antibody crgdfv (Enzo Life Sciences), β 1 blocking antibody (Abcam Inc), ROCK inhibitor Y (Calbiochem) were purchased. All drugs were pre-diluted in normal culture medium to the indicated concentrations and then used for cell treatment. Different concentrations of doxorubicin or cisplatin were added to the B16-F1 cell culture medium during the last 18 hours of 5-day culture in 90-Pa 3D fibrin gels or conventional 2D rigid dish. Cells were collected and stained with FITC conjugated Annexin-V for apoptotic detection by flow cytometry. The result presented was the apoptosis% calculated by Annexin V positive cell number divided by total cell number. To determine if the data in Fig. 3e is due to poor accessibility to the drug for the cells in the 3D fibrin gels, we added the same concentration of doxorubicin to the culture media of 3D fibrin gels and 2D rigid plastic. We harvested cells at different time points (4th and 8th hour) and analyzed the cells by flow cytometry, and found the similar mean fluorescent intensity (doxorubicin exhibits red fluorescence) and positive cell ratio between two groups, suggesting that the drug entered a similar number of cells both in 3D fibrin gels and on 2D surface. Therefore what we found is not due to limitation of drug accessibility in the 3D fibrin gels. The fresh breast cancer tissue removed from patients was digested with collagenase and hyaluronidase for 1 h. After grinding with semi-frosted slides and lysis of RBC, the dissociated cells were incubated on ice for 20 min and then spun down at 500 rpm for 1 min. This process was repeated twice and the cells were first incubated for 2 h to get rid of adhesive cells (e.g., macrophages; within 2 hr, tumour cells could not adhere to the plate) and then used as the primary breast cancer cells. Peripheral blood cells of leukemic patients were collected and separated by the Ficoll gradient centrifugation. The obtained peripheral blood mononuclear cells were used for T- leukemic cell purification by negative magnetic sorting with biotinylated anti-human CD14, CD16, CD19, CD36, CD56, CD123 and CD235a antibodies (Pan T-Cell Isolation Kit II, 2 NATURE MATERIALS
3 SUPPLEMENTARY INFORMATION Miltenyi Biotec, Bergisch Gladbach, Germany). Isolated primary T-leukemic cells were cultured in 3D fibrin gels (90-Pa). Serial transplantation assay We subcutaneously injected 100 B16 cells derived from 3D soft fibrin gels (90-Pa) to C57BL/6 mice. After tumour formation (5x5 mm in size), we isolated B16 cells from the tumours and injected 10 5 isolated cells to naïve C57BL/6 mice. After 10 days, the tumour formation was observed in all mice (n=6). Similarly, tumour cells were isolated again and injected into 6 mice at 10 5 cells. All mice (n=6) formed tumours. Cell proliferation assay BrdU assay was used to quantify proliferating B16 cells cultured within 3D fibrin gels. Briefly, we added 10 µm BrdU (BD Biosciences) 17 hr before Day 5 and the cells were fixed 17 hr later, treated, and stained, following manufacturer s instruction. Then, 10 µg/ml propidium iodide was incubated with cells for 1 hr at room temperature. The proliferating cell number was quantified for each round colony at the equatorial plane of the spheroid. Apoptosis assay Propidium iodide (PI) was used to label apoptotic cells cultured in 3D fibrin gels with different stiffness from Day 1 to Day 5. Briefly, the cells cultured in 3D fibrin gels were rinsed with prewarmed PBS and then incubated with 10 µg/ml PI (pre-diluted in normal culture medium) for 1 h. The PI-positive (apoptotic) cells were counted under a fluorescence microscope. Cytoskeleton staining B16-F1 cell spheroids maintained in 3-D fibrin gel were used for F-actin staining. At Day 5, multicellular B16-F1 tumour spheroids were pipetted into single cells, seeded onto glassbottomed 35-mm dishes pre-coated with collagen-1 (200 g/ml), and cultured for 6 h at 37 C and5% CO 2. The cells were washed three times with PBS, and fixed with 3.7% paraformaldehyde at room temperature for 10 min and permeabilized with 0.1% Triton X-100 in PBS for 5 min. F-actin staining of cells was performed by incubating cells with 50 µg/ml TRITC-labeled phalloidin (Sigma-Aldrich) in PBS for 20 min at room temperature. For nuclear imaging, cells were then re-stained with 1 µg/ml Hoechst for 10 min. RT-PCR and real-time PCR analysis The primers were designed with the Oligo Primer Analysis 4.0 software, and the sequences were blasted ( Total RNA (100 ng) was used for reverse transcription using Superscript II RNase H reverse transcriptase (Invitrogen) in a volume of 20 μl. Then, 1 μl of cdna was amplified with FastStart Universal SYBR Green Master (Rox) (Roche, Indianapolis, IN) in duplicate. Histologic evaluation and Immunohistochemistry The 4% paraformaldehyde fixed BALB/c mice lung tissues were embedded in paraffin and cut to 6-µm thick sections by Leica RM2016 Machine. Tissue-sections were stained by Hematoxylin NATURE MATERIALS 3
4 and Eosin (H&E) and slides were evaluated for inflammation and tumour formation by a veterinary pathologist blinded to sample identity. Immunohistochemistry detecting fibrinogen (1:500; DAKO, Glostrup, Denmark) was performed on paraffin-embedded sections using the Vectastain ABC kit for rabbit primary antibodies (Vector Labs, Burlingame, CA), following manufacturer s instructions. EGF (epidermal growth factor) and AKT1/2 kinase inhibitor were purchased from Sigma-Aldrich; anti-phosphorylated AKT1/2 antibody was obtained from Millipore. Quantification of cell stiffness The complex stiffness was defined as G* = /d, where d was the peak amplitude of the bead displacement. To increase the signal to noise ratio, d was averaged over 5 consecutive cycles. The measured stiffness has the unit of Pa/nm. The magnetic bead was embedded ~50% into the cell surface. A finite element model was used to convert cell stiffness (Pa/nm) to shear modulus (Pa) 1. Since cell stiffness is defined as the ratio of applied stress to cell deformation (cell shape change or cell strain) and cell deformability is defined as the degree of cell deformation (or the degree of cell shape change) under a given level of applied stress, cell stiffness is the inverse of cell deformation or cell deformability. Transfection assay Sox2, c-kit, nestin, and Bmi-1 sirnas and the corresponding scrambled control oligonucleotides were purchased from RiboBio Corporation (Guangzhou, China). Briefly, 100 nm sirna each was transfected to the cells cultured in 24-well plate by Lipofectamine 2000 (Invitrogen), according to instructions provided by the manufacturer. Assay of tumour cell arrest in lung B16-F1 cells were cultured on rigid plastic or in 3D soft fibrin gels (90 Pa) for 5 days. They were then labeled with CFSE and injected into mice ( per mouse) via tail vein. Lungs were surgically excised from mice 4 h, 12 h and 24 h after the injection. Frozen sections were prepared and analyzed by fluorescence microscopy. Fluorescent spots, which represented single cells, were counted from 20 randomly chosen viewing fields in the sections of each mouse. Traction measurement In brief, red fluorescent beads (0.2 µm in diameter) were embedded into the apical surface of gels. Images of these beads under a cell were taken before and after trypsinization. Based on an established method of traction force computation, the displacements of the beads were recorded, from which the traction field was then computed with the known gel modulus 2. The substrate stiffness of the gel was varied by altering bis-acrylamide crosslinker concentrations (0.04, 0.06, 0.3%) and polyacrylamide concentration (3%, 3%, 5%) and the corresponding stiffnesses are 0.15, 0.6, and 8.0 kpa respectively using published protocols 2,3. Cell transmigration assays 4 NATURE MATERIALS
