Genetic characteristics of 22 Y-STRs in Koreans:
|
|
- Charla Henry
- 6 years ago
- Views:
Transcription
1 Genetic characteristics of 22 Y-STRs in Koreans: Intermediate, null, and duplicated alleles and deletions in the DYS flanking region Myung Jin Park, Hwan Young Lee, Ukhee Chung, Na Young Kim, Woo Ick Yang, Sang-Ho Cho, Kyoung-Jin Shin Department of Forensic Medicine, Yonsei University College of Medicine, Seoul, Korea Human Identification Research Center, Yonsei University, Seoul, Korea Establishment of a Korean Y-STR database for 22 Y-STRs 22 Y-STRs DYS9, DYS, DYS388, DYS389I/II, DYS390, DYS39, DYS392, DYS393, DYS437, DYS438, DYS439, DYS446, DYS447, DYS448, DYS449, DYS456, DYS458, DYS464, DYS635 and GATA H4. 3 multiplex PCR systems 708 unrelated Korean males Haplotype alleles analysis and characterization of atypical
2 Schematic of 3 multiplex PCRs for 22 Y-STRs 00 bp 50 bp 200 bp 250 bp 300 bp I I II II H III DYS was included in each multiplex to detect sample switching Small amplicon was designed for DYS in multiplex III ( bp vs bp) Y-STR analysis in 708 Koreans Y-STR haplotype No. of haplotype Haplotype diversity Discriminatory power Minimal Haplotype loci Y-filer loci haplotype Y-STRs haplotype Atypical alleles Intermediate alleles at DYS447, DYS449, DYS458 and DYS464 Duplicated alleles at DYS9, DYS390 and DYS447 Null allele at DYS448 Different allele designation at DYS depending on the primer binding site
3 Microvariant and intermediate alleles in DYS447, DYS449, DYS458 and DYS464 Locus Allele Sequence structure N DYS447 8 (TAATA) 7 TAAAA (TAATA) 0 TAAAA(TAATA) n 2 9 (TAATA) 7 TAAAA (TAATA) TAAAA(TAATA) n 4 DYS (25)* (TTTC) 2 -tctc-n0-n32-cttc-(tttc) 4 30 (30.)* (TTTC) 6 -tctc-n0-n32-ctttc-(tttc) 4 33 (42)* (TTTC) 5 -tctc-n0-[n32-cttc] 2 -(TTTC) 8 DYS458 DYS (TTTC) 3 TC(TTTC) 0 -tctc-n0-n32-cttc-(tttc) (TTTC) 3 TT(TTTC) -tctc-n0-n32-cttc-(tttc) (TTTC) 3 TC(TTTC) 0 -tctc-n0-n32-cttc-(tttc) (TTTC) 6 -tctc-n0-n32-cttc- (TTTC) 0 TT(TTTC) (GAAA) 4 G 7.2 (GAAA) 5 AA(GAAA) (CCTT) 7 CTT(CCTT) (CCTT) 3 CTT(CCTT) 5 * Ostensible alleles at DYS449 Duplicated alleles at DYS9, DYS390 and DYS447 Locus Allele Sequence structure DYS9 6,7 (TAGA) 3 tagg(taga) 3,4 DYS390 22,23 (TCTG) 8 (TCTA) 9,0 (TCTG) (TCTA) 4 DYS447 23,24 (TAATA) 7 TAAAA(TAATA) 7,8 TAAAA(TAATA) 7
4 Null allele at DYS448 In 6 samples, null allele at DYS448 were commonly observed using multiplex II and Y-filer Multiplex II AmpFlSTR Yfiler kit Characterization of the null allele at DYS448 Schematic representation of Y-STRs and STS markers , , , , H p.32 p.3 p. 2 q.2 q.22 q.222 q.223 q.23 Scale (Mb) 0.2Mb AZFa AZFb AZFc Azoospermia factor c (AZFc) region 4.94 Mb DYS448 DYS464 DNA (contigs) sy6 sy6 sy9 sy29 sy206 sy206 sy20 3 of 708 samples 3 of 708 samples Null alleles at DYS448 were occurred with partial AZFc deletion.
