Genetic characteristics of 22 Y-STRs in Koreans:

Size: px
Start display at page:

Download "Genetic characteristics of 22 Y-STRs in Koreans:"

Transcription

1 Genetic characteristics of 22 Y-STRs in Koreans: Intermediate, null, and duplicated alleles and deletions in the DYS flanking region Myung Jin Park, Hwan Young Lee, Ukhee Chung, Na Young Kim, Woo Ick Yang, Sang-Ho Cho, Kyoung-Jin Shin Department of Forensic Medicine, Yonsei University College of Medicine, Seoul, Korea Human Identification Research Center, Yonsei University, Seoul, Korea Establishment of a Korean Y-STR database for 22 Y-STRs 22 Y-STRs DYS9, DYS, DYS388, DYS389I/II, DYS390, DYS39, DYS392, DYS393, DYS437, DYS438, DYS439, DYS446, DYS447, DYS448, DYS449, DYS456, DYS458, DYS464, DYS635 and GATA H4. 3 multiplex PCR systems 708 unrelated Korean males Haplotype alleles analysis and characterization of atypical

2 Schematic of 3 multiplex PCRs for 22 Y-STRs 00 bp 50 bp 200 bp 250 bp 300 bp I I II II H III DYS was included in each multiplex to detect sample switching Small amplicon was designed for DYS in multiplex III ( bp vs bp) Y-STR analysis in 708 Koreans Y-STR haplotype No. of haplotype Haplotype diversity Discriminatory power Minimal Haplotype loci Y-filer loci haplotype Y-STRs haplotype Atypical alleles Intermediate alleles at DYS447, DYS449, DYS458 and DYS464 Duplicated alleles at DYS9, DYS390 and DYS447 Null allele at DYS448 Different allele designation at DYS depending on the primer binding site

3 Microvariant and intermediate alleles in DYS447, DYS449, DYS458 and DYS464 Locus Allele Sequence structure N DYS447 8 (TAATA) 7 TAAAA (TAATA) 0 TAAAA(TAATA) n 2 9 (TAATA) 7 TAAAA (TAATA) TAAAA(TAATA) n 4 DYS (25)* (TTTC) 2 -tctc-n0-n32-cttc-(tttc) 4 30 (30.)* (TTTC) 6 -tctc-n0-n32-ctttc-(tttc) 4 33 (42)* (TTTC) 5 -tctc-n0-[n32-cttc] 2 -(TTTC) 8 DYS458 DYS (TTTC) 3 TC(TTTC) 0 -tctc-n0-n32-cttc-(tttc) (TTTC) 3 TT(TTTC) -tctc-n0-n32-cttc-(tttc) (TTTC) 3 TC(TTTC) 0 -tctc-n0-n32-cttc-(tttc) (TTTC) 6 -tctc-n0-n32-cttc- (TTTC) 0 TT(TTTC) (GAAA) 4 G 7.2 (GAAA) 5 AA(GAAA) (CCTT) 7 CTT(CCTT) (CCTT) 3 CTT(CCTT) 5 * Ostensible alleles at DYS449 Duplicated alleles at DYS9, DYS390 and DYS447 Locus Allele Sequence structure DYS9 6,7 (TAGA) 3 tagg(taga) 3,4 DYS390 22,23 (TCTG) 8 (TCTA) 9,0 (TCTG) (TCTA) 4 DYS447 23,24 (TAATA) 7 TAAAA(TAATA) 7,8 TAAAA(TAATA) 7

4 Null allele at DYS448 In 6 samples, null allele at DYS448 were commonly observed using multiplex II and Y-filer Multiplex II AmpFlSTR Yfiler kit Characterization of the null allele at DYS448 Schematic representation of Y-STRs and STS markers , , , , H p.32 p.3 p. 2 q.2 q.22 q.222 q.223 q.23 Scale (Mb) 0.2Mb AZFa AZFb AZFc Azoospermia factor c (AZFc) region 4.94 Mb DYS448 DYS464 DNA (contigs) sy6 sy6 sy9 sy29 sy206 sy206 sy20 3 of 708 samples 3 of 708 samples Null alleles at DYS448 were occurred with partial AZFc deletion.

5 Frequencies of null allele at DYS448 in various ethnic groups Korean Present study 6 in % Nepalese Parkin et al. (2006) FSI 3 in % Malay Chang et al. (2006) FSI Indian Chang et al. (2006) FSI Chinese Chang et al. (2006) FSI Asian in Yfiler database African American in Yfiler database Caucasian (USA) in Yfiler database German Rodig et al. (2006) IJLM Austrian Berger et al. (2005) IJLM in 334 in 35 in 33 2 in in in in in % 0.32% 0.30% 0.6% 0.20% 0.6% 0.00% 0.00% Total 4 in 2787 Asians 0.50% Null allele at DYS448 is observed much more frequently in Asians compared with African Americans and Caucasians. Different allele designation at DYS in multiplex I/II and multiplex III Multiplex I/II Multiplex III 3 samples different by 2 repeat 5 samples different by repeat

