Supporting Information
|
|
- Jane Daniels
- 6 years ago
- Views:
Transcription
1 Supporting Information Balastik et al /pnas SI Text TRIM2 GT Mice PCR Genotyping. PCR genotyping was based on the known chromosomal localization of Trim2 gene on mouse chromosome 3, area E3 and a simple sequence length polymorphism (SSLP) between mouse strains C57/Bl6 (into which the Trim2 GT mice were back-crossed) and 129/Sv (the origin of the ES cells). The sequence of SSLP PCR markers was obtained from the Whitehead Institute homepage (www-genome.wi.mit-.edu/). Several markers that were localized within 0.1 cm distance from Trim2 locus were tested for PCR polymorphism between the two mouse strains. Primers D3Mit97L (ACTG- CATATGTATGTGTGCATG) and D3Mit97R (AGAACAT- GAAATAACCATGAAAAGC) were selected for genotyping consistently producing SSLP ( 107 bp C57/Bl6 and 101 bp 129/Sv) detectable by 6% agarose gel electrophoresis. Nonradioactive in Situ Hybridization. The sections were fixed in 4% PFA for 15 min at room temperature, washed in PBS, digested with 20 g/ml proteinase K solution at 37 C for 5 min and washed again in 0.2% glycin/pbs buffer. Following the proteinase K digestion, the sections were again fixed in 4% PFA 0.2% glutaraldehyde in PBS and incubated in hybridization buffer (50% formamid; 5x SSC; 1% blocking reagent (Roche); 5 mm EDTA; 0.1% Tween-20; 0.1% CHAPS; 0.1 mg/ml heparin; 1 mg/ml yeast total RNA) in a humidified chamber at 70 C for 2 h. The hybridization with a DIG- labeled probe diluted in hybridization buffer (1 g/ml) was performed overnight at 70 C in a humidified chamber. After the hybridization the sections were rinsed in 2 SSC (ph 4.5) buffer and washed three times for 30 min at 65 C in washing solution [50% formamide/2 SSC (ph 4.5)] and twice 10 min in KTBT buffer (0.05 M Tris-Cl; 0.15 M NaCl; 0.01 M KCl; 1% Triton X-100). Subsequently the slides were incubated in blocking solution (20% sheep serum in KTBT) for2hatroom temperature and overnight at 4 C with anti-dig alkaline phosphatase conjugate antibodies (1:2,000; Roche), washed with KTBT buffer (three times for 5 min. and three times for 30 min) and incubated three times for 5 min in NTMT buffer (100 mm Tris-Cl; 100 mm NaCl; 50 mm MgCl2; 0.05% Tween- 20; 2 mm levamisole). Finally, the color reaction was developed at room temperature in a dark humidified box with NBT-BCIP color substrate (Roche) usually for 2 5 h. The reaction was stopped by washing in 0.1% Triton X-100/PBS, sections were fixed in 4% PFA/PBS (10 min, room temperature), rinsed in PBS, and mounted in Mowiol. Pull-Down Assays of Endogenous NF-L from Brain Lysate. Neuro 2a cells transfected with c-myc tagged Trim2 were lyzed in 300 l of buffer A [50 mm Tris-HCl (ph 7.4); 150 mm NaCl; 0.5% Triton X-100; EDTA-free protease inhibitors, Roche) and spun at 16,000 g for 10 min at 4 C. Meanwhile, one-half of adult mouse cerebellum was homogenized on ice with Polytron (Brinkmann Instruments) in 1 ml of buffer B [50 mm Tris HCl (ph 7.4); 150 mm NaCl; 0.15% SDS; 1% Triton X-100; EDTAfree protease inhibitors (Roche)], sonicated on ice for 20 s and spun at 15,000 g for 15 min at 4 C. N2a cell lysate (150 l)was incubated overnight at 4 C with 150 l of cerebellar lysate and 50 l of anti-c-myc agarose beads (Vector). The beads were washed seven times with washing buffer [50 mm Tris HCl (ph 7.4); 150 mm NaCl; 0.75% Triton X-100] and analyzed by Western blotting. Preembedding Immunocytochemical Electron Microscopy. Freefloating sections were preincubated for 1hin20%normalgoat serum (NGS) diluted in TBS and then incubated for 48 h at 4 C with primary antibodies diluted in TBS-1% NGS. Two different primary antibodies have been used: rabbit polyclonal anti-nf-l raised against purified porcine NF-L (Chemicon) diluted 1:500 and mouse monoclonal anti-nf-l 68 clone NR4 (Sigma) diluted 1:250. Visualization of NF-L antigen antibody complexes was performed using anti-rabbit or anti-mouse affinity purified Fab fragment coupled to 1.4-nm gold particles (1:100, Nanogold; Nanoprobes Inc.). Gold particles were enhanced by silver amplification for 8 10 min using the HQ Silver kit following the manufacturer s instructions (Nanoprobes Inc.). Sections were then routinely processed for EM examination (2% OsO 4 ;1% uranyl acetate) and embedded in Durcupan ACM. Ultrathin sections (70 nm) were collected on pioloform-coated copper slot grids and analyzed in a Philips CM120 electron microscope. Lead citrate contrasting was used for both high-glutaraldehydefixed tissue and ImmunoGold/silver-labeled sections. At least four different blocks of each animal were cut for electron microscopy. 1of11