5 Frequencies of null allele at DYS448 in various ethnic groups Korean Present study 6 in % Nepalese Parkin et al. (2006) FSI 3 in % Malay Chang et al. (2006) FSI Indian Chang et al. (2006) FSI Chinese Chang et al. (2006) FSI Asian in Yfiler database African American in Yfiler database Caucasian (USA) in Yfiler database German Rodig et al. (2006) IJLM Austrian Berger et al. (2005) IJLM in 334 in 35 in 33 2 in in in in in % 0.32% 0.30% 0.6% 0.20% 0.6% 0.00% 0.00% Total 4 in 2787 Asians 0.50% Null allele at DYS448 is observed much more frequently in Asians compared with African Americans and Caucasians. Different allele designation at DYS in multiplex I/II and multiplex III Multiplex I/II Multiplex III 3 samples different by 2 repeat 5 samples different by repeat
6 Design of DYS for small PCR products in multiplex III Forward primer in the multiplex I and II agcatgggtg acagagctag acaccatgcc aaacaacaac aaagaaaaga aatgaaattc agaaaggaag gaaggaagga gaaagaaagt aaaaaagaaa gaaagagaaa aagagaaaaa gaaagaaaga gaagaaagag aaagaggaaa Forward primer in the multiplex III gagaaagaaa ggaaggaagg aaggaaggaa gggaaagaaa gaaagaaaga aagaaagaaa gaaagaaaga aagagaaaaa gaaaggagga ctatgtaatt Reverse primer in the multiplex I and II ggaatagata gattattttt taaaatattt ttattacctt tacagttttt ttaaatgccg ccatttcaga aagaaatctg gtcagcagcc cttaccagct Reverse primer in the multiplex III Allele size ranges Multiplex I and II: bp Multiplex III: bp Characterization of allele designation difference at DYS Due to the deletion mutation in 8 samples, DYS allele designation in multiplex I and II was differently observed from that in multiplex III. 8 bp deletion: (gagaaaaa)2 -N38-(aagg) 6 (GAAA) n 4 bp deletion: (gagaaaaa) 2 -N38- (aagg)6 5(GAAA) n F primer in multiplex I/II agcatgggtg acagagctag acaccatgcc aaacaacaac aaagaaaaga aatgaaattc agaaaggaag gaaggaagga gaaagaaagt aaaaaagaaa gaaagagaaa aagagaaaaa gaaagaaaga gaagaaagag aaagaggaaa F primer in multiplex III 8 bp deletion gagaaagaaa ggaaggaagg aaggaaggaa gggaaagaaa gaaagaaaga R primer in multiplex I/II aagaaagaaa gaaagaaaga aagagaaaaa gaaaggagga ctatgtaatt 4 bp deletion ggaatagata gattattttt taaaatattt ttattacctt tacagttttt R primer in multiplex III ttaaatgccg ccatttcaga aagaaatctg gtcagcagcc cttaccagct
7 Concluding remarks. 8 microvariant alleles at DYS449, 6 intermediate alleles at DYS464, 2 intermediate alleles at DYS458, and duplicated allele at DYS9, DYS390 and DYS447 have been discovered and characterized. 2. The use of DYS448 needs to be considered for genotyping of Asians due to the relatively high frequency of null allele in Asians. 3. By applying small amplicon of DYS in multiplex III, we could efficiently avoid or prevent the allele mis-designation at DYS which occurs as a result of deletion mutation. 4. This work will provide a well-established Korean Y-STR database which can be used as a reference for the interpretation of Y-STR genotyping results in Koreans. Acknowledgement Funding National R&D program of Ministry of Science and Technology (MOST) Korea Science and Engineering Foundation (KOSEF) To our lab members Kyoung-Jin Shin, D.D.S., Ph.D Professor Hwan Young Lee, Ph.D Ukhee Chung, MSc. Na Young Kim, MSc.
Y chromosomal STRs in forensics
Haplotype and mutation analysis for newly suggested Y-STRs in Korean father-son pairs Yu Na Oh, Hwan Young Lee, Eun Young Lee, Eun Hey Kim, Woo Ick Yang, Kyoung-Jin Shin Department of Forensic Medicine
More informationLatest Tools for Human Identification
Latest Tools for Human Identification Lisa Calandro, Senior Forensic Scientist Applied Markets Division To hear the audio portion of this seminar, please call the phone number for your country: Australia-1800002092
More informationDNA methylation-based body fluid typing
DNA methylation-based body fluid typing Hwan Young Lee Department of Forensic Medicine Yonsei University College of Medicine, Seoul, Korea Forensic Body Fluid Identification Body fluid identification can
More informationSequence variation in the short tandem repeat system SE33 discovered by next generation sequencing
Sequence variation in the short tandem repeat system SE33 discovered by next generation sequencing Eszter Rockenbauer, MSc, PhD and Line Møller, MSc Forensic Geneticist Section of Forensic Genetics Department
More informationAnalyzing Y-STR mixtures and calculating inclusion statistics
Analyzing Y-STR mixtures and calculating inclusion statistics Rick W. Staub, Ph.D. and Cassie Johnson, M.S. Orchid Cellmark Inc. Dallas, TX ABSTRACT Forensic evidence samples analyzed with Y-STR multiplexes
More informationSequence structure of 12 novel Y chromosome microsatellites and PCR amplification strategies
International Congress Series 1239 (2003) 425 429 Sequence structure of 12 novel Y chromosome microsatellites and PCR amplification strategies Anna González-Neira a, Paula Sánchez-Diz a, Leonor Gusmão
More informationProduct Catalog 2012 AmplGen Ltd.