5 SUPPLEMENTARY INFORMATION The cell transmembrane migration assay has been described in detail previously 4. 8-µm-pore transwell migration chambers were purchased from Costar. The membranes were pre-coated at room temperature for 1 hour with rat collagen-i (66 g/ml) (Sigma). 5% FBS-MEM was added in the lower chamber as a chemoattractant. Cells (1.5x 10 4 per well) were added to the upper chambers in serum-free medium. Cell migration was allowed to proceed for 3, 6 or 9 hours at 37 in CO 2 incubator. Cells then were washed with PBS and fixed in methanol. The cells from the upper surface were removed with a cotton swab. Cells that migrated to the lower surface were stained with crystal violet and counted. At least 10 random viewfields were counted for each experimental condition. Curve fitting The data in Fig. 1 (c) and (d) were fitted by the 3 rd order polynomial functions (f(x) = Ax 3 +Bx 2 +Cx+D). The parameters of the fitting curves (A, B, C, and D) are ( , , and ), (-5.787, , and ), and ( , 9.504, and ) in (c); and (3954.5, , and ), (1888.1, , and ), and (780.47, , and ) in (d) for 90-Pa, 420-Pa and 1050-Pa fibrin gels, respectively. A two-tailed Student s t-test was used for all statistics. References 1. Mijailovich, S.M., Kojic, M., Zivkovic, M., Fabry, B. & Fredberg J.J. A finite element model of cell deformation during magnetic bead twisting. J. Appl. Physiol. 93, (2002). 2. Chowdhury, F. et al. Material properties of the cell dictate stress-induced spreading and differentiation in embryonic stem cells. Nat. Mater. 9, (2010). 3. Poh, Y.C., Chowdhury, F., Tanaka, T.S. & Wang. N. Embryonic stem cells do not stiffen on rigid substrates. Biophys. J. 99, L01-L03 (2010). 4. Senger, D.R. et al. The alpha(1)beta(1) and alpha(2)beta(1) integrins provide critical support for vascular endothelial growth factor signaling, endothelial cell migration, and tumor angiogenesis. Am J Pathol. 160, (2002). NATURE MATERIALS 5
6 Table S1 Tumourigenicity of H22 and A2780 cell spheroids in different mouse models i.m.: intramuscular injection; i.p.: intraperitoneal injection. 6 NATURE MATERIALS
7 SUPPLEMENTARY INFORMATION Table S2 Primer sequences used for RT-PCR and real-time PCR analysis of B16-F1 cells NATURE MATERIALS 7
8 Fig. S1. Apoptotic colonies increase with stiffness of fibrin gels and with culture time single cells were cultured within the 3D fibrin gels and propidium iodide was used to stain the apoptotic cells from Day 1 to Day 5. Apoptotic colonies as % of total colonies (round and nonround) were plotted. The increase from Day 2 to Day 5 in apoptotic colonies (%) for 90-Pa gels could be due to additional apoptosis of non-round colonies. Mean+s.e.m.; n=6 dishes from 3 independent experiments. From Day 1 to Day 5, p=0.0003, 0.015, 0.007, 0.003, and between 90-Pa and 420-Pa gels; p=0.0003, 0.004, 0.002, , and between 90-Pa and 1050-Pa gels. There are no significant differences between 420-Pa and 1050-Pa gels (p>0.55) except at Day 2 (p<0.016). 8 NATURE MATERIALS
9 SUPPLEMENTARY INFORMATION Fig. S2. B16 cells proliferate better in softer fibrin gels than in stiffer ones. B16 cells were cultured within fibrin gels with different stiffness (90, 420, or 1050 Pa). (a) Representative images of B16 spheroids (top left panels, bright field images) in different fibrin gels were stained with anti-brdu antibody (top right panels; Brdu, green) and propidium iodide (bottom left panels; Nuc, red). Brdu was added 17 hr before Day 5 to quantitate cells that went through DNA synthesis. Bottom right panels were merged images of Brdu and Nuc. (b) Quantification of proliferating cells in one colony per focal plane. Mean+s.e.m.; n=3 independent experiments; ***p< NATURE MATERIALS 9
10 Fig. S3. Cell viability of 3D fibrin gel cultured B16 spheroid cells. (a) Trypan blue staining of 3D B16-F1 spheroid cells. B16-F1 spheroids were picked out from soft 3D fibrin gel and cell suspension was stained with 0.4% trypan blue. (b) Annexin V staining of 3D B16-F1 spheroid cells for apoptosis assay and analyzed by flow cytometry. Rigid B16-F1: control cells plated on rigid plastic dishes. 3D B16-F1: cells cultured within 90-Pa 3D fibrin gels. Positive Cont.: cells treated with cisplatin (100 M for 20 h, a known apoptosis-inducing drug). The results shown were a representative of three independent experiments. 10 NATURE MATERIALS
11 SUPPLEMENTARY INFORMATION Fig. S4. Serial passages from 3D soft fibrin gels elevate colony number. B16-F1 cells were seeded within 90-Pa (a) or 420-Pa (b) fibrin gels. 1 st generation: cells were cultured up to Day 5 and colony numbers were counted from Day 1 to Day 5. 2 nd generation: the cells from 1 st generation were cultured for another 5 days. 3 rd generation: the cells from 2 nd generation were cultured for another 5 days. For (a), between 2 nd and1 st generation, p<0.02 at Day 2-5 except at Day 1 where p>0.45. Between 3 rd and 1 st generation, p<0.025 at Day 1-5. Between 3 rd and 2 st generation, p<0.05 at Day 1-5. For (b), between 2 nd and 1 st generation, p< at Day 1-5. Between 3 rd and 1 st generation, all p< Between 3 rd and 2 st generation, p<0.03 at Day 1, 2, 4, or 5 except at Day 3 where p>0.19. Data are averaged from two independent experiments. Mean+s.e.m. NATURE MATERIALS 11
12 Fig. S5. Colony size increases more with passage number in softer 3D fibrin gels. Colony sizes are counted for the cells in 90-Pa (a) or 420-Pa (b) fibrin gels. Note that the cells were only grown up to Day 5, not Day 6 as in Fig. 1d. For (a), all p-values (see Fig. S4 for different comparison groups) are less than 0.03 except between 3 rd and 2 st generation at Day 4 and Day 5, where p>0.8. For (b), all p-values are less than except between 3 rd and 1 st generation at Day 3 and Day 4 where p>0.06. n>40 colonies were counted for each time point. 12 NATURE MATERIALS