2 Fig. S1. GT vector integration into the Trim2 gene. (A) PCR and RACE-PCR were used to identify and confirm the insertion site of the GT vector within the Trim2 locus. The RACE-PCR primers were designed from the 5 part of the GT vector and the PCR primers from 5 part of the GT vector and 3 part of the TRIM2 exon 6 sequence. (B and C) Sequences obtained by the 5 RACE-PCR (B) and the PCR amplification of the insertion locus (C). 2of11
3 Fig. S2. Embryonic expression of TRIM2: TRIM2 is expressed in the developing nervous system. -Gal staining of heterozygous E12.5 embryos shows high TRIM2 expression in the spinal cord (arrows), dorsal root ganglia (arrowheads), hindbrain (h), and midbrain (m). 3of11
4 Fig. S3. Cerebellar degeneration in Trim2GT homozygous mice. (A and C) WT mice age-matched to those in B and D. (B and D) HE staining of 2-month-old Trim2GT mutants demonstrates Purkinje cell degeneration as a deficit in Purkinje cell somata. (Scale bars: 100 m.) 4 of 11
5 Fig. S4. Apoptotic degeneration of Purkinje cells. Purkinje cells positive for an apoptotic marker cleaved caspase-3 were present in 2-month-old TRIM2GT homozygous mice (B and D arrows) but not in 1-month-old homozygotes (A and C). (Scale bars: 100 m.) 5 of 11
6 Fig. S5. Degeneration of deep cerebellar neurons ultrastructurally resembles apoptosis. In a few neurons (asterisk) of the deep cerebellar nuclei at P45, we observed initial areas of condensation of the nuclear chromatin (indicated by the arrows) contained within an intact nuclear envelope, which were particularly evident near the nucleolus. These morphological features are suggestive of an early phase of apoptosis. This neuron is adjacent to a healthy presumed astrocyte. ncl, nucleolus. (Scale bar: 2 m.) 6 of 11
7 Fig. S6. Position of smooth endoplasmic reticulum (SR) and distribution of myosin V in Purkinje cells of TRIM2GT mutant mice. Electron micrographs of dendritic spines (s) of Purkinje cells in Trim2GT mutants (arrows, endoplasmic reticulum). (A C) Low- (A) and high- (B and C) magnification of the cerebellar cortex. In B and C, Purkinje cell spines in Trim2GT homozygous mice clearly show the typical stalks (arrows) resembling a spine apparatus. At, axon terminal. (D and E) Myosin V immunostaining of wild-type (D) and Trim2GT mutant (E) Purkinje cells at P30. (Scale bars: 200 nm in A and C; 25 nm in B; and100 m in D and E). 7 of 11
8 Fig. S7. TRIM2 - NF-L interaction in brain lysate and NF-L ubiquitination in vitro.(a) TRIM2 pulldown of NF-L from a cerebellar protein extract in the presence (line 2) or absence (line 4) of c-myc tagged TRIM2. The lower bands in lines 1 and 3 (supernatant) represent a partially degraded NF-L. (B) NF-L is ubiquitinated in an in vitro ubiquitination assay in the presence of UbcH5a E2. (C) NF-L ubiquitination in HeLa cells in the presence of endogenous UbcH5a (line 1), after overexpression of UbcH5a (line 2) and after overexpression of dominant-negative UbcH5a (line 3). 8of11
9 Fig. S8. Cortical NF-L inclusions in the Trim2 GT homozygous mice. NF-L immunostaining of mostly perikaryal NF-L inclusions (B Inset, arrows, counterstained with DAPI) in the frontal cortex (sagittal sections) of the Trim2 GT homozygous mice (B) and WT littermates (A). (Scale bars: 100 m.) 9of11
10 Fig. S9. Ubiquitin does not accumulate in the swollen axons of Purkinje cell in Trim2 GT homozygous mice at P30. CalbindinvD-28k immunostaining (A) detects numerous axonal swellings in the cerebellar white matter of Trim2 GT that do not colocalize (C) with ubiquitin immunostaining (B). (arrows, axonal swellings devoid of ubiquitin). (Scale bars: 50 m.) 10 of 11
11 Movie S1. Two months old Trim2 GT homozygous mice show tremor which is followed by progressive ataxia at around 3 months of age. Movie S1 (MPG) 11 of 11
WHOLE MOUNT IN SITU HYBRIDIZATION
WHOLE MOUNT IN SITU HYBRIDIZATION Dissect embryos in cold PBS, wash in cold PBS in a 10 or 50 ml tube, and fixate o/n in cold 4% PFA/PBS at 4 C, while gently rocking. Young embryos or dissected tissues
More informationNote that steps 1-16 are identical to steps 1-16 in the immunostaining protocol, except 0.5X PBtween is used in this protocol rather than 0.5X PBT.