Professional solutions for Genetic Human Identification and Molecular Diagnostics Product Catalog 2012 AmplGen Ltd. Riga, Lativa 2 Catalog AmplGen 2012, ver. #02 Dear colleagues, AmplGen is new European
More informationMale/female DNA mixtures: a challenge for Y-STR analysis
International Congress Series 1239 (2003) 295 299 Male/female DNA mixtures: a challenge for Y-STR analysis Burkhard Berger, Harald Niederstätter, Silvano Köchl, Martin Steinlechner, Walther Parson * Institute
More informationComparison of the Promega Power Y and AB AmpFlSTR YFiler kits and the Subsequent Validation of YFiler.
Comparison of the Promega Power Y and AB AmpFlSTR YFiler kits and the Subsequent Validation of YFiler. Dr. Timothy P McMahon Armed Forces DNA Identification Laboratory Rockville, Md 301-319 319-0238 Timothy.mcmahon@afip.osd.mil
More informationAmpF STR NGM PCR Amplification Kit - Overview
AmpF STR NGM PCR Amplification Kit - Overview The most advanced STR kits optimized for analysis of forensic casework and database samples in Europe Data Quality Worth Sharing! 9/7/2011 Life Technologies
More informationWhat is DNA? Deoxyribonucleic Acid The inherited genetic material that makes us what we are
DNA Basic Genetics What is DNA? DNA is Deoxyribonucleic Acid The inherited genetic material that makes us what we are DNA in the Cell Human Genome ~3 billion base pairs of DNA 30,000-35,000 genes Population-each
More informationNotice of Amendment of the FBI s STR Population Data Published in 1999 and 2001
Notice of Amendment of the FBI s STR Population Data Published in 1999 and 2001 Recently, new amplification kits that expand the number of loci in a multiplex reaction have become commercially available.
More informationSTR Profiling Matching Criteria: Establishment and Importance of a Cell Line Database
STR Profiling Matching Criteria: Establishment and Importance of a Cell Line Database Margaret Kline Applied Group Biochemical Science Division Chemical Science and Technology Laboratory National Institute
More informationMutations during meiosis and germ line division lead to genetic variation between individuals
Mutations during meiosis and germ line division lead to genetic variation between individuals Types of mutations: point mutations indels (insertion/deletion) copy number variation structural rearrangements
More informationGenetic Identity. Steve Harris SPASH - Biotechnology
Genetic Identity Steve Harris SPASH - Biotechnology Comparison of Organisms ORGANISM GENES BASE PAIRS Lambda Phage 40 50,000 E.coli 400 5,000,000 Yeast 13,000 15,000,000 Human 20,000 3,000,000,000 (3 billion)
More informationEvaluation of Genome wide SNP Haplotype Blocks for Human Identification Applications
Ranajit Chakraborty, Ph.D. Evaluation of Genome wide SNP Haplotype Blocks for Human Identification Applications Overview Some brief remarks about SNPs Haploblock structure of SNPs in the human genome Criteria
More informationThe Polymerase Chain Reaction. Chapter 6: Background
The Polymerase Chain Reaction Chapter 6: Background PCR Amplify= Polymerase Chain Reaction (PCR) Invented in 1984 Applications Invention of PCR Kary Mullis Mile marker 46.58 in April of 1983 Pulled off
More informationAmpFlSTR Identifiler PCR Amplification Kit
Product Bulletin Human Identification AmpFlSTR Identifiler PCR Amplification Kit Fifteen STR (short tandem repeat) loci and Amelogenin co-amplified in a single tube Incorporation of the same proven, reliable
More informationFORENSIC GENETICS. DNA in the cell FORENSIC GENETICS PERSONAL IDENTIFICATION KINSHIP ANALYSIS FORENSIC GENETICS. Sources of biological evidence
FORENSIC GENETICS FORENSIC GENETICS PERSONAL IDENTIFICATION KINSHIP ANALYSIS FORENSIC GENETICS Establishing human corpse identity Crime cases matching suspect with evidence Paternity testing, even after
More informationReport of Analyzing Short Tandem Repeats for Parentage Testing
1 Alex Michael Tseng Department of Forensic Medicine, College of Medicine, National Taiwan University Report of Analyzing Short Tandem Repeats for Parentage Testing Introduction In the three billion letter
More informationA genetic database for DNA-based forensic analysis in Brunei Darussalam
DNA-STR typing in Brunei 1 A genetic database for DNA-based forensic analysis in Brunei Darussalam Poh Yee Cheong 1, Paul V.O. Liew 1, Hamydon Ibrahim 1, Bruce Budowle 2 1 Forensic Biology/DNA Laboratory,
More informationDevelopment of a Global STR Multiplex for Human Identification Analysis
Development of a Global STR Multiplex for Human Identification Analysis Jonathan Tabak Life Technologies 1 Agenda Introduction Multiplex Configuration Strategy Application-Specific Development and Testing
More informationIntestinal Epithelial Cell-Specific Deletion of PLD2 Alleviates DSS-Induced Colitis by. Regulating Occludin