6 Design of DYS for small PCR products in multiplex III Forward primer in the multiplex I and II agcatgggtg acagagctag acaccatgcc aaacaacaac aaagaaaaga aatgaaattc agaaaggaag gaaggaagga gaaagaaagt aaaaaagaaa gaaagagaaa aagagaaaaa gaaagaaaga gaagaaagag aaagaggaaa Forward primer in the multiplex III gagaaagaaa ggaaggaagg aaggaaggaa gggaaagaaa gaaagaaaga aagaaagaaa gaaagaaaga aagagaaaaa gaaaggagga ctatgtaatt Reverse primer in the multiplex I and II ggaatagata gattattttt taaaatattt ttattacctt tacagttttt ttaaatgccg ccatttcaga aagaaatctg gtcagcagcc cttaccagct Reverse primer in the multiplex III Allele size ranges Multiplex I and II: bp Multiplex III: bp Characterization of allele designation difference at DYS Due to the deletion mutation in 8 samples, DYS allele designation in multiplex I and II was differently observed from that in multiplex III. 8 bp deletion: (gagaaaaa)2 -N38-(aagg) 6 (GAAA) n 4 bp deletion: (gagaaaaa) 2 -N38- (aagg)6 5(GAAA) n F primer in multiplex I/II agcatgggtg acagagctag acaccatgcc aaacaacaac aaagaaaaga aatgaaattc agaaaggaag gaaggaagga gaaagaaagt aaaaaagaaa gaaagagaaa aagagaaaaa gaaagaaaga gaagaaagag aaagaggaaa F primer in multiplex III 8 bp deletion gagaaagaaa ggaaggaagg aaggaaggaa gggaaagaaa gaaagaaaga R primer in multiplex I/II aagaaagaaa gaaagaaaga aagagaaaaa gaaaggagga ctatgtaatt 4 bp deletion ggaatagata gattattttt taaaatattt ttattacctt tacagttttt R primer in multiplex III ttaaatgccg ccatttcaga aagaaatctg gtcagcagcc cttaccagct

7 Concluding remarks. 8 microvariant alleles at DYS449, 6 intermediate alleles at DYS464, 2 intermediate alleles at DYS458, and duplicated allele at DYS9, DYS390 and DYS447 have been discovered and characterized. 2. The use of DYS448 needs to be considered for genotyping of Asians due to the relatively high frequency of null allele in Asians. 3. By applying small amplicon of DYS in multiplex III, we could efficiently avoid or prevent the allele mis-designation at DYS which occurs as a result of deletion mutation. 4. This work will provide a well-established Korean Y-STR database which can be used as a reference for the interpretation of Y-STR genotyping results in Koreans. Acknowledgement Funding National R&D program of Ministry of Science and Technology (MOST) Korea Science and Engineering Foundation (KOSEF) To our lab members Kyoung-Jin Shin, D.D.S., Ph.D Professor Hwan Young Lee, Ph.D Ukhee Chung, MSc. Na Young Kim, MSc.

Y chromosomal STRs in forensics

Y chromosomal STRs in forensics Haplotype and mutation analysis for newly suggested Y-STRs in Korean father-son pairs Yu Na Oh, Hwan Young Lee, Eun Young Lee, Eun Hey Kim, Woo Ick Yang, Kyoung-Jin Shin Department of Forensic Medicine

More information

Latest Tools for Human Identification

Latest Tools for Human Identification Latest Tools for Human Identification Lisa Calandro, Senior Forensic Scientist Applied Markets Division To hear the audio portion of this seminar, please call the phone number for your country: Australia-1800002092

More information

DNA methylation-based body fluid typing

DNA methylation-based body fluid typing DNA methylation-based body fluid typing Hwan Young Lee Department of Forensic Medicine Yonsei University College of Medicine, Seoul, Korea Forensic Body Fluid Identification Body fluid identification can

More information

Sequence variation in the short tandem repeat system SE33 discovered by next generation sequencing

Sequence variation in the short tandem repeat system SE33 discovered by next generation sequencing Sequence variation in the short tandem repeat system SE33 discovered by next generation sequencing Eszter Rockenbauer, MSc, PhD and Line Møller, MSc Forensic Geneticist Section of Forensic Genetics Department

More information

Analyzing Y-STR mixtures and calculating inclusion statistics

Analyzing Y-STR mixtures and calculating inclusion statistics Analyzing Y-STR mixtures and calculating inclusion statistics Rick W. Staub, Ph.D. and Cassie Johnson, M.S. Orchid Cellmark Inc. Dallas, TX ABSTRACT Forensic evidence samples analyzed with Y-STR multiplexes

More information

Sequence structure of 12 novel Y chromosome microsatellites and PCR amplification strategies

Sequence structure of 12 novel Y chromosome microsatellites and PCR amplification strategies International Congress Series 1239 (2003) 425 429 Sequence structure of 12 novel Y chromosome microsatellites and PCR amplification strategies Anna González-Neira a, Paula Sánchez-Diz a, Leonor Gusmão

More information

Product Catalog 2012 AmplGen Ltd.

Product Catalog 2012 AmplGen Ltd. Professional solutions for Genetic Human Identification and Molecular Diagnostics Product Catalog 2012 AmplGen Ltd. Riga, Lativa 2 Catalog AmplGen 2012, ver. #02 Dear colleagues, AmplGen is new European

More information

Male/female DNA mixtures: a challenge for Y-STR analysis

Male/female DNA mixtures: a challenge for Y-STR analysis International Congress Series 1239 (2003) 295 299 Male/female DNA mixtures: a challenge for Y-STR analysis Burkhard Berger, Harald Niederstätter, Silvano Köchl, Martin Steinlechner, Walther Parson * Institute

More information

Comparison of the Promega Power Y and AB AmpFlSTR YFiler kits and the Subsequent Validation of YFiler.