13 SUPPLEMENTARY INFORMATION Fig. S6. B16-F1 cells grow better in 3D soft fibrin gels than in 3D soft collagen gels. Representative images of B16-F1 tumour spheroid are shown after different days in culture in 3D collagen-1 gels or fibrin gels. Collagen-1 gels: 0.6 mg/ml = 94 Pa; 1 mg/ml =160 Pa. Fibrin gel: 1 mg/ml = 90 Pa. Note that the multicellular tumour spheroid is much bigger in the fibrin gel than in collagen-1 gels at Day 5 (scale bars are different). NATURE MATERIALS 13
14 Fig. S7. 3D soft fibrin gels are better than 3D soft collagen gels in growth of tumour spheroids. Quantitation of tumour spheroid size grown in 3D fibrin gels or in 3D collagen gels as a function of culture time shows that the colony sizes in 3D collagen gels are much smaller than in 3D fibrin gels, suggesting 3D fibrin gels are better at promoting cell proliferation. 14 NATURE MATERIALS
15 SUPPLEMENTARY INFORMATION Fig. S8. 3D soft fibrin gels promote formation of tumour spheroids from various mouse and human cancer cell lines and human primary cancer cells. Images are multicellular tumour spheroids formed by A2780, EL4, H22, HepG2, and P815 cells in 3D soft fibrin gel at Day 6, respectively; primary cancer cells from a human breast cancer patient and from a leukemia patient formed smaller tumour spheroids at Day 10 in 3D soft fibrin gels (90-Pa). All cell images were captured under 10 objective lens of Leica optical microscope. NATURE MATERIALS 15
16 Fig. S9. B16-F1 cells grow better within 3D fibrin gels than on 2D fibrin gels. (a) Round colony number as a function of culture time. p<0.0002, 0.005, between 90-Pa 3D and 2D gels at Day 1, 2, and 3, respectively; no significant differences at Day 4 and Day 5 (p>0.12). All p< between 420-Pa 3D and 2D gels. There are no significant differences (p>0.05) between 1050-Pa 3D and 2D gels except at Day 3 (p<0.022). (b) Size of round colonies as a function of culture time. B16 colony sizes are larger in 3D fibrin gels than on 2D fibrin gels at Day 4 (all p<0.018) and Day 5 (all p< ) between 90-Pa 3D and 2D gels, between 420-Pa 3D and 2D gels, and between 1050-Pa 3D and 2D gels. Mean+s.e.m.; n=6 independent experiments for 3D fibrin gels and n=3 independent experiments for 2D fibrin gels. Note that for more accurate comparison, colony projected area rather than colony volume is presented in (b). Note that on 2D gels, the colony area reached a plateau between Day 4 and Day 5, whereas within 3D gels, it continued to increase. Therefore, the difference in colony size cannot be explained by the presence of fibrin polymers inside each colony in 3D gels. 16 NATURE MATERIALS
17 SUPPLEMENTARY INFORMATION Fig. S10. B16-F1 cells form small colonies on 2D soft collagen-coated polyacrylamide gels. B16-F1 cells were seeded onto both soft (0.15 kpa; left image) and stiff 2D (8 kpa; middle image) type-1 collagen-coated polyacrylamide gels, respectively, for 5 days. Cells cultured on collagen- 1 coated rigid glass dish (right image) were controls. It appears that B16-F1 spread on stiff or rigid substrates, but stay round and form small colonies on 2D soft substrates. NATURE MATERIALS 17
18 Fig. S11. Cells from 3D soft fibrin gels survive better in the lung than control cancer cells. B16-F1 cells cultured in 3D soft fibrin gels (triangles) or on the rigid plastic (squares) were labeled with CFSE and labeled cells were injected into mice via tail vein. The arrest of B16 cell in the lungs was analyzed by counting fluorescent spots in the sections prepared from mice (n=3) at different time points after tumour cell injection. *, p< NATURE MATERIALS
19 SUPPLEMENTARY INFORMATION Fig. S12. Cells from 3D soft fibrin gels but not from rigid plastic express Sox2. (a) 10 5 B16- F1 cells cultured in 3D soft fibrin gels (3D; 90-Pa) or on rigid plastic (Contr) were used for total RNA isolation. The expressions of c-myc, Rex-1, and Sox2 were analyzed by RT-PCR. The first round PCR (1 st ) product was used as the DNA template for the second round PCR (2 nd ). Note that after 2nd round PCR, Sox2 is still un-detectable in Contr but amplified in 3D, suggesting that Sox2 was only expressed in cells cultured from 3D soft fibrin gels. Similar results were observed from 3 independent experiments. (b) Self-renewal marker Sox2 of B16-F1 cells was quantified by real-time PCR. Same mrna sample of B16-F1 tumour spheroid cells was used as above. 3D B16F1: 90-Pa soft 3D fibrin gels; Control B16F1: 2D rigid plastic dishes. Mean ± s.e.m.; n=6 samples for each condition from 2 independent experiments. **p <0.0073, compared with control cells. NATURE MATERIALS 19
20 Fig. S13. Knocking down Sox2, c-kit, Nestin, or Bmi-1 in B16-F1 spheroids on 2D soft fibrin gels promotes colony spreading. B16-F1 cells were seeded onto 2D soft fibrin gels (90- Pa) in 24-well plates and cultured for 3 days. Sox2, c-kit, Nestin or Bmi-1 sirna and the corresponding scrambled control oligonucleotides (all images of minus signs) were transfected to the cells. The colonies were imaged at different time points post sirna (left, middle, and right columns are before sirna transfection, 24 hr post-transfection, and 48 hr post-transfection, respectively). It appears that sirna transfection leads to spreading of cells from the spheroids, suggesting inhibition of self-renewal and onset of differentiation of these cells. (a), The images shown were representatives in each group. (b), The circularity of colonies was calculated using the formula of 4 [area]/[perimeter] 2. A perfect circle has a value of 1.0. Mean+s.e.m.; n=20 randomly chosen colonies per condition from 3 independent experiments; diamond represents controls, square represents those treated with sirna. *, p<0.05; **, p< NATURE MATERIALS
21 SUPPLEMENTARY INFORMATION Fig. S14. Cells from 3D soft fibrin gels are more resistant to apoptosis induced by cisplatin than those from the rigid plastic. B16-F1 cells were cultured in 3D soft fibrin gels (90 Pa) or on the rigid plastic. Different concentrations of cisplatin were added to the B16-F1 cell culture medium during the last 18 hr of 5-day culture. Cells were collected and stained with FITC conjugated Annexin-V for apoptotic detection by flow cytometry. Mean ± s.e.m., n=3 independent experiments; *p <0.05, compared with control cells. NATURE MATERIALS 21
22 Fig. S15. Similar F-actin distribution of 3D fibrin gel cultured B16-F1 cells as control cancer cells. Six hours after re-plating B16-F1 cells (cultured for 5 days in soft 3D fibrin gel or on rigid dish) on the dish pre-coated with collagen-1, F-actin of the cells was stained by TRITClabeled phalloidine. Nucleus was stained with Hoechst NATURE MATERIALS
23 SUPPLEMENTARY INFORMATION Fig. S16. No differences in expressions of integrins between 3D fibrin gel-cultured and control B16-F1 cells B16-F1 cells cultured in 3D soft fibrin gels or on the rigid plastic were used for total RNA isolation. The expressions of α v, β 3, α 5 and, β 1 integrin genes were analyzed by RT-PCR. No apparent differences were observed between the two culture conditions. Similar results were obtained in 3 independent experiments. NATURE MATERIALS 23