Intestinal Epithelial Cell-Specific Deletion of PLD2 Alleviates DSS-Induced Colitis by Regulating Occludin Chaithanya Chelakkot 1,ǂ, Jaewang Ghim 2,3,ǂ, Nirmal Rajasekaran 4, Jong-Sun Choi 5, Jung-Hwan
More informationData Quality Worth Sharing
Product Bulletin Human Identification AmpFlSTR NGM and NGM SElect PCR Amplification Kits Next generation amplification chemistries including the 5 new loci from the expanded European Standard Set Enhanced
More informationCHAPTER THREE RESULTS
CHAPTER THREE RESULTS 3.1 PCR-SSP In this study, the PCR SSP technique was used to amplify the GYP hybrid gene from the genomic DNA samples and detect GP.Mur, GP.Bun, GP.Hop (148 bp), GP.HF and GP.Hut
More informationThe Real CSI: Using DNA to Identify Criminals and Missing Persons
The Real CSI: Using DNA to Identify Criminals and Missing Persons San Jose State University May 2, 2012 Overview Forensic DNA in the media perceptions and reality The power and limitations of nuclear (STR)
More informationMassively Parallel Sequencing and STR Typing Basics and Forensic Applications
Massively Parallel Sequencing and STR Typing Basics and Forensic Applications Bruce Budowle Institute of Applied Genetics Department of Molecular and Medical Genetics, University of North Texas Health
More informationJS 190- Population Genetics- Assessing the Strength of the Evidence Pre class activities
JS 190- Population Genetics- Assessing the Strength of the Evidence I. Pre class activities a. Quiz then Review Assignments and Schedule II. Learning Objectives a. Overview of Validation Developmental
More informationProcedure for GeneMapper ID-X for Casework
Procedure for GeneMapper ID-X for Casework 1.0 Purpose-This procedure specifies the steps for performing analysis on DNA samples amplified with AmpFlSTR Identifiler Plus using the GeneMapper ID-X (GMID-X)
More informationQIAGEN Whole Genome Amplification REPLI-g Eliminating Sample Limitations, Potential Use for Reference Material
QIAGEN Whole Genome Amplification REPLI-g Eliminating Sample Limitations, Potential Use for Reference Material MDA Technology Protocols Locus Bias Applications Kits & Service Summary QIAGEN REPLI-g WGA
More informationForensic DNA Testing. Forensic DNA Testing. Maj Gen (R) Suhaib Ahmed, HI (M)
Maj Gen (R) Suhaib Ahmed, HI (M) DNA from no two individuals except identical twins is alike. The person to person differences in DNA can be discovered by PCR amplification and genomic sequencing. The
More informationDevelopment of a Global STR Multiplex for Human Identification Analysis. Julio Mulero, Ph. D. R&D Group Human Identification, Life Technologies
Development of a Global STR Multiplex for Human Identification Analysis Julio Mulero, Ph. D. R&D Group Human Identification, Life Technologies Agenda Why a global multiplex? Multiplex Configuration Strategy
More informationInvestigator Quantiplex HYres Kit
These specifications are for the procurement of a validation study at GBI Division of Forensic Sciences facilities of two commercially available kits used in forensic DNA analysis. The two kits to be validated
More informationAlignment and annotation of forensic STR data generated from MPS analysis: Notes from the sequence workbench
Alignment and annotation of forensic STR data generated from MPS analysis: Notes from the sequence workbench Chris Phillips, Katherine Gettings, Jonathan King, Christophe van Neste, Walther Parson Capillary
More informationGlobalFiler Kit Casework Test Site Results and Other Development Updates
GlobalFiler Kit Casework Test Site Results and Other Development Updates April Orbison Sr. Field Applications Specialist Human Identification 1 Agenda GlobalFiler Kit Update: Recent Casework Test Site
More informationData Sources and Biobanks in the Asia-Pacific Region. Wei Zhou, MD, Ph.D. Department of Epidemiology, Merck Research Laboratories October 23, 2014
Data Sources and Biobanks in the Asia-Pacific Region Wei Zhou, MD, Ph.D. Department of Epidemiology, Merck Research Laboratories October 23, 2014 1 Disclosures Wei Zhou is currently an employee of Merck
More informationDNA Collection. Data Quality Control. Whole Genome Amplification. Whole Genome Amplification. Measure DNA concentrations. Pros
DNA Collection Data Quality Control Suzanne M. Leal Baylor College of Medicine sleal@bcm.edu Copyrighted S.M. Leal 2016 Blood samples For unlimited supply of DNA Transformed cell lines Buccal Swabs Small
More informationProcedure for Casework DNA Interpretation
Procedure for Casework DNA Interpretation 1.0 Purpose The purpose of this document is to provide guidelines for the interpretation of autosomal DNA results when amplified with Identifiler Plus. 2.0 Scope
More informationLaboratory Exercise 4. Multiplex PCR of Short Tandem Repeats and Vertical Polyacrylamide Gel Electrophoresis.