Embryo In-situ Hybridization: This protocol is based closely on an immunostaining protocol for Hypsibius dujardini (Gabriel and Goldstein 2007) and available in-situ protocols for both insects (Tomoysu
More informationCombined Digoxigenin-labeled in situ hybridization/ Immunohistochemistry protocol (for fixed frozen cryostat sections)
Combined Digoxigenin-labeled in situ hybridization/ Immunohistochemistry protocol (for fixed frozen cryostat sections) A. Digoxigenin-UTP labeling of crna antisense probe Refer to laboratory protocol and
More information1. Cross-linking and cell harvesting
ChIP is a powerful tool that allows the specific matching of proteins or histone modifications to regions of the genome. Chromatin is isolated and antibodies to the antigen of interest are used to determine
More informationSupporting Information
Supporting Information Su et al. 10.1073/pnas.1211604110 SI Materials and Methods Cell Culture and Plasmids. Tera-1 and Tera-2 cells (ATCC: HTB- 105/106) were maintained in McCoy s 5A medium with 15% FBS
More informationSANTA CRUZ BIOTECHNOLOGY, INC.
TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same
More informationIn Situ Hybridization
In Situ Hybridization Modified from C. Henry, M. Halpern and Thisse labs April 17, 2013 Table of Contents Reagents... 2 AP Buffer... 2 Developing Solution... 2 Hybridization buffer... 2 PBT... 2 PI Buffer
More informationSupplemental Data. LMO4 Controls the Balance between Excitatory. and Inhibitory Spinal V2 Interneurons
Neuron, Volume 61 Supplemental Data LMO4 Controls the Balance between Excitatory and Inhibitory Spinal V2 Interneurons Kaumudi Joshi, Seunghee Lee, Bora Lee, Jae W. Lee, and Soo-Kyung Lee Supplemental
More informationThe preparation of native chromatin from cultured human cells.
Native chromatin immunoprecipitation protocol The preparation of native chromatin from cultured human cells. All solutions need to be ice cold. Sucrose containing solutions must be made up fresh on the
More informationPolyclonal ARHGAP25 antibody was prepared from rabbit serum after intracutaneous
Preparation and purification of polyclonal antibodies Polyclonal ARHGAP25 antibody was prepared from rabbit serum after intracutaneous injections of glutathione S-transferase-ARHGAP25-(509-619) (GST-coiled
More informationIgG TrueBlot Protocol for Mouse, Rabbit or Goatderived Antibodies - For Research Use Only
IgG TrueBlot Protocol for Mouse, Rabbit or Goatderived Antibodies - For Research Use Only Introduction The IgG TrueBlot for mouse, rabbit, or goat-derived antibodies represents unique series of respective
More informationSupplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling
Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Glendining KA 1, Markie D 2, Gardner RJM 4, Franz EA 3, Robertson SP 4, Jasoni CL 1 Supplementary
More informationab Ran Activation Assay Kit
ab173247 Ran Activation Assay Kit Instructions for Use For the simple and fast measurement of Ran activation. This product is for research use only and is not intended for diagnostic use. Version 1 Last
More information5. Wash larvae briefly (<1min) 2mg/ml glycine in PTw (make fresh every time).
In situ Hybridization Day 1 PRETREATMENT 1. Transfer embryos to small mesh filter cups in a tip box lid with 30ml 75% MeOH/25% PTw. Use ~50ul larvae per probe for each stage. Place in fume hood on top
More informationsupplementary information
DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /
More informationStrep-tag detection in Western blots
Strep-tag detection in Western blots General protocol for the detection of Strep-tag fusion proteins Last date of revision April 2012 Version PR07-0010 www.strep-tag.com For research use only Important
More informationab Ubiquitylation Assay Kit (HeLa lysate-based)
ab139471 Ubiquitylation Assay Kit (HeLa lysate-based) Instructions for Use For the generation of ubiquitin-conjugated lysate proteins This product is for research use only and is not intended for diagnostic
More informationTechnical Note Detection of post-immunoprecipitation proteins by Western blot using the Quick Western Kit IRDye 680RD
Technical Note Detection of post-immunoprecipitation proteins by Western blot using the Quick Western Kit IRDye 680RD Developed for: Aerius, Odyssey Classic, Odyssey CLx and Odyssey Sa Imaging Systems
More informationab Ubiquitylation Assay Kit
ab139467 Ubiquitylation Assay Kit Instructions for Use For the activation of ubiquitin for use in ubiquitylation experiments This product is for research use only and is not intended for diagnostic use.