24 Fig. S17. B16-F1 cells form and grow spheroid colonies via v 3 integrins in 3D fibrin gels. Blocking α v β 3, but not β 1 integrin, with specific antibody inhibited spheroid colony formation and growth within 90-Pa fibrin gels. (a) Colony number as a function of culture time from Day 1 to Day 5 when treated with α v β 3 or β 1 blocking antibodies. No significant differences are observed between Control and Ab-β 1 (p>0.40 for all days), or between Control and 1 µg/ml Abα v β 3 (p>0.20 for all days except Day 4 where p<0.04), or between Control and 20 µg/ml Ab-α v β 3 at Day 1 and at Day 5 (p>0.1), or between Control and 100 µg/ml Ab-α v β 3 at Day 1 (p>0.07).. There are significant differences between Control and 20 µg/ml Ab-α v β 3 at Day 2, 3, and 4 (all p<0.043), between Control and 100 µg/ml Ab-α v β 3 at Day 2 through Day 5 (all p<0.01). (b) Colony size as a function of culture time. There are no significant differences between Control and 100 µg/ml Ab-β 1 or between Control and 1 µg/ml ab-α v β 3 (all p>0.05). There are significant differences between Control and 20 (or 100) µg/ml ab-α v β 3 (all p<0.001 except at Day 1 for 20 µg/ml ab-α v β 3 ). Mean+s.e.m.; n=3 independent experiments. 24 NATURE MATERIALS
25 SUPPLEMENTARY INFORMATION Fig. S18. RhoA-mediated cell contractility is associated with round colony formation and growth within 3D fibrin gels. Formation and growth of round colonies in 3D (a, b) and on 2D fibrin gels (c, d) were inhibited by Y-27632, a ROCK inhibitor in a dose-dependent manner. In (a), there are significant differences between control and 5, or 25, or 50 µm Y from Day 1 through Day 5 (all p<0.04). In (b), there are significant differences between control and 5, or 25, or 50 µm Y at Day 1 (all p<0.023), at Day 2 (all p<0.0044), Day 3 (p< except 5 µm, where p>0.25), Day 4 (p< except 5 µm, where p>0.11), Day 5 (all p<0.0012). In (c), there are significant differences between Control and 5, or 25, or 50 µm Y (all p<0.05 except at Day 1 for 25 µm). In (d), there are significant differences between Control and 5, or 25, or 50 µm Y (all p<0.01). Mean+s.e.m.; n=3 independent experiments. NATURE MATERIALS 25
26 Fig. S19. Similar transmigration rates for soft 3D fibrin gel cultured cells and control B16- F1 cells. In vitro transwell assays were performed and cell transmigration rates were compared between the cells isolated from tumour spheroids cultured in soft 3D fibrin gels for 5 days and control B16-F1 cells. 15,000 cells per well were seeded on the upper chamber of the transwell membrane and cell numbers were counted 3, 6, or 9 hr after 5% serum (chemotactic factors) was added to the lower chamber. The membranes were pre-coated with collagen-1. There were no significant differences between 3D cells and control cells (p>0.72, 0.19, 0.34 for 3, 6, or 9 hr). Mean+s.e.m.; n=3 independent experiments. 26 NATURE MATERIALS
27 SUPPLEMENTARY INFORMATION Fig. S20. Fibrin/Fibrinogen is present in the stroma of B16-F1 melanoma. B16-F1 cells from the rigid plastic were inoculated at 10 5 per mouse subcutaneously to C57BL/6 mice. After tumour formation, tumour tissues were collected for immunohistochemical staining to detect the expression of fibrin/fibrinogen (brown color represents positive tissues for fibrin/fibrinogen). Tissues from two different mice (Melanoma #1, #2) were presented. Control: the isotype IgG. Fibrin Ab: antibodies against fibrin/fibrinogen. NATURE MATERIALS 27
28 Fig. S21. AKT is constitutively active in cells from 3D soft fibrin gels. B16-F1 cells were cultured on rigid plastic, in 3D soft fibrin gels (90 Pa), or in 3D soft collagen gels (94 Pa). On Day 5, 20 ng/ml EGF was added to the culture media for 20 min. Single cell suspensions were collected from these different culture conditions, stained with Alexa Fluor 488-conjugated antiphosphorylated AKT1/2 antibody, and analyzed by flow cytometry. (a) Representatives of FACS profiles. (b) Mean Fluorescence Intensity (MFI) from three independent experiments (Mean+s.e.m.). 28 NATURE MATERIALS
29 SUPPLEMENTARY INFORMATION Fig. S22. AKT inhibition leads to decreases in spheroid growth. B16-F1 cells were cultured in 3D soft fibrin gels (90 Pa). Two days later, cells were treated with the selective AKT1/2 inhibitor (A6730 at 1 µm or 10µM). Cells treated with PBS were used as control. The spheroids were imaged on Day 5 (all images were taken at 4x objective). (a) Representative images of the colonies. (b) The average colony projected area from 3 independent experiments (Mean+s.e.m.; n=20 randomly chosen colonies per condition; control (Con) colony areas were set to 1.0). NATURE MATERIALS 29
Supplementary Figure 1. Expressions of stem cell markers decreased in TRCs on 2D plastic. TRCs were cultured on plastic for 1, 3, 5, or 7 days,
Supplementary Figure 1. Expressions of stem cell markers decreased in TRCs on 2D plastic. TRCs were cultured on plastic for 1, 3, 5, or 7 days, respectively, and their mrnas were quantified by real time
More informationSupplementary Figure 1. Soft fibrin gels promote growth and organized mesodermal differentiation. Representative images of single OGTR1 ESCs cultured
Supplementary Figure 1. Soft fibrin gels promote growth and organized mesodermal differentiation. Representative images of single OGTR1 ESCs cultured in 90-Pa 3D fibrin gels for 5 days in the presence
More informationB. ADM: C. D. Apoptosis: 1.68% 2.99% 1.31% Figure.S1,Li et al. number. invaded cells. HuH7 BxPC-3 DLD-1.
A. - Figure.S1,Li et al. B. : - + - + - + E-cadherin CK19 α-sma vimentin β -actin C. D. Apoptosis: 1.68% 2.99% 1.31% - : - + - + - + Apoptosis: 48.33% 45.32% 44.59% E. invaded cells number 400 300 200
More informationFlow cytometric determination of apoptosis by annexin V/propidium iodide double staining.
Supplementary materials and methods Flow cytometric determination of apoptosis by annexin V/propidium iodide double staining. Cells were analyzed for phosphatidylserine exposure by an annexin-v FITC/propidium
More informationSupplementary Data. Supplementary Methods Three-step protocol for spontaneous differentiation of mouse induced pluripotent stem (embryonic stem) cells
Supplementary Data Supplementary Methods Three-step protocol for spontaneous differentiation of mouse induced pluripotent stem (embryonic stem) cells Mouse induced pluripotent stem cells (ipscs) were cultured
More informationSupplementary Figure 1. IFN-γ induces TRC dormancy. a, IFN-γ induced dormancy
Supplementary Figure 1. IFN-γ induces TRC dormancy. a, IFN-γ induced dormancy of various tumor type TRCs, including H22 (murine hepatocarcinoma) and CT26 (murine colon cancer). Bar, 50 µm. b, B16 cells
More informationSupplementary Figure 1. Co-localization of GLUT1 and DNAL4 in BeWo cells cultured
Supplementary Figure 1. Co-localization of GLUT1 and DNAL4 in BeWo cells cultured under static conditions. Cells were seeded in the chamber area of the device and cultured overnight without medium perfusion.