Laboratory Exercise 4 4 Multiplex PCR of Short Tandem Repeats and Vertical Polyacrylamide Gel Electrophoresis B A C K G R O U N D The human genome contains over 3000 million base pairs, which are distributed
More informationCharacterization of 26 MiniSTR Loci for Improved Analysis of Degraded DNA Samples
J Forensic Sci, January 2008, Vol. 53, No. 1 doi: 10.1111/j.1556-4029.2008.00595.x Available online at: www.blackwell-synergy.com Carolyn R. Hill, M.S.; Margaret C. Kline, M.S.; Michael D. Coble, Ph.D.;
More informationShort Tandem Repeat (STR) Analysis
Maj Gen (R) Suhaib Ahmed, HI (M) Short tandem repeats (STR) are randomly distributed DNA sequences in which 2-6bp are tandemly repeated. These are scattered on all chromosomes including the autosomes as
More informationRADSeq Data Analysis. Through STACKS on Galaxy. Yvan Le Bras Anthony Bretaudeau Cyril Monjeaud Gildas Le Corguillé
RADSeq Data Analysis Through STACKS on Galaxy Yvan Le Bras Anthony Bretaudeau Cyril Monjeaud Gildas Le Corguillé RAD sequencing: next-generation tools for an old problem INTRODUCTION source: Karim Gharbi
More informationGenPlex HID Training Class I
Rixun Fang GenPlex HID Training Class I Outline of Presentation Introduction GenPlex HID kit Experimental plan Class schedule Forensic SNP Analysis GenPlex HID Training Class I 2 Potential Forensic Applications
More informationThe Polymerase Chain Reaction. Chapter 6: Background
The Polymerase Chain Reaction Chapter 6: Background Invention of PCR Kary Mullis Mile marker 46.58 in April of 1983 Pulled off the road and outlined a way to conduct DNA replication in a tube Worked for
More informationValidation of Identity and Ancestry SNP Panels for the Ion PGM
Validation of Identity and Ancestry SNP Panels for the Ion PGM Christopher Phillips, Carla Santos, Maria de la Puente, Manuel Fondevila, Ángel Carracedo, Maviky Lareu Forensic Genetics Unit, University
More informationEUROPEAN DNA PROFILING GROUP (EDNAP) MEETING
EUROPEAN DNA PROFILING GROUP (EDNAP) MEETING ROME, ITALY 12 13 SEPTEMBER 2007 Host: Alberto Intini and Renato Biondo. Chairman: Niels Morling. A list of participants is attached. Welcome Alberto Intini
More informationA CRISPR/Cas9 Vector System for Tissue-Specific Gene Disruption in Zebrafish
Developmental Cell Supplemental Information A CRISPR/Cas9 Vector System for Tissue-Specific Gene Disruption in Zebrafish Julien Ablain, Ellen M. Durand, Song Yang, Yi Zhou, and Leonard I. Zon % larvae
More informationGenetic analysis of eight x-chromosomal short tandem repeat loci in Iraqi population using the Mentype Argus X-UL PCR amplification kit
Vol. 14(30), pp. 2341-2351, 29 July, 2015 DOI: 10.5897/AJB2015.14422 Article Number: 996414654423 ISSN 1684-5315 Copyright 2015 Author(s) retain the copyright of this article http://www.academicjournals.org/ajb
More informationDNA Mixture Interpretation Workshop Dr Chris Maguire. Identification and resolution of DNA mixtures
DNA Mixture Interpretation Workshop Dr Chris Maguire Identification and resolution of DNA mixtures Introduction Mixture analysis models Pros & Cons Recognizing a DNA Mixture Extra peaks Peak imbalance
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature09937 a Name Position Primersets 1a 1b 2 3 4 b2 Phenotype Genotype b Primerset 1a D T C R I E 10000 8000 6000 5000 4000 3000 2500 2000 1500 1000 800 Donor (D)
More informationValidation of PowerPlex Y23 PCR Amplification System for Forensic Casework
Validation of PowerPlex Y23 PCR Amplification System for Forensic Casework Jessica Tokarz (B.S.) 1, Sarah Foster (B.S.) 2, Scott Milne (B.S.) 2, Pamela Staton (PhD) 1, Kathleen Press (M.S.F.S.) 3 1 Marshall
More informationIntroducing: 3Zomy Aneuploidity Test
Introducing: 3Zomy Aneuploidity Test QF-PCR Life Technologies (India) Pvt. Ltd. 306, Aggarwal City Mall, Opposite M2K Pitampura, Delhi 110034 (INDIA). Ph: +91-11-42208000, 4220811, 42208222 Mobile: +91-9810521400
More informationAllele and Haplotype Frequencies of Y-Short Tandem Repeat Loci in Turkey
44(3):310-314,2003 FORENSIC SCIENCES Allele and Haplotype Frequencies of Y-Short Tandem Repeat Loci in Turkey Faruk Aºicioglu, Fatih Akyüz, Ümit Çetinkaya, Mehmet Ali Canli Department of Biology, Council
More informationTarget Enrichment Strategies for Next Generation Sequencing