More informationApoTrack Cytochrome c Apoptosis ICC Antibody
ab110417 ApoTrack Cytochrome c Apoptosis ICC Antibody Instructions for Use For the Immunocytochemistry analysis of cytochrome c and a mitochondrial marker (Complex Vα) in apoptotic cells and nonapoptotic
More informationOptimized Vibratome Section in situ Hybridization For P1 Mouse Kidney Sections Andrew P. McMahon Laboratory
Optimized Vibratome Section in situ Hybridization For P1 Mouse Kidney Sections Andrew P. McMahon Laboratory I. Preparation of tissues for vibratome section 1. Dissect newborn kidneys in cold PBS. 2. Fix
More informationRNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,
Materials and methods Oligonucleotides and DNA constructs RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by Dharmacon Inc. (Lafayette, CO). The sequences were: 122-2 OMe, 5
More information1. Paraffin section slides can be stored at room temperature for a long time.
Immunohistochemistry (IHC) Protocols Immunohistochemistry (IHC) Protocol of Paraffin Section 1. Fix dissected tissues with 10% formalin for no less than 48 hours at room temperature. Inadequately fixation
More informationRen Lab ENCODE in situ HiC Protocol for Tissue
Ren Lab ENCODE in situ HiC Protocol for Tissue Pulverization, Crosslinking of Tissue Note: Ensure the samples are kept frozen on dry ice throughout pulverization. 1. Pour liquid nitrogen into a mortar
More informationSegments of the obstructed intestinal loops were fixed in 4% paraformaldehyde
Supplementary text Supplementary materials and methods Histopathological examination Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde (PFA) and embedded in paraffin wax with
More informationIMMUNOPRECIPITATION (IP)
1 IMMUNOPRECIPITATION (IP) Overview and Technical Tips 2 CONTENTS 3 7 8 9 12 13 17 18 19 20 Introduction Factors Influencing IP General Protocol Modifications Of IP Protocols Troubleshooting Contact Us
More informationSupplemental Data. Lee et al. Plant Cell. (2010) /tpc Supplemental Figure 1. Protein and Gene Structures of DWA1 and DWA2.
Supplemental Figure 1. Protein and Gene Structures of DWA1 and DWA2. (A) Protein structures of DWA1 and DWA2. WD40 region was determined based on the NCBI conserved domain databases (B, C) Schematic representation
More informationRespiratory distress and early neonatal lethality in Hspa4l/Hspa4 double mutant mice
Respiratory distress and early neonatal lethality in Hspa4l/Hspa4 double mutant mice Belal A. Mohamed, Amal Z. Barakat, Torsten Held, Manar Elkenani, Christian Mühlfeld, Jörg Männer, and Ibrahim M. Adham
More informationConfocal immunofluorescence microscopy
Confocal immunofluorescence microscopy HL-6 and cells were cultured and cytospun onto glass slides. The cells were double immunofluorescence stained for Mt NPM1 and fibrillarin (nucleolar marker). Briefly,
More informationSOX2 antibody - Embryonic Stem Cell Marker (ab15830) datasheet
-Embryonic Stem Cell Marker (ab15830) 1/8 ページ d Products: Stem Cells >> Germline Stem Cells >> Embryonic Germ Cells SOX2 antibody - Embryonic Stem Cell Marker (ab15830) datasheet Product Name Product type
More informationToll Receptor-Mediated Hippo Signaling Controls Innate Immunity in Drosophila
Cell Supplemental Information Toll Receptor-Mediated Hippo Signaling Controls Innate Immunity in Drosophila Bo Liu, Yonggang Zheng, Feng Yin, Jianzhong Yu, Neal Silverman, and Duojia Pan Supplemental Experimental
More informationHypoxyprobe Plus Kit
Updated 2017 1 PRODUCT INSERT Hypoxyprobe, Inc 121 Middlesex Turnpike Burlington, MA 01803 USA www.hypoxyprobe.com Hypoxyprobe Plus Kit (HPI Part # HP2-XXX) Kit contents: Solid pimonidazole HCl (Hypoxyprobe
More informationNon-Radioactive Southern Blot Reagents
Product Specifications Non-Radioactive Southern Blot Reagents Store as labeled. For research use only. Non-Radioactive Southern Blot Analysis, Electrophoresis Reagents Polymerase Chain Reaction Reagents,
More informationTransfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX
Transfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX INTRODUCTION The CRISPR/Cas genome editing system consists of a single guide RNA
More informationSensoLyte Anti-alpha-Synuclein Quantitative ELISA Kit (Human/Mouse/Rat) *Colorimetric*
Catalog # Kit Size SensoLyte Anti-alpha-Synuclein Quantitative ELISA Kit (Human/Mouse/Rat) *Colorimetric* AS-55550 One 96-well strip plate This kit is optimized to detect human/mouse/rat alpha-synuclein