More informationIsolation, culture, and transfection of primary mammary epithelial organoids
Supplementary Experimental Procedures Isolation, culture, and transfection of primary mammary epithelial organoids Primary mammary epithelial organoids were prepared from 8-week-old CD1 mice (Charles River)
More informationConfocal immunofluorescence microscopy
Confocal immunofluorescence microscopy HL-6 and cells were cultured and cytospun onto glass slides. The cells were double immunofluorescence stained for Mt NPM1 and fibrillarin (nucleolar marker). Briefly,
More informationWe performed RT-PCR, cloning, sequencing and qrt-pcr in murine melanoma. cell lines and melanocytic tumors from RET-mice in accordance with the method
Supplementary Material and Methods Quantitative RT-PCR (qrt-pcr) We performed RT-PCR, cloning, sequencing and qrt-pcr in murine melanoma cell lines and melanocytic tumors from RET-mice in accordance with
More informationSANTA CRUZ BIOTECHNOLOGY, INC.
TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same
More informationFlow cytometry Stained cells were analyzed and sorted by SORP FACS Aria (BD Biosciences).
Mice C57BL/6-Ly5.1 or -Ly5.2 congenic mice were used for LSK transduction and competitive repopulation assays. Animal care was in accordance with the guidelines of Keio University for animal and recombinant
More informationTherapeutic angiogenesis via solar cell facilitated electrical
Supporting information Therapeutic angiogenesis via solar cell facilitated electrical stimulation Gun-Jae Jeong 1,, Jin Young Oh 2,, Yeon-Ju Kim 3,, Suk Ho Bhang 4, Hyeon-Ki Jang 5, Jin Han 1, Jeong-Kee
More informationIKK is a therapeutic target in KRAS-induced lung cancer with disrupted p53 activity
IKK is a therapeutic target in KRAS-induced lung cancer with disrupted p5 activity H6 5 5 H58 A59 H6 H58 A59 anti-ikkα anti-ikkβ anti-panras anti-gapdh anti-ikkα anti-ikkβ anti-panras anti-gapdh anti-ikkα
More informationSupporting Information
Supporting Information Chakrabarty et al. 10.1073/pnas.1018001108 SI Materials and Methods Cell Lines. All cell lines were purchased from the American Type Culture Collection. Media and FBS were purchased
More informationCD93 and dystroglycan cooperation in human endothelial cell adhesion and migration
/, Supplementary Advance Publications Materials 2016 CD93 and dystroglycan cooperation in human endothelial cell adhesion and migration Supplementary Materials Supplementary Figure S1: In ECs CD93 silencing
More informationSupplementary Figure 1 A green: cytokeratin 8
Supplementary Figure 1 A green: cytokeratin 8 green: α-sma red: α-sma blue: DAPI blue: DAPI Panc-1 Panc-1 Panc-1+hPSC Panc-1+hPSC monoculture coculture B Suppl. Figure 1: A, Immunofluorescence staining
More informationMeasurement of peritoneal macrophage apoptosis by Celigo plate imaging cytometer
SUPPLEMENTAL METHODS Measurement of peritoneal macrophage apoptosis by Celigo plate imaging cytometer For Celigo experiments, 0.1 ml containing 5 x 10 4 cells was seeded into 96 well plates for 30 min
More informationab Propidium Iodide Flow Cytometry Kit for Cell Cycle Analysis
ab139418 Propidium Iodide Flow Cytometry Kit for Cell Cycle Analysis Instructions for Use To determine cell cycle status in tissue culture cell lines by measuring DNA content using a flow cytometer. This
More informationab Propidium Iodide Flow Cytometry Kit for Cell Cycle Analysis
ab139418 Propidium Iodide Flow Cytometry Kit for Cell Cycle Analysis Instructions for Use To determine cell cycle status in tissue culture cell lines by measuring DNA content using a flow cytometer. This
More informationSupplementary Information (Ha, et. al) Supplementary Figures Supplementary Fig. S1
Supplementary Information (Ha, et. al) Supplementary Figures Supplementary Fig. S1 a His-ORMDL3 ~ 17 His-ORMDL3 GST-ORMDL3 - + - + IPTG GST-ORMDL3 ~ b Integrated Density (ORMDL3/ -actin) 0.4 0.3 0.2 0.1
More informationsupplementary information
DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /
More informationCytotoxicity of Botulinum Neurotoxins Reveals a Direct Role of
Supplementary Information Cytotoxicity of Botulinum Neurotoxins Reveals a Direct Role of Syntaxin 1 and SNAP-25 in Neuron Survival Lisheng Peng, Huisheng Liu, Hongyu Ruan, William H. Tepp, William H. Stoothoff,
More informationFor in vitro killing assays with lysed cells, neutrophils were sonicated using a 550 Sonic
Supplemental Information Cell Host & Microbe, Volume 8 Statins Enhance Formation of Phagocyte Extracellular Traps Ohn A. Chow, Maren von Köckritz-Blickwede, A. Taylor Bright, Mary E. Hensler, Annelies
More informationSupplementary Information: Materials and Methods. Immunoblot and immunoprecipitation. Cells were washed in phosphate buffered
Supplementary Information: Materials and Methods Immunoblot and immunoprecipitation. Cells were washed in phosphate buffered saline (PBS) and lysed in TNN lysis buffer (50mM Tris at ph 8.0, 120mM NaCl
More informationApoptosis And Anti-tumor Effect Induced By Mtor Inhibitor And Autophagy Inhibitor In Human Osteosarcoma Cells
Apoptosis And Anti-tumor Effect Induced By Mtor Inhibitor And Autophagy Inhibitor In Human Osteosarcoma Cells Ryosuke Horie. Kagawa University of medecine, Kita-gun, Japan. Disclosures: R. Horie: None.