Comparison of the Promega Power Y and AB AmpFlSTR YFiler kits and the Subsequent Validation of YFiler. Comparison of the Promega Power Y and AB AmpFlSTR YFiler kits and the Subsequent Validation of YFiler. Dr. Timothy P McMahon Armed Forces DNA Identification Laboratory Rockville, Md 301-319 319-0238 Timothy.mcmahon@afip.osd.mil

More information

AmpF STR NGM PCR Amplification Kit - Overview

AmpF STR NGM PCR Amplification Kit - Overview AmpF STR NGM PCR Amplification Kit - Overview The most advanced STR kits optimized for analysis of forensic casework and database samples in Europe Data Quality Worth Sharing! 9/7/2011 Life Technologies

More information

What is DNA? Deoxyribonucleic Acid The inherited genetic material that makes us what we are

What is DNA? Deoxyribonucleic Acid The inherited genetic material that makes us what we are DNA Basic Genetics What is DNA? DNA is Deoxyribonucleic Acid The inherited genetic material that makes us what we are DNA in the Cell Human Genome ~3 billion base pairs of DNA 30,000-35,000 genes Population-each

More information

Notice of Amendment of the FBI s STR Population Data Published in 1999 and 2001

Notice of Amendment of the FBI s STR Population Data Published in 1999 and 2001 Notice of Amendment of the FBI s STR Population Data Published in 1999 and 2001 Recently, new amplification kits that expand the number of loci in a multiplex reaction have become commercially available.

More information

STR Profiling Matching Criteria: Establishment and Importance of a Cell Line Database

STR Profiling Matching Criteria: Establishment and Importance of a Cell Line Database STR Profiling Matching Criteria: Establishment and Importance of a Cell Line Database Margaret Kline Applied Group Biochemical Science Division Chemical Science and Technology Laboratory National Institute

More information

Mutations during meiosis and germ line division lead to genetic variation between individuals

Mutations during meiosis and germ line division lead to genetic variation between individuals Mutations during meiosis and germ line division lead to genetic variation between individuals Types of mutations: point mutations indels (insertion/deletion) copy number variation structural rearrangements

More information

Genetic Identity. Steve Harris SPASH - Biotechnology

Genetic Identity. Steve Harris SPASH - Biotechnology Genetic Identity Steve Harris SPASH - Biotechnology Comparison of Organisms ORGANISM GENES BASE PAIRS Lambda Phage 40 50,000 E.coli 400 5,000,000 Yeast 13,000 15,000,000 Human 20,000 3,000,000,000 (3 billion)

More information

Evaluation of Genome wide SNP Haplotype Blocks for Human Identification Applications

Evaluation of Genome wide SNP Haplotype Blocks for Human Identification Applications Ranajit Chakraborty, Ph.D. Evaluation of Genome wide SNP Haplotype Blocks for Human Identification Applications Overview Some brief remarks about SNPs Haploblock structure of SNPs in the human genome Criteria

More information

The Polymerase Chain Reaction. Chapter 6: Background

The Polymerase Chain Reaction. Chapter 6: Background The Polymerase Chain Reaction Chapter 6: Background PCR Amplify= Polymerase Chain Reaction (PCR) Invented in 1984 Applications Invention of PCR Kary Mullis Mile marker 46.58 in April of 1983 Pulled off

More information

AmpFlSTR Identifiler PCR Amplification Kit

AmpFlSTR Identifiler PCR Amplification Kit Product Bulletin Human Identification AmpFlSTR Identifiler PCR Amplification Kit Fifteen STR (short tandem repeat) loci and Amelogenin co-amplified in a single tube Incorporation of the same proven, reliable

More information

FORENSIC GENETICS. DNA in the cell FORENSIC GENETICS PERSONAL IDENTIFICATION KINSHIP ANALYSIS FORENSIC GENETICS. Sources of biological evidence

FORENSIC GENETICS. DNA in the cell FORENSIC GENETICS PERSONAL IDENTIFICATION KINSHIP ANALYSIS FORENSIC GENETICS. Sources of biological evidence FORENSIC GENETICS FORENSIC GENETICS PERSONAL IDENTIFICATION KINSHIP ANALYSIS FORENSIC GENETICS Establishing human corpse identity Crime cases matching suspect with evidence Paternity testing, even after

More information

Report of Analyzing Short Tandem Repeats for Parentage Testing

Report of Analyzing Short Tandem Repeats for Parentage Testing 1 Alex Michael Tseng Department of Forensic Medicine, College of Medicine, National Taiwan University Report of Analyzing Short Tandem Repeats for Parentage Testing Introduction In the three billion letter

More information

A genetic database for DNA-based forensic analysis in Brunei Darussalam

A genetic database for DNA-based forensic analysis in Brunei Darussalam DNA-STR typing in Brunei 1 A genetic database for DNA-based forensic analysis in Brunei Darussalam Poh Yee Cheong 1, Paul V.O. Liew 1, Hamydon Ibrahim 1, Bruce Budowle 2 1 Forensic Biology/DNA Laboratory,

More information

Development of a Global STR Multiplex for Human Identification Analysis

Development of a Global STR Multiplex for Human Identification Analysis Development of a Global STR Multiplex for Human Identification Analysis Jonathan Tabak Life Technologies 1 Agenda Introduction Multiplex Configuration Strategy Application-Specific Development and Testing

More information

Intestinal Epithelial Cell-Specific Deletion of PLD2 Alleviates DSS-Induced Colitis by. Regulating Occludin

Intestinal Epithelial Cell-Specific Deletion of PLD2 Alleviates DSS-Induced Colitis by. Regulating Occludin Intestinal Epithelial Cell-Specific Deletion of PLD2 Alleviates DSS-Induced Colitis by Regulating Occludin Chaithanya Chelakkot 1,ǂ, Jaewang Ghim 2,3,ǂ, Nirmal Rajasekaran 4, Jong-Sun Choi 5, Jung-Hwan

More information

Data Quality Worth Sharing

Data Quality Worth Sharing Product Bulletin Human Identification AmpFlSTR NGM and NGM SElect PCR Amplification Kits Next generation amplification chemistries including the 5 new loci from the expanded European Standard Set Enhanced

More information

CHAPTER THREE RESULTS

CHAPTER THREE RESULTS CHAPTER THREE RESULTS 3.1 PCR-SSP In this study, the PCR SSP technique was used to amplify the GYP hybrid gene from the genomic DNA samples and detect GP.Mur, GP.Bun, GP.Hop (148 bp), GP.HF and GP.Hut