More informationEPIGENTEK. EpiQuik Chromatin Immunoprecipitation Kit. Base Catalog # P-2002 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE
EpiQuik Chromatin Immunoprecipitation Kit Base Catalog # P-2002 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE The EpiQuik Chromatin Immunoprecipitation Kit is suitable for combining the specificity of
More informationWhole Mount In Situ Hybridization Protocol
Whole Mount In Situ Hybridization Protocol Purpose of in situs: To use an RNA probe to stain for the specific complementary mrna of an intact embryo, allowing visualization of mrna patterns. Note: When
More informationMouse TNF alpha ELISA Kit
Mouse TNF alpha ELISA Kit Catalog No. GWB-ZZD049 Size 96 wells/kit Sandwich ELISA kit for quantitative detection of mouse TNF alpha in cell culture supernates, serum and plasma(heparin, EDTA). Typical
More informationMouse IGF-1 ELISA Kit
GenWay Biotech, Inc. 6777 Nancy Ridge Drive San Diego, CA 92121 Phone: 858.458.0866 Fax: 858.458.0833 Email: sales@genwaybio.com http://www.genwaybio.com Mouse IGF-1 ELISA Kit Catalog No GWB-ZZD063 Size
More informationSUPPLEMENTAL MATERIAL. Supplemental Methods. Cumate solution was from System Biosciences. Human complement C1q and complement
SUPPLEMENTAL MATERIAL Supplemental Methods Reagents Cumate solution was from System Biosciences. Human complement Cq and complement C-esterase inhibitor (C-INH) were from Calbiochem. C-INH (Berinert) for
More informationSupplemental Data. Regulating Gene Expression. through RNA Nuclear Retention
Supplemental Data Regulating Gene Expression through RNA Nuclear Retention Kannanganattu V. Prasanth, Supriya G. Prasanth, Zhenyu Xuan, Stephen Hearn, Susan M. Freier, C. Frank Bennett, Michael Q. Zhang,
More informationSupplemental information
Supplemental information - Control samples (200 subjects) - Immunohistochemistry of rat brain - Immunocytochemistry on neuronal cultures - Immunocompetition assay - Immunoprecipitation - Immunocytochemistry
More informationMyers Lab ChIP-seq Protocol v Modified January 10, 2014
Myers Lab ChIP-seq Protocol V011014 1 Contact information: Dr. Florencia Pauli Behn HudsonAlpha Institute for Biotechnology 601 Genome Way Huntsville, AL 35806 Telephone: 256-327-5229 Email: fpauli@hudsonalpha.org
More informationIndex 1. Product Description 2. Purification Procedure 3. Troubleshooting 4. Ordering Information
High Affinity Ni-Charged Resin Cat. No. L00223 Technical Manual No. TM0217 Version 07132010 Index 1. Product Description 2. Purification Procedure 3. Troubleshooting 4. Ordering Information 1. Product
More informationSupplementary Figure 1. HiChIP provides confident 1D factor binding information.
Supplementary Figure 1 HiChIP provides confident 1D factor binding information. a, Reads supporting contacts called using the Mango pipeline 19 for GM12878 Smc1a HiChIP and GM12878 CTCF Advanced ChIA-PET
More informationSUPPLEMENTARY INFORMATION. Transcriptional output transiently spikes upon mitotic exit
SUPPLEMENTARY INFORMATION Transcriptional output transiently spikes upon mitotic exit Viola Vaňková Hausnerová 1, 2, Christian Lanctôt 1* 1 BIOCEV and Department of Cell Biology, Faculty of Science, Charles
More informationab Mouse and Rabbit AP/Fast-Red (ABC) Detection IHC Kit
ab128967 - Mouse and Rabbit AP/Fast-Red (ABC) Detection IHC Kit Instructions for Use For the detection of a specific antibody bound to an antigen in tissue sections. This product is for research use only
More informationSupplemental Information. PARP1 Represses PAP and Inhibits Polyadenylation during Heat Shock
Molecular Cell, Volume 49 Supplemental Information PARP1 Represses PAP and Inhibits Polyadenylation during Heat Shock Dafne Campigli Di Giammartino, Yongsheng Shi, and James L. Manley Supplemental Information
More informationSupporting Information
Supporting Information Groschwitz et al. 10.1073/pnas.0906372106 SI Methods In vitro permeability. Caco2-bbe human intestinal adenocarcinoma cells (ATCC) were maintained in DMEM supplemented with 10% FCS,
More informationKPL SignaLOCK ChemiWestern Kits (Film and Imager Analysis)
KPL SignaLOCK ChemiWestern Kits (Film and Imager Analysis) SignaLOCK HRP ChemiWestern Kit (Film) Catalog No. 54-53-00 SignaLOCK HRP ChemiWestern Kit (Imager) Catalog No. 54-54-00 SignaLOCK AP ChemiWestern
More informationRat IGF-1 ELISA Kit (rigf-1-elisa)