Target Enrichment Strategies for Next Generation Sequencing Anuj Gupta, PhD Agilent Technologies, New Delhi Genotypic Conference, Sept 2014 NGS Timeline Information burst Nearly 30,000 human genomes sequenced
More informationMHC Region. MHC expression: Class I: All nucleated cells and platelets Class II: Antigen presenting cells
DNA based HLA typing methods By: Yadollah Shakiba, MD, PhD MHC Region MHC expression: Class I: All nucleated cells and platelets Class II: Antigen presenting cells Nomenclature of HLA Alleles Assigned
More informationNew Autosomal and Y-Chromosome STR Loci: Characterization and Potential Uses*
New Autosomal and Y-Chromosome STR Loci: Characterization and Potential Uses* John M. Butler 1, Carolyn R. Hill 1, Amy E. Decker 1, Margaret C. Kline 1, Thomas M. Reid 2, and Peter M. Vallone 1 1 Biochemical
More informationPowerPlex. Y System Validation
PowerPlex Y System Validation By Patricia M. Fulmer, Dawn Rabbach, Kimberly Huston, Curtis Knox and Cynthia Sprecher, Promega Corporation Abstract We have improved the manufacturing process for the PowerPlex
More informationAppendix - I. Primer and Probe Sequences. MTUS1 gene
- I Primer and Probe Sequences MTUS1 gene MDel-F: 5' TGCATTTTTCTTCCTGTTTGG 3' (21 bases) MDel-R: 5' ATATCCTGTGCTCCTCACTGC 3' (21 bases) MEx4-F: 5' CCTTGAAAACTGCACAGTCG 3' (20 bases) MEx4-R: 5' CTCAGCTCACTGTGGGTGCT
More informationTable S1. List of primers used in this study
Table S1. List of primers used in this study Name KanMx-F2 KanMx-A2 FEN1-DG-S FEN1-DG-A SUR4-DG-S SUR4-DG-A CaARG4-R1130 CaARG4-F61 CaHIS1-DR CaHIS1-ter CaFEN1-US1 CaFEN1-UA1 CaFEN1-DS2 CaFEN1-DA2 CaFEN1-DG-S
More informationDevelopment of a Global STR Multiplex for Human Identification Analysis
Development of a Global STR Multiplex for Human Identification Analysis ISHI 2012 Dennis Wang Sr. Staff Scientist Human Identification Group 1 Agenda Why a Global Multiplex? Multiplex Configuration Strategy
More informationGeneral Characteristics and Population Genetic Application of Chromosome Y Microsatellites
Peter de Knijff 1, Manfred Kayser 2, Lutz Roewer 2 1 MGC-Dept. of Human Genetics, Leiden University Medical Center, POBox 9503, Leiden, The Netherlands. 2 Institut für Rechtsmedizin, Humboldt-Universität
More informationSTR Interpretation Guidelines
Introduction: STR Interpretation Guidelines The interpretation of results in casework is necessarily a matter of professional judgment and expertise. Not every situation can or should be covered by a pre-set
More informationHLA and Next Generation Sequencing it s all about the Data
HLA and Next Generation Sequencing it s all about the Data John Ord, NHSBT Colindale and University of Cambridge BSHI Annual Conference Manchester September 2014 Introduction In 2003 the first full public
More informationA critical review for DNA polymorphic markers and blood group markers in paternity testing
International Congress Series 1239 (2003) 749 753 A critical review for DNA polymorphic markers and blood group markers in paternity testing A. Sawaguchi*, X. Wang, T. Sawaguchi Department of Legal Medicine,
More informationIntroducing the Applied Biosystems TM Precision ID NGS System for Human Identification
Introducing the Applied Biosystems TM Precision ID NGS System for Human Identification Sheri J. Olson Director, Product Management Casework Human Identification Current challenges for forensic scientists
More informationMicrosatellite repeat motif and amplicon length affect amplification success of. degraded faecal DNA
Microsatellite repeat motif and amplicon length affect amplification success of degraded faecal DNA Alida de Flamingh a, Catherine L. Sole b, Rudi J. van Aarde a a Conservation Ecology Research Unit, Department
More informationLaboratory Validation. Chapter 16
Laboratory Validation Chapter 16 Importance The DNA profile is used to convict or free a suspect It must be perfect! No mistakes like we have in regular laboratories all the time Also DNA evidence must
More informationCaenorhabditis elegans: The Heavyweight Champ of Gene Knockout Technology
Caenorhabditis elegans: The Heavyweight Champ of Gene Knockout Technology Rachel Pan The nematode (worm) Caenorhabditis elegans was the first multicellular organism to have its genome, or complete DNA
More informationMentype Argus X-12 PCR Amplification Kit