More information

The Real CSI: Using DNA to Identify Criminals and Missing Persons

The Real CSI: Using DNA to Identify Criminals and Missing Persons The Real CSI: Using DNA to Identify Criminals and Missing Persons San Jose State University May 2, 2012 Overview Forensic DNA in the media perceptions and reality The power and limitations of nuclear (STR)

More information

Massively Parallel Sequencing and STR Typing Basics and Forensic Applications

Massively Parallel Sequencing and STR Typing Basics and Forensic Applications Massively Parallel Sequencing and STR Typing Basics and Forensic Applications Bruce Budowle Institute of Applied Genetics Department of Molecular and Medical Genetics, University of North Texas Health

More information

JS 190- Population Genetics- Assessing the Strength of the Evidence Pre class activities

JS 190- Population Genetics- Assessing the Strength of the Evidence Pre class activities JS 190- Population Genetics- Assessing the Strength of the Evidence I. Pre class activities a. Quiz then Review Assignments and Schedule II. Learning Objectives a. Overview of Validation Developmental

More information

Procedure for GeneMapper ID-X for Casework

Procedure for GeneMapper ID-X for Casework Procedure for GeneMapper ID-X for Casework 1.0 Purpose-This procedure specifies the steps for performing analysis on DNA samples amplified with AmpFlSTR Identifiler Plus using the GeneMapper ID-X (GMID-X)

More information

QIAGEN Whole Genome Amplification REPLI-g Eliminating Sample Limitations, Potential Use for Reference Material

QIAGEN Whole Genome Amplification REPLI-g Eliminating Sample Limitations, Potential Use for Reference Material QIAGEN Whole Genome Amplification REPLI-g Eliminating Sample Limitations, Potential Use for Reference Material MDA Technology Protocols Locus Bias Applications Kits & Service Summary QIAGEN REPLI-g WGA

More information

Forensic DNA Testing. Forensic DNA Testing. Maj Gen (R) Suhaib Ahmed, HI (M)

Forensic DNA Testing. Forensic DNA Testing. Maj Gen (R) Suhaib Ahmed, HI (M) Maj Gen (R) Suhaib Ahmed, HI (M) DNA from no two individuals except identical twins is alike. The person to person differences in DNA can be discovered by PCR amplification and genomic sequencing. The

More information

Development of a Global STR Multiplex for Human Identification Analysis. Julio Mulero, Ph. D. R&D Group Human Identification, Life Technologies

Development of a Global STR Multiplex for Human Identification Analysis. Julio Mulero, Ph. D. R&D Group Human Identification, Life Technologies Development of a Global STR Multiplex for Human Identification Analysis Julio Mulero, Ph. D. R&D Group Human Identification, Life Technologies Agenda Why a global multiplex? Multiplex Configuration Strategy

More information

Investigator Quantiplex HYres Kit

Investigator Quantiplex HYres Kit These specifications are for the procurement of a validation study at GBI Division of Forensic Sciences facilities of two commercially available kits used in forensic DNA analysis. The two kits to be validated

More information

Alignment and annotation of forensic STR data generated from MPS analysis: Notes from the sequence workbench

Alignment and annotation of forensic STR data generated from MPS analysis: Notes from the sequence workbench Alignment and annotation of forensic STR data generated from MPS analysis: Notes from the sequence workbench Chris Phillips, Katherine Gettings, Jonathan King, Christophe van Neste, Walther Parson Capillary

More information

GlobalFiler Kit Casework Test Site Results and Other Development Updates

GlobalFiler Kit Casework Test Site Results and Other Development Updates GlobalFiler Kit Casework Test Site Results and Other Development Updates April Orbison Sr. Field Applications Specialist Human Identification 1 Agenda GlobalFiler Kit Update: Recent Casework Test Site

More information

Data Sources and Biobanks in the Asia-Pacific Region. Wei Zhou, MD, Ph.D. Department of Epidemiology, Merck Research Laboratories October 23, 2014

Data Sources and Biobanks in the Asia-Pacific Region. Wei Zhou, MD, Ph.D. Department of Epidemiology, Merck Research Laboratories October 23, 2014 Data Sources and Biobanks in the Asia-Pacific Region Wei Zhou, MD, Ph.D. Department of Epidemiology, Merck Research Laboratories October 23, 2014 1 Disclosures Wei Zhou is currently an employee of Merck

More information

DNA Collection. Data Quality Control. Whole Genome Amplification. Whole Genome Amplification. Measure DNA concentrations. Pros

DNA Collection. Data Quality Control. Whole Genome Amplification. Whole Genome Amplification. Measure DNA concentrations. Pros DNA Collection Data Quality Control Suzanne M. Leal Baylor College of Medicine sleal@bcm.edu Copyrighted S.M. Leal 2016 Blood samples For unlimited supply of DNA Transformed cell lines Buccal Swabs Small

More information

Procedure for Casework DNA Interpretation

Procedure for Casework DNA Interpretation Procedure for Casework DNA Interpretation 1.0 Purpose The purpose of this document is to provide guidelines for the interpretation of autosomal DNA results when amplified with Identifiler Plus. 2.0 Scope

More information

Laboratory Exercise 4. Multiplex PCR of Short Tandem Repeats and Vertical Polyacrylamide Gel Electrophoresis.