Rat IGF-1 ELISA Kit (rigf-1-elisa) Cat. No. EK0377 96 Tests in 8 x 12 divisible strips Background Insulin-like growth factor 1 (IGF-1), also known as somatomedin C, is a polypeptide protein hormone similar
More informationab G alpha i Activation Assay Kit
ab173234 G alpha i Activation Assay Kit Instructions for Use For the simple and fast measurement of G alpha i activation. This product is for research use only and is not intended for diagnostic use. Version
More informationab Human on human IHC kit (AP/Permanent
Version 1 Last updated 13 September 2016 ab214753 Human on human IHC kit (AP/Permanent Red) For staining human primary antibodies on human tissues without background staining This product is for research
More informationWeek 1: Protein isolation and quantification
Week 1: Protein isolation and quantification Objective The objective of this lab exercise is to obtain protein samples from fruit fly larvae, BCS and FBS, all of which are then quantitated in the preparation
More informationGM130 Is Required for Compartmental Organization of Dendritic Golgi Outposts
Current Biology, Volume 24 Supplemental Information GM130 Is Required for Compartmental Organization of Dendritic Golgi Outposts Wei Zhou, Jin Chang, Xin Wang, Masha G. Savelieff, Yinyin Zhao, Shanshan
More informationViral RNAi suppressor reversibly binds sirna to. outcompete Dicer and RISC via multiple-turnover
Supplementary Data Viral RNAi suppressor reversibly binds sirna to outcompete Dicer and RISC via multiple-turnover Renata A. Rawlings 1,2, Vishalakshi Krishnan 2 and Nils G. Walter 2 * 1 Biophysics and
More informationFMF NIRCA PROTOCOL STEP 1.
FMF NIRCA PROTOCOL STEP 1. After you have isolated patient s DNA and DNA from a healthy donor (wild type), you perform a nested PCR. The primers used to amplify exon 2 and exon 10 of the mefv gene are
More informationGFP CCD2 GFP IP:GFP
D1 D2 1 75 95 148 178 492 GFP CCD1 CCD2 CCD2 GFP D1 D2 GFP D1 D2 Beclin 1 IB:GFP IP:GFP Supplementary Figure 1: Mapping domains required for binding to HEK293T cells are transfected with EGFP-tagged mutant
More informationOrexin A (HUMAN, MOUSE, RAT, PORCINE, OVINE,
Orexin A (HUMAN, MOUSE, RAT, PORCINE, OVINE, BOVINE) Western Blot Kit Protocol (Catalog #WBK-003-30) PHOENIX PHARMACEUTICALS, INC. TABLE OF CONTENTS 1. Kit Contents...2 2. Storage...2 3. Introduction...3
More informationINOS. Colorimetric Cell-Based ELISA Kit. Catalog #: OKAG00807
INOS Colorimetric Cell-Based ELISA Kit Catalog #: OKAG00807 Please read the provided manual entirely prior to use as suggested experimental protocols may have changed. Research Purposes Only. Not Intended
More informationImmunohistochemistry. How does it look like? When do we need IHC? When do we need IHC? In clinic: In research:
Introduction How does it look like? Immunohistochemistry Smooth muscle actin Parvalbumin Distrophyn Sandrine Bichet Head of Molecular Histology Platform Signal versus background 06.03.2012 IHC basics Introduction
More informationZebrafish ChIP-array protocol: version 1 August 5 th 2005
Zebrafish ChIP-array protocol: version 1 August 5 th 2005 PROCEDURE I. Fixation of embryos 1. Dechorionate embryos (Pronase treatment) 2. Fix embryos, 15 mins in 1.85% formaldehyde in Embryo medium, RT,
More informationab TripleStain IHC Kit: M&M&R on human tissue (DAB, Red/AP & DAB/Ni)
ab183287 TripleStain IHC Kit: M&M&R on human tissue (DAB, Red/AP & DAB/Ni) Instructions for Use For the detection of Rabbit and Mouse Primary antibodies on Human tissue or cell samples. This product is
More informationTrkB knockdown cell lines (i.e., BBM1-KD and 361-KD cells) were prepared by
Supplemental Information Cell Culture TrkB knockdown cell lines (i.e., BBM1-KD and 361-KD cells) were prepared by transducing BBM1 or 361 cells with a lentivirus encoding shrna for TrkB. Transduction was
More informationCytoGLOW. IKK-α/β. Colorimetric Cell-Based ELISA Kit. Catalog #: CB5358
CytoGLOW IKK-α/β Colorimetric Cell-Based ELISA Kit Catalog #: CB5358 Please read the provided manual entirely prior to use as suggested experimental protocols may have changed. Research Purposes Only.
More informationHigh Pure PCR Template Preparation Kit for preparation of 100 nucleic acid samples Cat. No
for preparation of 100 nucleic acid samples Cat. No. 1 796 88 Principle Cells are lysed during a short incubation with Proteinase K in the presence of a chaotropic salt (guanidine HCl), which immediately
More informationNOTE ACRYLAMIDE IS NEUROTOXIN YOU MUST WEAR GLOVES.