More informationSupporting Information
Supporting Information Su et al. 10.1073/pnas.1211604110 SI Materials and Methods Cell Culture and Plasmids. Tera-1 and Tera-2 cells (ATCC: HTB- 105/106) were maintained in McCoy s 5A medium with 15% FBS
More informationSegments of the obstructed intestinal loops were fixed in 4% paraformaldehyde
Supplementary text Supplementary materials and methods Histopathological examination Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde (PFA) and embedded in paraffin wax with
More informationFor Western blot analyses, cells were lysed in RIPA buffer (50 mm Tris-HCl ph 7.2,
Western blot assay For Western blot analyses, cells were lysed in RIPA buffer (50 mm Tris-HCl ph 7.2, 150 mm NaCl, 1% NP40, 0.1% SDS, 0.5% DOC, 1 mm PMSF, 25 mm MgCl 2, and supplemented with a phosphatase
More informationSupplemental data. Supplemental Materials and Methods
Supplemental data Supplemental Materials and Methods Transfection of plasmid. Transfection of plasmids into FRTL5 cells was performed using Lipofectamine LTX with Plus reagent (Invitrogen) according to
More informationSupplementary Figure Legend
Supplementary Figure Legend Supplementary Figure S1. Effects of MMP-1 silencing on HEp3-hi/diss cell proliferation in 2D and 3D culture conditions. (A) Downregulation of MMP-1 expression in HEp3-hi/diss
More informationSupplementary Methods
Supplementary Methods Antibodies Rabbit polyclonal VEGFR-1, VEGFR-2, Angiopoietin-1, Angiopoietin- 2 and GAPDH specific antibodies were from Santa Cruz Biotechnology. Rabbit polyclonal Akt1, Akt2, ps473
More informationFigure S Relative MUC4 transcript level* CD18/HPAF CD18/HPAF-Scr CD18/HPAF-siMUC4
Figure S1 Relative MUC4 transcript level* 1.4 1.2 1 0.8 0.6 0.4 0.2 0 CD18/HPAF CD18/HPAF-Scr CD18/HPAF-siMUC4 Figure S2 * * CD18/HPAF-Scr CD18/HPAF-siMUC4 CD18/HPAF-Scr CD18/HPAF-siMUC4 Figure S3 CD18/HPAF-Scr
More informationReagents and cell culture Mcl-1 gene expression: real-time quantitative RT-PCR In vitro PP2A phosphatase assay Detection of Mcl-1 in vivo
Reagents and cell culture Antibodies specific for caspase 3, PARP and GAPDH were purchased from Cell Signaling Technology Inc. (Beverly, MA). Caspase inhibitor z-vad-fmk and ROS scavenger N-acetyl-Lcysteine
More informationab BrdU Immunohistochemistry Kit
ab125306 - BrdU Immunohistochemistry Kit Instructions for Use For the detection and localization of bromodeoxyuridine incorporated into newly synthesized DNA of actively proliferating cells. This product
More information0.5% Triton X-100 for 5 min at room temperature. Fixed and permeabilized cells were
1 Supplementary Methods Immunohistochemistry EBC-1 cells were fixed in 4% paraformaldehyde for 15 min at room temperature, followed by 0.5% Triton X-100 for 5 min at room temperature. Fixed and permeabilized
More informationThe measurement of telomere length was performed by the same method as in the previous study (11).
1 SUPPLEMENTAL DATA 2 3 METHODS 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 Telomere length measurement by quantitative real-time PCR (q-pcr) The measurement of telomere length was performed
More informationRNA was isolated using NucleoSpin RNA II (Macherey-Nagel, Bethlehem, PA) according to the
Supplementary Methods RT-PCR and real-time PCR analysis RNA was isolated using NucleoSpin RNA II (Macherey-Nagel, Bethlehem, PA) according to the manufacturer s protocol and quantified by measuring the
More informationSupplemental Information
Supplemental Information Intrinsic protein-protein interaction mediated and chaperonin assisted sequential assembly of a stable Bardet Biedl syndome protein complex, the BBSome * Qihong Zhang 1#, Dahai
More informationSupplemental Materials and Methods
Supplemental Materials and Methods In situ hybridization In situ hybridization analysis of HFE2 and genin mrna in rat liver tissues was performed as previously described (1). Briefly, the digoxigenin-labeled
More informationApoptosis assay: Apoptotic cells were identified by Annexin V-Alexa Fluor 488 and Propidium
Apoptosis assay: Apoptotic cells were identified by Annexin V-Alexa Fluor 488 and Propidium Iodide (Invitrogen, Carlsbad, CA) staining. Briefly, 2x10 5 cells were washed once in cold PBS and resuspended
More informationProtocol Reprogramming MEFs using the Dox Inducible Reprogramming Lentivirus Set: Mouse OKSM
STEMGENT Page 1 OVERVIEW The following protocol describes the reprogramming of one well of mouse embryonic fibroblasts (MEFs) into induced pluripotent stem (ips) cells in a 6-well format. Transduction
More informationThe RT-qPCR analysis of selected type-i IFNs related genes, IRF7 and Oas3. The
SUPPLEMENTARY MATERIALS AND METHODS Real time quantitative PCR The RT-qPCR analysis of selected type-i IFNs related genes, IRF7 and Oas3. The RT-qPCR was performed on the Applied Biosystems StepOne TM
More informationNature Immunology: doi: /ni.1744
Macrophage colony stimulating factor induces macrophage proliferation and survival through a pathway involving DAP12 and β-catenin Karel Otero, Isaiah R Turnbull, Pietro Luigi Poliani *, William Vermi
More informationSupplementary Information Alternative splicing of CD44 mrna by ESRP1 enhances lung colonization of metastatic cancer cell
Supplementary Information Alternative splicing of CD44 mrna by ESRP1 enhances lung colonization of metastatic cancer cell Supplementary Figures S1-S3 Supplementary Methods Supplementary Figure S1. Identification
More informationTractionsForAll. v1.0. September 1 st, Created by Aleksandar Marinković, Sc.D. & Daniel Tschumperlin, Ph.D.