Mentype Argus X-12 PCR Amplification Kit Product description The Mentype Argus X-12 PCR Amplification Kit is a multiplex application for twelve X-chromosomal Short Tandem Repeat (STR) loci that supplements
More informationAdvanced Topics at Family Tree DNA Part 1: Y-DNA
Advanced Topics at Family Tree DNA Part 1: Y-DNA Presented By Elise Friedman, Relative Roots Take your genetic genealogy knowledge to the next level! This presentation further details the usage & genetics
More informationMULTIPLEX QUANTITATIVE REAL-TIME POLYMERASE CHAIN REACTION (qpcr) AS A METHOD FOR DETECTING PCR AMPLICON CONTAMINATION OF FORENSIC DNA SAMPLES
MULTIPLEX QUANTITATIVE REAL-TIME POLYMERASE CHAIN REACTION (qpcr) AS A METHOD FOR DETECTING PCR AMPLICON CONTAMINATION OF FORENSIC DNA SAMPLES Tessa Charlotte Dadd BSc (Genetics & Microbiology) & GDipForSci
More informationrjlflemmers, LUMC, Leiden, The Netherlands 6/3/2010
Genotyping of the SSLP The simple sequence length polymorphism (SSLP) 3.5 kb proximal to D4Z4 is studied by PCR and the sequence is localized between positions 1532 and 1694 of AF117653 (see figure below).
More information1a. What is the ratio of feathered to unfeathered shanks in the offspring of the above cross?
Problem Set 5 answers 1. Whether or not the shanks of chickens contains feathers is due to two independently assorting genes. Individuals have unfeathered shanks when they are homozygous for recessive
More informationThe Evolution of Short Tandem Repeat (STR) Multiplex Systems
Ann M. Lins, Cynthia J. Sprecher, Katherine A. Micka, Dawn R. Rabbach, Jennifer A. Taylor, Jeffrey W. Bacher, Laura F. Hennes, Allan Tereba, Trent Gu, Elizabeth A. Amiott, Nadine A. Nassif and James W.
More informationCertificate of Analysis of the Holotype HLA 24/7 Configuration A1 & CE
Certificate of Analysis of the Holotype HLA 24/7 Configuration A1 & CE Product name Holotype HLA 24/7 Configuration A1 & CE Reference number H52 LOT number 00027 (N4/002-P5/006-E1/004-R2/006) Expiration
More informationPopulation Genetics (Learning Objectives)
Population Genetics (Learning Objectives) Define the terms population, species, allelic and genotypic frequencies, gene pool, and fixed allele, genetic drift, bottle-neck effect, founder effect. Explain
More informationGenerating Forensic DNA Profiles
Wright State University CORE Scholar Biological Sciences Faculty Publications Biological Sciences 12-2012 Generating Forensic DNA Profiles Dan E. Krane Wright State University - Main Campus, dan.krane@wright.edu
More informationAutomated purification of DNA from bones of a Bronze Age family using the BioRobot EZ1 workstation
Application Note Automated purification of DNA from bones of a Bronze Age family using the BioRobot EZ1 workstation Felix Schilz, Diane Schmidt, and Susanne Hummel Historic Anthropology and Human Ecology,
More informationSystematic Analysis of single cells by PCR
Systematic Analysis of single cells by PCR Wolfgang Mann 27th March 2007, Weihenstephan Overview AmpliGrid Technology Examples DNA Forensics Single Cell Sequencing Polar Body Diagnostics Single Cell RT
More informationQIAGEN Validation Report
QIAGEN Validation Report Developmental validation of the Investigator ESSplex SE Plus Kit The QIAGEN Investigator ESSplex SE Plus Kit is intended for molecular biology applications in forensic, human identity,
More informationGenome research in eukaryotes
Functional Genomics Genome and EST sequencing can tell us how many POTENTIAL genes are present in the genome Proteomics can tell us about proteins and their interactions The goal of functional genomics
More informationLATE-PCR. Linear-After-The-Exponential
LATE-PCR Linear-After-The-Exponential A Patented Invention of the Laboratory of Human Genetics and Reproductive Biology Lab. Director: Lawrence J. Wangh, Ph.D. Department of Biology, Brandeis University,
More informationJohn M. Butler and Peter M. Vallone National Institute of Standards and Technology
DNA Biometrics: i Standards and Technology John M. Butler and Peter M. Vallone National Institute of Standards and Technology NDIA Biometrics Conference (Arlington VA) NDIA Biometrics Conference (Arlington,
More informationHarnessing the power of RADseq for ecological and evolutionary genomics