GST Purfication and Pulldown Part I Instructor: David Deitcher TA: Kristy Lawton In order to study the function of a protein it is often useful to have that protein purified away from others in the cell.
More informationManufactured by. Zyagen Barnes Canyon Road San Diego, CA 92121, USA
Alkaline Phosphatase Immunohistochemistry Detection kits For detection of mouse, rabbit, goat, rat, sheep, chicken, guinea pig, and human primary antibodies Size: 500 Tests Catalog #: AK-011, Mouse Kit
More information(Last update: 1 August 2000, Ver 1.4)
In-situ hybridization using GeneDetect TM oligonucleotide probes DIG-labeled probe, paraffin tissue sections, Detection by AP (alkaline phosphatase), FITC or rhodamine. (Last update: 1 August 2000, Ver
More informationab EXPOSE Mouse and Rabbit Specific HRP/DAB Detection IHC Kit
Version 7 Last updated 17 January 2018 ab80436 - EXPOSE Mouse and Rabbit Specific HRP/DAB Detection IHC Kit For the detection of a specific antibody bound to an antigen in tissue sections. This product
More informationSupplementary Materials
Supplementary Materials Construction of Synthetic Nucleoli in Human Cells Reveals How a Major Functional Nuclear Domain is Formed and Propagated Through Cell Divisision Authors: Alice Grob, Christine Colleran
More informationSupplemental Data Supplementary Figure Legends and Scheme Figure S1.
Supplemental Data Supplementary Figure Legends and Scheme Figure S1. UTK1 inhibits the second EGF-induced wave of lamellipodia formation in TT cells. A and B, EGF-induced lamellipodia formation in TT cells,
More informationProtocol for induction of expression and cell lysate production
Protocol for induction of expression and cell lysate production AV-04 Doxycyclin induction and cell lysate 1.0 Introduction / Description This method is intended for the treatment of the previously transfected
More informationMasterPure Complete DNA and RNA Purification Kit
Cat. Nos. MC85200 and MC89010 The MasterPure Complete DNA and RNA Purification Kit provides all of the reagents necessary to recover nucleic acid from a wide variety of biological sources. This kit utilizes
More informationTECHNICAL BULLETIN. MEK Activity Assay Kit. Product Code CS0490 Storage Temperature 20 C
MEK Activity Assay Kit Product Code CS0490 Storage Temperature 20 C TECHNICAL BULLETIN Product Description The MAP kinase kinases (MAPKK, mitogen-activated protein kinase kinase, also termed MEK) are a
More informationCellular Fractionation
Cellular Fractionation Lamond Lab Protocol 2007 More detailed protocol can be found here: http://www.lamondlab.com/f7nucleolarprotocol.htm This protocol has been adapted to fractionate a variety of different
More informationModified Rapid MAIPA Protocol
Modified Rapid MAIPA Protocol This method is based on the following publication; K Campbell, K Rishi, G Howkins, D Gilby, R Mushens, C Ghevaert, P Metcalfe, WH Ouwehand, G Lucas. A modified fast MAIPA
More informationStabilization of a virus-like particle and its application as a nanoreactor at physiological conditions
Supporting Information Stabilization of a virus-like particle and its application as a nanoreactor at physiological conditions Lise Schoonen, b Sjors Maassen, b Roeland J. M. Nolte b and Jan C. M. van
More informationEGFR (Phospho-Ser695)
Assay Biotechnology Company www.assaybiotech.com Tel: 1-877-883-7988 Fax: 1-877-610-9758 EGFR (Phospho-Ser695) Colorimetric Cell-Based ELISA Kit Catalog #: OKAG02090 Please read the provided manual entirely
More informationKinase Reaction and Alkylation Protocol
Kinase Reaction and Alkylation Protocol Protocol for the treatment of substrates prior to detection by Thiophosphate Ester antibodies This product is for research use only and is not intended for diagnostic
More informationSupplemental Information
Supplemental Information Itemized List Materials and Methods, Related to Supplemental Figures S5A-C and S6. Supplemental Figure S1, Related to Figures 1 and 2. Supplemental Figure S2, Related to Figure
More informationRapid GST Inclusion Body Solubilization and Renaturation Kit
Product Manual Rapid GST Inclusion Body Solubilization and Renaturation Kit Catalog Number AKR-110 FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Bacteria are widely used for His
More informationBeta3 integrin promotes long-lasting activation and polarization of Vascular Endothelial Growth Factor Receptor 2 by immobilized ligand
SUPPLEMENTAL FIGURES Beta3 integrin promotes long-lasting activation and polarization of Vascular Endothelial Growth Factor Receptor 2 by immobilized ligand C. Ravelli et al. FIGURE S. I Figure S. I: Gremlin
More informationReagents and cell culture Mcl-1 gene expression: real-time quantitative RT-PCR In vitro PP2A phosphatase assay Detection of Mcl-1 in vivo
Reagents and cell culture Antibodies specific for caspase 3, PARP and GAPDH were purchased from Cell Signaling Technology Inc. (Beverly, MA). Caspase inhibitor z-vad-fmk and ROS scavenger N-acetyl-Lcysteine
More informationFor the development of sandwich ELISAs to measure phosphorylated Vascular Endothelial Growth Factor Receptor 1 (VEGF R1/Flt-1) in cell lysates.