TractionsForAll v1.0 September 1 st, 2013 TractionsForAll v1.0 is freely distributed program that calculates tractions exerted by an adherent cell on the soft hydrogel substrate underneath. It is created
More informationProtocol CRISPR Genome Editing In Cell Lines
Protocol CRISPR Genome Editing In Cell Lines Protocol 2: HDR donor plasmid applications (gene knockout, gene mutagenesis, gene tagging, Safe Harbor ORF knock-in) Notes: 1. sgrna validation: GeneCopoeia
More informationMethods Western blot analysis of plg Quantification of plasminogen accumulation by ELISA Immunohistochemical analysis
Methods Western blot analysis of plg Wild-type mice first received a standardized burn wound and then were intravenously administered 2 mg of human plg (Omnio AB, Umeå, Sweden). 24 hours after wounding
More informationPhagocytosis Assay Kit (IgG PE)
Phagocytosis Assay Kit (IgG PE) Item No. 600540 www.caymanchem.com Customer Service 800.364.9897 Technical Support 888.526.5351 1180 E. Ellsworth Rd Ann Arbor, MI USA TABLE OF CONTENTS GENERAL INFORMATION
More informationSmooth Muscle-Specific Expression of ipla 2 β Participates in the Initiation and Early Progression of Vascular Inflammation and Neointima Formation
Smooth Muscle-Specific Expression of ipla 2 β Participates in the Initiation and Early Progression of Vascular Inflammation and Neointima Formation Shu Liu 1, Zhongwen Xie 2, Qingwei Zhao 2, Huan Pang
More informationCancer cells that survive radiation therapy acquire HIF-1 activity and translocate toward tumor blood vessels Supplementary Information
Cancer cells that survive radiation therapy acquire HIF-1 activity and translocate toward tumor blood vessels Supplementary Information 1. Supplementary Figure S1-S10: Pages 2-11 2. Supplementary References:
More informationMice TRAMP mice were maintained in a C57BL/6J background. Syngeneic UBI-GFP/BL6 mice were used for bone marrow engraftment. 2
Antibodies Chicken IgY polyclonal α-gfp antibodies were purchased from Abcam (Cambridge, MA) and were detected using α-chicken IgY-FITC or α-chicken-hrp (also purchased from Abcam). The CD31-PE, CD11b-PE,
More informationSupplementary Materials and Methods
Supplementary Materials and Methods Reagents Supplementary Material (ESI) for Lab on a Chip RPMI medium, FBS, HEPES buffer solution, sodium pyruvate, penicillin, and streptomycin were obtained from Biological
More informationHeLa cells stably transfected with an empty pcdna3 vector (HeLa Neo) or with a plasmid
SUPPLEMENTAL MATERIALS AND METHODS Cell culture, transfection and treatments. HeLa cells stably transfected with an empty pcdna3 vector (HeLa Neo) or with a plasmid encoding vmia (HeLa vmia) 1 were cultured
More informationSupplementary Methods. Li J.-Y. et al. Lewy bodies in grafted neurons in Parkinson s patients suggest host to. graft disease propagation
1 Supplementary Methods Li J.-Y. et al. Lewy bodies in grafted neurons in Parkinson s patients suggest host to graft disease propagation Neural transplantation and clinical assessment Detailed information
More informationASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG
Supplemental Materials and Methods Plasmids: the following plasmids were used in the supplementary data: pwzl-myc- Lats2 (Aylon et al, 2006), pretrosuper-vector and pretrosuper-shp53 (generous gift of
More informationEstablishing sirna assays in primary human peripheral blood lymphocytes
page 1 of 7 Establishing sirna assays in primary human peripheral blood lymphocytes This protocol is designed to establish sirna assays in primary human peripheral blood lymphocytes using the Nucleofector
More informationThe Wnt-5a-derived hexapeptide Foxy-5 inhibits breast cancer. metastasis in vivo by targeting cell motility
SUPPLEMENTARY MATERIAL: The Wnt-5a-derived hexapeptide Foxy-5 inhibits breast cancer metastasis in vivo by targeting cell motility Annette Säfholm, Johanna Tuomela, Jeanette Rosenkvist, Janna Dejmek, Pirkko
More informationChromatin immunoprecipitation (ChIP) ES and FACS-sorted GFP+/Flk1+ cells were fixed in 1% formaldehyde and sonicated until fragments of an average
Chromatin immunoprecipitation (ChIP) ES and FACS-sorted cells were fixed in % formaldehyde and sonicated until fragments of an average size of 5 bp were obtained. Soluble, sheared chromatin was diluted
More informationSupplementary Material
Supplementary Material Supplementary Methods Cell synchronization. For synchronized cell growth, thymidine was added to 30% confluent U2OS cells to a final concentration of 2.5mM. Cells were incubated
More informationProtein and transcriptome quantitation using BD AbSeq Antibody-Oligonucleotide
Protein and transcriptome quantitation using BD AbSeq Antibody-Oligonucleotide technology and the 10X Genomics Chromium Single Cell Gene Expression Solution Jocelyn G. Olvera, Brigid S. Boland, John T.
More informationFig. S1 TGF RI inhibitor SB effectively blocks phosphorylation of Smad2 induced by TGF. FET cells were treated with TGF in the presence of
Fig. S1 TGF RI inhibitor SB525334 effectively blocks phosphorylation of Smad2 induced by TGF. FET cells were treated with TGF in the presence of different concentrations of SB525334. Cells were lysed and
More informationSupporting Information
Supporting Information of Laser Immunotherapy in Combination with Perdurable PD-1 Blocking for Treatment of Metastatic Tumor Lihua Luo, Chunqi Zhu, Hang Yin, Mengshi Jiang, Junlei Zhang, Bing Qin, Zhenyu
More informationElectronic Supplementary Information (ESI)
Electronic Supplementary Material (ESI) for Chemical Science. This journal is The Royal Society of Chemistry 2014 Electronic Supplementary Information (ESI) Gold(III) complexes inhibit growth of cisplatin-resistant
More informationBrdU Immunohistochemistry Kit Instruction Manual
BrdU Immunohistochemistry Kit Instruction Manual Features Easy to use system Reagents titered for success Proven protocol Ordering Information Catalog Number X1545K Size 50 Slides Format Immunohistochemistry
More informationTo isolate single GNS 144 cell clones, cells were plated at a density of 1cell/well
Supplemental Information: Supplemental Methods: Cell culture To isolate single GNS 144 cell clones, cells were plated at a density of 1cell/well in 96 well Primaria plates in GNS media and incubated at
More informationBrdU IHC Kit. For the detection and localization of bromodeoxyuridine incorporated into newly synthesized DNA of actively proliferating cells
K-ASSAY BrdU IHC Kit For the detection and localization of bromodeoxyuridine incorporated into newly synthesized DNA of actively proliferating cells Cat. No. KT-077 For Research Use Only. Not for Use in
More informationTF-1a lymphoblastic leukemia cell line: marking with GFP, phenotyping and sorting
Supplemental Material Supplemental Methods TF-1a lymphoblastic leukemia cell line: marking with GFP, phenotyping and sorting In order to determine if the multi-parameter FACS approach would be successful
More informationDNA methylation analysis was carried out using the Epityper system from Sequenom
Supplemental methods Quantitative DNA methylation analysis DNA methylation analysis was carried out using the Epityper system from Sequenom (San Diego, CA). The EpiTYPER assay is a tool for the detection
More informationab BrdU Immunohistochemistry Kit
ab125306 - BrdU Immunohistochemistry Kit Instructions for Use For the detection and localization of bromodeoxyuridine incorporated into newly synthesized DNA of actively proliferating cells. This product
More informationSupplementary Protocol. sirna transfection methodology and performance
Supplementary Protocol sirna transfection methodology and performance sirna oligonucleotides, DNA construct and cell line. Chemically synthesized 21 nt RNA duplexes were obtained from Ambion Europe, Ltd.
More informationSingle-cell suspensions of C57BL/6J splenocytes were incubated with CD5 beads
S S Single-cell suspensions of C57BL/6J splenocytes were incubated with CD5 beads (Miltenyi Biotech) and T cells were positively selected by magnetically activated cell sorting (MACS). 50x10 6 or greater
More informationBmDCs were generated as described by a modified protocol of Inaba et al S1. Briefly, bone
Generation and culture of bone marrow-derived dendritic cells (bmdcs) BmDCs were generated as described by a modified protocol of Inaba et al S1. Briefly, bone marrow cells from murine tibias and femurs
More informationAt E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in
Supplementary Materials and Methods Barrier function assays At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in acidic X-gal mix (100 mm phosphate buffer at ph4.3, 3 mm
More informationContribution and Mobilization of Mesenchymal Stem Cells in a mouse model of carbon tetrachloride-induced liver fibrosis
Contribution and Mobilization of Mesenchymal Stem Cells in a mouse model of carbon tetrachloride-induced liver fibrosis Yan Liu 1,*, Zhipeng Han 1,*, Yingying Jing 1,*, Xue Yang 1, Shanshan Zhang 1, Chen
More informationProtocol Reprogramming Human Fibriblasts using the Dox Inducible Reprogramming Polycistronic Lentivirus Set: Human 4F2A LoxP
STEMGENT Page 1 OVERVIEW The following protocol describes the reprogramming of one well of BJ Human Fibroblasts (BJ cells) into induced pluripotent stem (ips) cells in a 6-well format. Transduction efficiency
More informationPercent survival. Supplementary fig. S3 A.