Laboratory Exercise 4. Multiplex PCR of Short Tandem Repeats and Vertical Polyacrylamide Gel Electrophoresis. Laboratory Exercise 4 4 Multiplex PCR of Short Tandem Repeats and Vertical Polyacrylamide Gel Electrophoresis B A C K G R O U N D The human genome contains over 3000 million base pairs, which are distributed

More information

Characterization of 26 MiniSTR Loci for Improved Analysis of Degraded DNA Samples

Characterization of 26 MiniSTR Loci for Improved Analysis of Degraded DNA Samples J Forensic Sci, January 2008, Vol. 53, No. 1 doi: 10.1111/j.1556-4029.2008.00595.x Available online at: www.blackwell-synergy.com Carolyn R. Hill, M.S.; Margaret C. Kline, M.S.; Michael D. Coble, Ph.D.;

More information

Short Tandem Repeat (STR) Analysis

Short Tandem Repeat (STR) Analysis Maj Gen (R) Suhaib Ahmed, HI (M) Short tandem repeats (STR) are randomly distributed DNA sequences in which 2-6bp are tandemly repeated. These are scattered on all chromosomes including the autosomes as

More information

RADSeq Data Analysis. Through STACKS on Galaxy. Yvan Le Bras Anthony Bretaudeau Cyril Monjeaud Gildas Le Corguillé

RADSeq Data Analysis. Through STACKS on Galaxy. Yvan Le Bras Anthony Bretaudeau Cyril Monjeaud Gildas Le Corguillé RADSeq Data Analysis Through STACKS on Galaxy Yvan Le Bras Anthony Bretaudeau Cyril Monjeaud Gildas Le Corguillé RAD sequencing: next-generation tools for an old problem INTRODUCTION source: Karim Gharbi

More information

GenPlex HID Training Class I

GenPlex HID Training Class I Rixun Fang GenPlex HID Training Class I Outline of Presentation Introduction GenPlex HID kit Experimental plan Class schedule Forensic SNP Analysis GenPlex HID Training Class I 2 Potential Forensic Applications

More information

The Polymerase Chain Reaction. Chapter 6: Background

The Polymerase Chain Reaction. Chapter 6: Background The Polymerase Chain Reaction Chapter 6: Background Invention of PCR Kary Mullis Mile marker 46.58 in April of 1983 Pulled off the road and outlined a way to conduct DNA replication in a tube Worked for

More information

Validation of Identity and Ancestry SNP Panels for the Ion PGM

Validation of Identity and Ancestry SNP Panels for the Ion PGM Validation of Identity and Ancestry SNP Panels for the Ion PGM Christopher Phillips, Carla Santos, Maria de la Puente, Manuel Fondevila, Ángel Carracedo, Maviky Lareu Forensic Genetics Unit, University

More information

EUROPEAN DNA PROFILING GROUP (EDNAP) MEETING

EUROPEAN DNA PROFILING GROUP (EDNAP) MEETING EUROPEAN DNA PROFILING GROUP (EDNAP) MEETING ROME, ITALY 12 13 SEPTEMBER 2007 Host: Alberto Intini and Renato Biondo. Chairman: Niels Morling. A list of participants is attached. Welcome Alberto Intini

More information

A CRISPR/Cas9 Vector System for Tissue-Specific Gene Disruption in Zebrafish

A CRISPR/Cas9 Vector System for Tissue-Specific Gene Disruption in Zebrafish Developmental Cell Supplemental Information A CRISPR/Cas9 Vector System for Tissue-Specific Gene Disruption in Zebrafish Julien Ablain, Ellen M. Durand, Song Yang, Yi Zhou, and Leonard I. Zon % larvae

More information

Genetic analysis of eight x-chromosomal short tandem repeat loci in Iraqi population using the Mentype Argus X-UL PCR amplification kit

Genetic analysis of eight x-chromosomal short tandem repeat loci in Iraqi population using the Mentype Argus X-UL PCR amplification kit Vol. 14(30), pp. 2341-2351, 29 July, 2015 DOI: 10.5897/AJB2015.14422 Article Number: 996414654423 ISSN 1684-5315 Copyright 2015 Author(s) retain the copyright of this article http://www.academicjournals.org/ajb

More information

DNA Mixture Interpretation Workshop Dr Chris Maguire. Identification and resolution of DNA mixtures

DNA Mixture Interpretation Workshop Dr Chris Maguire. Identification and resolution of DNA mixtures DNA Mixture Interpretation Workshop Dr Chris Maguire Identification and resolution of DNA mixtures Introduction Mixture analysis models Pros & Cons Recognizing a DNA Mixture Extra peaks Peak imbalance

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature09937 a Name Position Primersets 1a 1b 2 3 4 b2 Phenotype Genotype b Primerset 1a D T C R I E 10000 8000 6000 5000 4000 3000 2500 2000 1500 1000 800 Donor (D)

More information

Validation of PowerPlex Y23 PCR Amplification System for Forensic Casework

Validation of PowerPlex Y23 PCR Amplification System for Forensic Casework Validation of PowerPlex Y23 PCR Amplification System for Forensic Casework Jessica Tokarz (B.S.) 1, Sarah Foster (B.S.) 2, Scott Milne (B.S.) 2, Pamela Staton (PhD) 1, Kathleen Press (M.S.F.S.) 3 1 Marshall

More information

Introducing: 3Zomy Aneuploidity Test

Introducing: 3Zomy Aneuploidity Test Introducing: 3Zomy Aneuploidity Test QF-PCR Life Technologies (India) Pvt. Ltd. 306, Aggarwal City Mall, Opposite M2K Pitampura, Delhi 110034 (INDIA). Ph: +91-11-42208000, 4220811, 42208222 Mobile: +91-9810521400

More information

Allele and Haplotype Frequencies of Y-Short Tandem Repeat Loci in Turkey

Allele and Haplotype Frequencies of Y-Short Tandem Repeat Loci in Turkey 44(3):310-314,2003 FORENSIC SCIENCES Allele and Haplotype Frequencies of Y-Short Tandem Repeat Loci in Turkey Faruk Aºicioglu, Fatih Akyüz, Ümit Çetinkaya, Mehmet Ali Canli Department of Biology, Council