DuoSet IC Human Phospho-VEGF R1/Flt-1 Catalog Number DYC4170-2 Catalog Number DYC4170-5 For the development of sandwich ELISAs to measure phosphorylated Vascular Endothelial Growth Factor Receptor 1 (VEGF
More informationSUMOylated protein capture kit
SUMOylated protein capture kit Cat no. A010-100 Capture and detect SUMOylated proteins High capacity, high specificity SUMO binding matrix Fast, convenient protein isolation using purification system provided
More informationSupplementary Table 1. The Q-PCR primer sequence is summarized in the following table.
Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of
More informationab Mouse and Rabbit Specific HRP/DAB (ABC) Detection IHC Kit
ab64264 - Mouse and Rabbit Specific HRP/DAB (ABC) Detection IHC Kit Instructions for Use For the detection of a specific antibody bound to an antigen in tissue sections. This product is for research use
More informationImmunoprecipitation Protocol
Immunoprecipitation Protocol Immunoprecipitation is a general method to obtain the enrichment of a specific protein from tissue lysate and cell lysate. It can be used to purify a specific protein, to identify
More informationMethodology for Immunohistochemistry. Learning Objectives:
Proteomics Methodology for Immunohistochemistry Methodology for Immunohistochemistry A staining process for identifying the proteins location in cells, tissues by using antigen-antibody property. Immuno
More informationHow to run Alpha assay: How to setup an Alpha assay Make your own assay!
How to run Alpha assay: How to setup an Alpha assay Make your own assay! 1 2009 PerkinElmer AlphaLISA kits - recommendations before starting the assay Samples: Phenol red and hemoglobin: choose AlphaLISA
More informationMicroarray Industry Products
Via Nicaragua, 12-14 00040 Pomezia (Roma) Phone: +39 06 91601628 Fax: +39 06 91612477 info@lifelinelab.com www.lifelinelab.com Microarray Industry Products Page 10 NBT / BCPIP Chromogenic phosphatase
More informationHigh-Affinity Ni-NTA Resin
High-Affinity Ni-NTA Resin Technical Manual No. 0217 Version 20070418 I Description.... 1 II Key Features... 1 III His-Tagged Fusion Protein Purification Procedure.. 1 IV Resin Regeneration. 4 V Troubleshooting...
More informationMitoBiogenesis In-Cell ELISA Kit (Colorimetric)
PROTOCOL MitoBiogenesis In-Cell ELISA Kit (Colorimetric) DESCRIPTION 1850 Millrace Drive, Suite 3A Eugene, Oregon 97403 MS643 Rev.2 For identifying inhibitors and activators of mitochondrial biogenesis
More informationEnzMet HRP Detection Kit for IHC / ISH
EnzMet HRP Detection Kit for IHC / ISH 95 Horseblock Road, Unit 1, Yaphank NY 11980-9710 Tel: (877) 447-6266 (Toll-Free in US) or (631) 205-9490 Fax: (631) 205-9493 Tech Support: (631) 205-9492 tech@nanoprobes.com
More informationHigh-Affinity Ni-NTA Resin
High-Affinity Ni-NTA Resin Technical Manual No. 0237 Version 20070418 I Description.. 1 II Key Features... 1 III His-Tagged Fusion Protein Purification Procedure 1 IV Resin Regeneration. 4 V Troubleshooting...
More informationChIP-Adem-Kit AutoMag Solution (Cat #04643) Instruction manual for automation protocol
ChIP-Adem-Kit AutoMag Solution (Cat #04643) Instruction manual for automation protocol ADEMTECH SA Bioparc BioGalien 27, allée Charles Darwin 33600 Pessac France Tel: +33557020201 Fax +3355702020 Visit
More informationWhole Mount IHC Protocol
Whole Mount IHC Protocol Authors: Ruth Sullivan, Ryan Trevena and Kyle Wegner Creation Date: 03/17/2016 All steps should be conducted with gentle agitation on an orbital shaker, unless otherwise instructed.
More informationApplication Note AN001
Testing hybridoma supernatants with the Spots On Dots Antibody Screening Kit Application Note AN1 Table of Contents Overview... 2 Figure 1. Screening of hybridomas raised against peptide antigens... 3
More informationImmunohistochemistry: Basics and Methods
Immunohistochemistry: Basics and Methods Igor B. Buchwalow l Werner Böcker Immunohistochemistry: Basics and Methods Prof. Dr. Igor B. Buchwalow Prof. Dr. Werner Böcker Gerhard-Domagk-Institut für Pathologie
More information