STUDY DESIGNS Harnessing the power of RADseq for ecological and evolutionary genomics Kimberly R. Andrews 1, Jeffrey M. Good 2, Michael R. Miller 3, Gordon Luikart 4 and Paul A. Hohenlohe 5 Abstract High-throughput
More informationMolecular Markers CRITFC Genetics Workshop December 9, 2014
Molecular Markers CRITFC Genetics Workshop December 9, 2014 Molecular Markers Tools that allow us to collect information about an individual, a population, or a species Application in fisheries mating
More informationLightScanner Hi-Res Melting Comparison of Six Master Mixes for Scanning and Small Amplicon and LunaProbes Genotyping
LightScanner Hi-Res Melting Comparison of Six Master Mixes for Scanning and Small Amplicon and LunaProbes Genotyping Introduction Commercial master mixes are convenient and cost-effective solutions for
More informationBIOLOGY Dr.Locke Lecture# 27 An Introduction to Polymerase Chain Reaction (PCR)
BIOLOGY 207 - Dr.Locke Lecture# 27 An Introduction to Polymerase Chain Reaction (PCR) Required readings and problems: Reading: Open Genetics, Chapter 8.1 Problems: Chapter 8 Optional Griffiths (2008) 9
More information4.1. Genetics as a Tool in Anthropology
4.1. Genetics as a Tool in Anthropology Each biological system and every human being is defined by its genetic material. The genetic material is stored in the cells of the body, mainly in the nucleus of
More informationDNA Mixture Interpretation Workshop Michael D. Coble, PhD. Current SWGDAM Guidelines
DNA Mixture Interpretation Workshop Michael D. Coble, PhD Current SWGDAM Guidelines Hierarchy of Rules for Forensic DNA Labs Validation Audits United States FBI (DAB) Quality Assurance Standards NDIS Procedures
More informationGENE MAPPING. Genetica per Scienze Naturali a.a prof S. Presciuttini
GENE MAPPING Questo documento è pubblicato sotto licenza Creative Commons Attribuzione Non commerciale Condividi allo stesso modo http://creativecommons.org/licenses/by-nc-sa/2.5/deed.it Genetic mapping
More informationDevelopment and Validation of the 3500 Series Genetic Analyzer for Human Identification
Development and Validation of the 3500 Series Genetic Analyzer for Human Identification Jeff Sailus Forensic Science Applications Group 1 Development of a Next Generation Genetic Analyzer A Whole System
More informationDISTRIBUTION OF ABO GENOTYPES AND ALLELE FREQUENCIES IN A KOREAN POPULATION
Jpn J Human Genet 42, 331-335, 1997 DISTRIBUTION OF ABO GENOTYPES AND ALLELE FREQUENCIES IN A KOREAN POPULATION Sung Ha KANG, x'2 Yasuo FUKUMORI, 1'* Shiro OHNOKI, 1 Hirotoshi SHIBATA, 1 Kyou Sup HAN,
More information44(31: ,2003 FORENSIC SCIENCES
44(31:310-314,2003 FORENSIC SCIENCES Allele and Haplotype Frequencies of Y-Short Tandem Repeat Loci in Turkey Faruk Aşicioglu, Fatih Akyiiz, Omit Çetinkaya, Mehmet Ali Canli Department of Biology, Council
More informationUniparental disomy (UPD) analysis of chromosome 15
YOUR INNOVATIVE RESEARCH Analysis of UPD by STR-PCR Uniparental disomy (UPD) analysis of chromosome 15 Applied Biosystems 3500xL Genetic Analyzer Introduction Researchers at the Laboratory of Medical Genetics
More informationAnalysis of genetic polymorphism of nine short tandem repeat loci in Chinese Han population of Henan province
African Journal of Biotechnology Vol. 11(22), pp. 5988-5994, 15 March, 2012 Available online at http://www.academicjournals.org/ajb DOI: 10.5897/AJB11.3642 ISSN 1684 5315 2012 Academic Journals Full Length
More informationBiotechnology. Explorer Program. Serious About Science Education 5/17/09 1
Biotechnology Explorer Program Serious About Science Education 5/17/09 1 Chromosome 8: PCR TM PCR Workshop Kirk Brown,, Tracy High School; Tracy, Ca Stan Hitomi,, Monte Vista High School; Danville, CA
More informationThe Job Classification System and Certification. Lists of Construction Industry - Focused on Construction Technicians
Contemporary Engineering Sciences, Vol. 7, 2014, no. 21, 1053-1060 HIKARI Ltd, www.m-hikari.com http://dx.doi.org/10.12988/ces.2014.49132 The Job Classification System and Certification Lists of Construction
More informationAmplicon Sequencing Template Preparation
Amplicon Sequencing Template Preparation The DNA sample preparation procedure for Amplicon Sequencing consists of a simple PCR amplification reaction, but uses special Fusion Primers (Figure 1-1). The
More information