More information

Target Enrichment Strategies for Next Generation Sequencing

Target Enrichment Strategies for Next Generation Sequencing Target Enrichment Strategies for Next Generation Sequencing Anuj Gupta, PhD Agilent Technologies, New Delhi Genotypic Conference, Sept 2014 NGS Timeline Information burst Nearly 30,000 human genomes sequenced

More information

MHC Region. MHC expression: Class I: All nucleated cells and platelets Class II: Antigen presenting cells

MHC Region. MHC expression: Class I: All nucleated cells and platelets Class II: Antigen presenting cells DNA based HLA typing methods By: Yadollah Shakiba, MD, PhD MHC Region MHC expression: Class I: All nucleated cells and platelets Class II: Antigen presenting cells Nomenclature of HLA Alleles Assigned

More information

New Autosomal and Y-Chromosome STR Loci: Characterization and Potential Uses*

New Autosomal and Y-Chromosome STR Loci: Characterization and Potential Uses* New Autosomal and Y-Chromosome STR Loci: Characterization and Potential Uses* John M. Butler 1, Carolyn R. Hill 1, Amy E. Decker 1, Margaret C. Kline 1, Thomas M. Reid 2, and Peter M. Vallone 1 1 Biochemical

More information

PowerPlex. Y System Validation

PowerPlex. Y System Validation PowerPlex Y System Validation By Patricia M. Fulmer, Dawn Rabbach, Kimberly Huston, Curtis Knox and Cynthia Sprecher, Promega Corporation Abstract We have improved the manufacturing process for the PowerPlex

More information

Appendix - I. Primer and Probe Sequences. MTUS1 gene

Appendix - I. Primer and Probe Sequences. MTUS1 gene - I Primer and Probe Sequences MTUS1 gene MDel-F: 5' TGCATTTTTCTTCCTGTTTGG 3' (21 bases) MDel-R: 5' ATATCCTGTGCTCCTCACTGC 3' (21 bases) MEx4-F: 5' CCTTGAAAACTGCACAGTCG 3' (20 bases) MEx4-R: 5' CTCAGCTCACTGTGGGTGCT

More information

Table S1. List of primers used in this study

Table S1. List of primers used in this study Table S1. List of primers used in this study Name KanMx-F2 KanMx-A2 FEN1-DG-S FEN1-DG-A SUR4-DG-S SUR4-DG-A CaARG4-R1130 CaARG4-F61 CaHIS1-DR CaHIS1-ter CaFEN1-US1 CaFEN1-UA1 CaFEN1-DS2 CaFEN1-DA2 CaFEN1-DG-S

More information

Development of a Global STR Multiplex for Human Identification Analysis

Development of a Global STR Multiplex for Human Identification Analysis Development of a Global STR Multiplex for Human Identification Analysis ISHI 2012 Dennis Wang Sr. Staff Scientist Human Identification Group 1 Agenda Why a Global Multiplex? Multiplex Configuration Strategy

More information

General Characteristics and Population Genetic Application of Chromosome Y Microsatellites

General Characteristics and Population Genetic Application of Chromosome Y Microsatellites Peter de Knijff 1, Manfred Kayser 2, Lutz Roewer 2 1 MGC-Dept. of Human Genetics, Leiden University Medical Center, POBox 9503, Leiden, The Netherlands. 2 Institut für Rechtsmedizin, Humboldt-Universität

More information

STR Interpretation Guidelines

STR Interpretation Guidelines Introduction: STR Interpretation Guidelines The interpretation of results in casework is necessarily a matter of professional judgment and expertise. Not every situation can or should be covered by a pre-set

More information

HLA and Next Generation Sequencing it s all about the Data

HLA and Next Generation Sequencing it s all about the Data HLA and Next Generation Sequencing it s all about the Data John Ord, NHSBT Colindale and University of Cambridge BSHI Annual Conference Manchester September 2014 Introduction In 2003 the first full public

More information

A critical review for DNA polymorphic markers and blood group markers in paternity testing

A critical review for DNA polymorphic markers and blood group markers in paternity testing International Congress Series 1239 (2003) 749 753 A critical review for DNA polymorphic markers and blood group markers in paternity testing A. Sawaguchi*, X. Wang, T. Sawaguchi Department of Legal Medicine,

More information

Introducing the Applied Biosystems TM Precision ID NGS System for Human Identification

Introducing the Applied Biosystems TM Precision ID NGS System for Human Identification Introducing the Applied Biosystems TM Precision ID NGS System for Human Identification Sheri J. Olson Director, Product Management Casework Human Identification Current challenges for forensic scientists

More information

Microsatellite repeat motif and amplicon length affect amplification success of. degraded faecal DNA

Microsatellite repeat motif and amplicon length affect amplification success of. degraded faecal DNA Microsatellite repeat motif and amplicon length affect amplification success of degraded faecal DNA Alida de Flamingh a, Catherine L. Sole b, Rudi J. van Aarde a a Conservation Ecology Research Unit, Department

More information

Laboratory Validation. Chapter 16

Laboratory Validation. Chapter 16 Laboratory Validation Chapter 16 Importance The DNA profile is used to convict or free a suspect It must be perfect! No mistakes like we have in regular laboratories all the time Also DNA evidence must

More information

Caenorhabditis elegans: The Heavyweight Champ of Gene Knockout Technology

Caenorhabditis elegans: The Heavyweight Champ of Gene Knockout Technology Caenorhabditis elegans: The Heavyweight Champ of Gene Knockout Technology Rachel Pan The nematode (worm) Caenorhabditis elegans was the first multicellular organism to have its genome, or complete DNA

More information

Mentype Argus X-12 PCR Amplification Kit

Mentype Argus X-12 PCR Amplification Kit Mentype Argus X-12 PCR Amplification Kit Product description The Mentype Argus X-12 PCR Amplification Kit is a multiplex application for twelve X-chromosomal Short Tandem Repeat (STR) loci that supplements