Supplementary fig. S3 A. B. 100 Percent survival 80 60 40 20 Ml 0 0 100 C. Fig. S3 Comparison of leukaemia incidence rate in the triple targeted chimaeric mice and germline-transmission translocator mice
More informationµ Slide Membrane ibipore Flow
The ibidi product family is comprised of a variety of µ Slides and µ Dishes, which have all been designed for high end microscopic analysis of fixed or living cells. The high optical quality of the material
More informationM X 500 µl. M X 1000 µl
GeneGlide TM sirna Transfection Reagent (Catalog # M1081-300, -500, -1000; Store at 4 C) I. Introduction: BioVision s GeneGlide TM sirna Transfection reagent is a cationic proprietary polymer/lipid formulation,
More informationTumor tissues or cells were homogenized and proteins were extracted using
SUPPLEMENTAL MATERIALS AND METHODS Western Blotting Tumor tissues or cells were homogenized and proteins were extracted using T-PER tissue protein extraction buffer. Protein concentrations were determined
More information1. Cross-linking and cell harvesting
ChIP is a powerful tool that allows the specific matching of proteins or histone modifications to regions of the genome. Chromatin is isolated and antibodies to the antigen of interest are used to determine
More informationQuantitative real-time RT-PCR analysis of the expression levels of E-cadherin
Supplementary Information 1 Quantitative real-time RT-PCR analysis of the expression levels of E-cadherin and ribosomal protein L19 (RPL19) mrna in cleft and bud epithelial cells of embryonic salivary
More information. Viability of colonies was then assessed using the WST-1 reagent as described above, and normalized relative to untreated controls.
Cell viability analysis in the absence of disaggregation To assess cell viability in the absence of disaggregation, quintuplicate samples of cells at 5 x 1 5 /ml were treated with mab (1 µg/ml) for 24
More informationSarker et al. Supplementary Material. Subcellular Fractionation
Supplementary Material Subcellular Fractionation Transfected 293T cells were harvested with phosphate buffered saline (PBS) and centrifuged at 2000 rpm (500g) for 3 min. The pellet was washed, re-centrifuged
More informationData Sheet CD137/NF-κB Reporter - HEK293 Recombinant Cell Line Catalog # 79289
Data Sheet CD137/NF-κB Reporter - HEK293 Recombinant Cell Line Catalog # 79289 Background Human CD137 (4-1BB; TNFRS9) is an inducible co-stimulatory molecule that activates T cells. CD137:CD137L-mediated
More informationAnti-HB-EGF (Human) mab
Page 1 For Research Use Only. Not for use in diagnostic procedures. CODE No. D308-3 Anti-HB-EGF (Human) mab CLONALITY CLONE ISOTYPE QUANTITY SOURCE IMMUNOGEN FORMURATION STORAGE Monoclonal 3H4 Mouse IgG1
More information(B) Comparable expression of major integrin subunits and glycoproteins on the surface of resting WT and Lnk -/- platelets.
Supplemental Figure S1. Characteristics of Lnk -/- platelets. (A) Electron micrographs of resting platelets showing the normal intracellular structure of Lnk -/ platelets. Samples were fixed with 4% PFA
More informationSOP: SYBR Green-based real-time RT-PCR
SOP: SYBR Green-based real-time RT-PCR By Richard Yu Research fellow Centre for Marine Environmental Research and Innovative Technology (MERIT) Department of Biology and Chemistry City University of Hong
More informationShort hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna
Supplemental Materials and Methods Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna (Mission shrna, Sigma) against mouse MMP14 were transfected into HEK293 cells using FuGene6
More informationSupplementary methods
Supplementary methods Cell culture, infection, transfection, and RNA interference HEK293 cells and its derivatives were grown in DMEM supplemented with 10% FBS. Various constructs were introduced into
More informationFigure S1. Specificity of polyclonal anti stabilin-1 and anti stabilin-2 antibodies Lysates of 293T cells transfected with empty vector, mouse
Figure S1. Specificity of polyclonal anti stabilin-1 and anti stabilin-2 antibodies Lysates of 293T cells transfected with empty vector, mouse stabilin-1, or mouse stabilin-2 were immunoblotted using anti
More informationSuperPrep Cell Lysis & RT Kit for qpcr
SuperPrep Cell Lysis & RT Kit for qpcr 1402 F1267K SuperPrep Cell Lysis & RT Kit for qpcr SCQ-101 100 reactions Store at -20 C SuperPrep Cell Lysis Kit for qpcr SCQ-201 100 preparations Store at -20 C
More informationFigure S1. Phenotypic characterization of transfected ECFC. (a) ECFC were transfected using a lentivirus with a vector encoding for either human EPO
Figure S1. Phenotypic characterization of transfected ECFC. (a) ECFC were transfected using a lentivirus with a vector encoding for either human EPO (epoecfc) or LacZ (laczecfc) under control of a cytomegalovirus
More informationProtocols for Neural Progenitor Cell Expansion and Dopaminergic Neuron Differentiation
Protocols for Neural Progenitor Cell Expansion and Dopaminergic Neuron Differentiation In vitro neurological research presents many challenges due to the difficulty in establishing high-yield neuronal
More informationSupplementary Table 1. PCR amplification conditions for each primer pair. Primer sequence
- 1 - Supplementary Tables Supplementary Table 1. PCR amplification conditions for each primer pair Primer sequence FN1 S - CAAAGCAAGCCCGGTTGT AS - CGCTCCCACTGTTGATTTATCTG ITGα2 S - TTAGGTTACTCTGTGGCTGCAATT
More informationNature Medicine doi: /nm.2548
Supplementary Table 1: Genotypes of offspring and embryos from matings of Pmm2 WT/F118L mice with Pmm2 WT/R137H mice total events Pmm2 WT/WT Pmm2 WT/R137H Pmm2 WT/F118L Pmm2 R137H/F118L offspring 117 (100%)
More informationFigure legend. The expression of BAFF and its receptors in macrophages was detected at lesion areas of atherosclerosis and arthritis.
Data supplement #1 Figure legend. The expression of BAFF and its receptors in macrophages was detected at lesion areas of atherosclerosis and arthritis. A. Consecutive sections of an atherosclerotic plaque
More informationSupplemental Figure 1 (Figure S1), related to Figure 1 Figure S1 provides evidence to demonstrate Nfatc1Cre is a mouse line that directed gene
Developmental Cell, Volume 25 Supplemental Information Brg1 Governs a Positive Feedback Circuit in the Hair Follicle for Tissue Regeneration and Repair Yiqin Xiong, Wei Li, Ching Shang, Richard M. Chen,
More informationSupplementary Material (ESI) for Lab on a Chip This journal is The Royal Society of Chemistry 2007
Supplementary Material (ESI) for Lab on a Chip This journal is The Royal Society of Chemistry 2007 Fibronectin isolation and fluorescent labeling Human plasma Fn was isolated from fresh human plasma (Swiss
More information