More information

Advanced Topics at Family Tree DNA Part 1: Y-DNA

Advanced Topics at Family Tree DNA Part 1: Y-DNA Advanced Topics at Family Tree DNA Part 1: Y-DNA Presented By Elise Friedman, Relative Roots Take your genetic genealogy knowledge to the next level! This presentation further details the usage & genetics

More information

MULTIPLEX QUANTITATIVE REAL-TIME POLYMERASE CHAIN REACTION (qpcr) AS A METHOD FOR DETECTING PCR AMPLICON CONTAMINATION OF FORENSIC DNA SAMPLES

MULTIPLEX QUANTITATIVE REAL-TIME POLYMERASE CHAIN REACTION (qpcr) AS A METHOD FOR DETECTING PCR AMPLICON CONTAMINATION OF FORENSIC DNA SAMPLES MULTIPLEX QUANTITATIVE REAL-TIME POLYMERASE CHAIN REACTION (qpcr) AS A METHOD FOR DETECTING PCR AMPLICON CONTAMINATION OF FORENSIC DNA SAMPLES Tessa Charlotte Dadd BSc (Genetics & Microbiology) & GDipForSci

More information

rjlflemmers, LUMC, Leiden, The Netherlands 6/3/2010

rjlflemmers, LUMC, Leiden, The Netherlands 6/3/2010 Genotyping of the SSLP The simple sequence length polymorphism (SSLP) 3.5 kb proximal to D4Z4 is studied by PCR and the sequence is localized between positions 1532 and 1694 of AF117653 (see figure below).

More information

1a. What is the ratio of feathered to unfeathered shanks in the offspring of the above cross?

1a. What is the ratio of feathered to unfeathered shanks in the offspring of the above cross? Problem Set 5 answers 1. Whether or not the shanks of chickens contains feathers is due to two independently assorting genes. Individuals have unfeathered shanks when they are homozygous for recessive

More information

The Evolution of Short Tandem Repeat (STR) Multiplex Systems

The Evolution of Short Tandem Repeat (STR) Multiplex Systems Ann M. Lins, Cynthia J. Sprecher, Katherine A. Micka, Dawn R. Rabbach, Jennifer A. Taylor, Jeffrey W. Bacher, Laura F. Hennes, Allan Tereba, Trent Gu, Elizabeth A. Amiott, Nadine A. Nassif and James W.

More information

Certificate of Analysis of the Holotype HLA 24/7 Configuration A1 & CE

Certificate of Analysis of the Holotype HLA 24/7 Configuration A1 & CE Certificate of Analysis of the Holotype HLA 24/7 Configuration A1 & CE Product name Holotype HLA 24/7 Configuration A1 & CE Reference number H52 LOT number 00027 (N4/002-P5/006-E1/004-R2/006) Expiration

More information

Population Genetics (Learning Objectives)

Population Genetics (Learning Objectives) Population Genetics (Learning Objectives) Define the terms population, species, allelic and genotypic frequencies, gene pool, and fixed allele, genetic drift, bottle-neck effect, founder effect. Explain

More information

Generating Forensic DNA Profiles

Generating Forensic DNA Profiles Wright State University CORE Scholar Biological Sciences Faculty Publications Biological Sciences 12-2012 Generating Forensic DNA Profiles Dan E. Krane Wright State University - Main Campus, dan.krane@wright.edu

More information

Automated purification of DNA from bones of a Bronze Age family using the BioRobot EZ1 workstation

Automated purification of DNA from bones of a Bronze Age family using the BioRobot EZ1 workstation Application Note Automated purification of DNA from bones of a Bronze Age family using the BioRobot EZ1 workstation Felix Schilz, Diane Schmidt, and Susanne Hummel Historic Anthropology and Human Ecology,

More information

Systematic Analysis of single cells by PCR

Systematic Analysis of single cells by PCR Systematic Analysis of single cells by PCR Wolfgang Mann 27th March 2007, Weihenstephan Overview AmpliGrid Technology Examples DNA Forensics Single Cell Sequencing Polar Body Diagnostics Single Cell RT

More information

QIAGEN Validation Report

QIAGEN Validation Report QIAGEN Validation Report Developmental validation of the Investigator ESSplex SE Plus Kit The QIAGEN Investigator ESSplex SE Plus Kit is intended for molecular biology applications in forensic, human identity,

More information

Genome research in eukaryotes

Genome research in eukaryotes Functional Genomics Genome and EST sequencing can tell us how many POTENTIAL genes are present in the genome Proteomics can tell us about proteins and their interactions The goal of functional genomics

More information

LATE-PCR. Linear-After-The-Exponential

LATE-PCR. Linear-After-The-Exponential LATE-PCR Linear-After-The-Exponential A Patented Invention of the Laboratory of Human Genetics and Reproductive Biology Lab. Director: Lawrence J. Wangh, Ph.D. Department of Biology, Brandeis University,

More information

John M. Butler and Peter M. Vallone National Institute of Standards and Technology

John M. Butler and Peter M. Vallone National Institute of Standards and Technology DNA Biometrics: i Standards and Technology John M. Butler and Peter M. Vallone National Institute of Standards and Technology NDIA Biometrics Conference (Arlington VA) NDIA Biometrics Conference (Arlington,

More information

Harnessing the power of RADseq for ecological and evolutionary genomics

Harnessing the power of RADseq for ecological and evolutionary genomics STUDY DESIGNS Harnessing the power of RADseq for ecological and evolutionary genomics Kimberly R. Andrews 1, Jeffrey M. Good 2, Michael R. Miller 3, Gordon Luikart 4 and Paul A. Hohenlohe 5 Abstract High-throughput

More information

Molecular Markers CRITFC Genetics Workshop December 9, 2014

Molecular Markers CRITFC Genetics Workshop December 9, 2014 Molecular Markers CRITFC Genetics Workshop December 9, 2014 Molecular Markers Tools that allow us to collect information about an individual, a population, or a species Application in fisheries mating

More information

LightScanner Hi-Res Melting Comparison of Six Master Mixes for Scanning and Small Amplicon and LunaProbes Genotyping

LightScanner Hi-Res Melting Comparison of Six Master Mixes for Scanning and Small Amplicon and LunaProbes Genotyping LightScanner Hi-Res Melting Comparison of Six Master Mixes for Scanning and Small Amplicon and LunaProbes Genotyping Introduction Commercial master mixes are convenient and cost-effective solutions for

More information

BIOLOGY Dr.Locke Lecture# 27 An Introduction to Polymerase Chain Reaction (PCR)

BIOLOGY Dr.Locke Lecture# 27 An Introduction to Polymerase Chain Reaction (PCR) BIOLOGY 207 - Dr.Locke Lecture# 27 An Introduction to Polymerase Chain Reaction (PCR) Required readings and problems: Reading: Open Genetics, Chapter 8.1 Problems: Chapter 8 Optional Griffiths (2008) 9

More information

4.1. Genetics as a Tool in Anthropology

4.1. Genetics as a Tool in Anthropology 4.1. Genetics as a Tool in Anthropology Each biological system and every human being is defined by its genetic material. The genetic material is stored in the cells of the body, mainly in the nucleus of

More information

DNA Mixture Interpretation Workshop Michael D. Coble, PhD. Current SWGDAM Guidelines

DNA Mixture Interpretation Workshop Michael D. Coble, PhD. Current SWGDAM Guidelines DNA Mixture Interpretation Workshop Michael D. Coble, PhD Current SWGDAM Guidelines Hierarchy of Rules for Forensic DNA Labs Validation Audits United States FBI (DAB) Quality Assurance Standards NDIS Procedures

More information

GENE MAPPING. Genetica per Scienze Naturali a.a prof S. Presciuttini

GENE MAPPING. Genetica per Scienze Naturali a.a prof S. Presciuttini GENE MAPPING Questo documento è pubblicato sotto licenza Creative Commons Attribuzione Non commerciale Condividi allo stesso modo http://creativecommons.org/licenses/by-nc-sa/2.5/deed.it Genetic mapping

More information

Development and Validation of the 3500 Series Genetic Analyzer for Human Identification

Development and Validation of the 3500 Series Genetic Analyzer for Human Identification Development and Validation of the 3500 Series Genetic Analyzer for Human Identification Jeff Sailus Forensic Science Applications Group 1 Development of a Next Generation Genetic Analyzer A Whole System

More information

DISTRIBUTION OF ABO GENOTYPES AND ALLELE FREQUENCIES IN A KOREAN POPULATION

DISTRIBUTION OF ABO GENOTYPES AND ALLELE FREQUENCIES IN A KOREAN POPULATION Jpn J Human Genet 42, 331-335, 1997 DISTRIBUTION OF ABO GENOTYPES AND ALLELE FREQUENCIES IN A KOREAN POPULATION Sung Ha KANG, x'2 Yasuo FUKUMORI, 1'* Shiro OHNOKI, 1 Hirotoshi SHIBATA, 1 Kyou Sup HAN,

More information

44(31: ,2003 FORENSIC SCIENCES

44(31: ,2003 FORENSIC SCIENCES 44(31:310-314,2003 FORENSIC SCIENCES Allele and Haplotype Frequencies of Y-Short Tandem Repeat Loci in Turkey Faruk Aşicioglu, Fatih Akyiiz, Omit Çetinkaya, Mehmet Ali Canli Department of Biology, Council

More information

Uniparental disomy (UPD) analysis of chromosome 15

Uniparental disomy (UPD) analysis of chromosome 15 YOUR INNOVATIVE RESEARCH Analysis of UPD by STR-PCR Uniparental disomy (UPD) analysis of chromosome 15 Applied Biosystems 3500xL Genetic Analyzer Introduction Researchers at the Laboratory of Medical Genetics

More information

Analysis of genetic polymorphism of nine short tandem repeat loci in Chinese Han population of Henan province

Analysis of genetic polymorphism of nine short tandem repeat loci in Chinese Han population of Henan province African Journal of Biotechnology Vol. 11(22), pp. 5988-5994, 15 March, 2012 Available online at http://www.academicjournals.org/ajb DOI: 10.5897/AJB11.3642 ISSN 1684 5315 2012 Academic Journals Full Length

More information

Biotechnology. Explorer Program. Serious About Science Education 5/17/09 1

Biotechnology. Explorer Program. Serious About Science Education 5/17/09 1 Biotechnology Explorer Program Serious About Science Education 5/17/09 1 Chromosome 8: PCR TM PCR Workshop Kirk Brown,, Tracy High School; Tracy, Ca Stan Hitomi,, Monte Vista High School; Danville, CA

More information

The Job Classification System and Certification. Lists of Construction Industry - Focused on Construction Technicians

The Job Classification System and Certification. Lists of Construction Industry - Focused on Construction Technicians Contemporary Engineering Sciences, Vol. 7, 2014, no. 21, 1053-1060 HIKARI Ltd, www.m-hikari.com http://dx.doi.org/10.12988/ces.2014.49132 The Job Classification System and Certification Lists of Construction

More information

Amplicon Sequencing Template Preparation

Amplicon Sequencing Template Preparation Amplicon Sequencing Template Preparation The DNA sample preparation procedure for Amplicon Sequencing consists of a simple PCR amplification reaction, but uses special Fusion Primers (Figure 1-1). The

More information