A Practical Guide to CRISPR-Mediated Gene Tagging with a Bioluminescent Peptide

Transcription

1 A Practical Guide to CRISPR-Mediated Gene Tagging with a Bioluminescent Peptide Marie K. Schwinn, PhD Senior Research Scientist For Research Use Only. Not for use in diagnostic procedures.

2 Why endogenous tagging? Maintenance of proper cellular protein levels is critical to regulation of physiology Overexpression of reporter-protein fusions is one approach to studying cellular processes Artifacts are associated with over-expression - Mislocalization - Aberrant signaling - Aggregation - Competition with endogenous - Abnormal morphology Endogenous tagging helps avoid over-expression artifacts However not all tags are suitable for this approach - Large size - High background - Low sensitivity - Lack of functionality 2

3 In this webinar 1) Discuss properties of HiBiT tag which make it an ideal tag for endogenous protein studies 2) Walk through a workflow for CRISPR-mediated HiBiT tagging 3) Show examples of how endogenously expressed HiBiT protein fusions can be monitored in cells 3

4 Engineering an optimal reporter Oplophorus gracilirostris Native Enzyme 19kDa Catalytic Subunit 19kDa NanoLuc Furimazine substrate 2,500,000X Brighter 35kDa Coelenterazine substrate Stable, glow kinetics Poor activity, expression, stability High thermal stability Active over broad ph Monomeric No post-translational modifications No disulfide bonds Uniform cellular distribution Hall, M.P. (2012) ACS Chem. Biol. 7,

5 Applications for NanoLuc Reporter Gene Assays RE NLuc + Furim / O2 Light Biosensors p53 NLuc p53 NLuc Imaging Cell Health Protein Dynamics D A D A Complementation Resonance Energy Transfer 5

6 NanoLuc Binary Technology (NanoBiT ) 156 NanoLuc -based complementation system Divided at amino acid 156 Subunits are 18kDa and 1.3kDa 1.3kDa 18kDa LgBiT Dixon, A.S. et al. (2016) ACS Chem Biol 11, 400. Each subunit further optimized to improve performance as reporter 18kDa subunit (Large BiT, LgBiT) optimized for expression, stability and brightness 1.3kDa peptide optimized for affinity 6

7 Two types of NanoLuc -based complementation assays Native Peptide K D =900nM Luminescence (RLU) HiBiT High affinity for LgBiT K D = 700pM Detection tag 1.E+07 1.E+06 1.E+05 1.E+04 1.E+03 1.E-07 1.E-04 1.E-01 1.E+02 Peptide Concentration (µm) SmBiT Low affinity for LgBiT K D = 190µM Protein interactions 7

8 Properties of HiBiT as a detection tag Express HiBiT fusion Add detection reagent (+LgBiT) Measure luminescence log RLUs (background corrected) HiBiT NanoLuc log HiBiT or NanoLuc (moles) High sensitivity (< 0.2amoles) Easy and rapid quantitation (<10 minutes) Large dynamic range (>7orders) 8

9 The Nano-Glo HiBiT Lytic Detection System 9

10 Application: Measuring intracellular protein abundance HIF1α Pathway Accumulation of HIF1α-HiBiT Normoxia Hypoxia OH OH HIF1α HiBiT PHD Proteasomal Degradation RLU HIF1α HIF1α HRE Target Gene Expression HiBiT Background assay BG [phenanthroline] M HIF1α-HiBiT accumulates after treatment with hypoxia mimetic (phenanthroline) 10

11 The Nano-Glo HiBiT Extracellular Detection System 11

12 Application: Monitoring receptor internalization Internalization of ADRB2 Normalized RLUs Compound (EC50, %External) Isoproterenol (51nM, 16%) Salbutamol (160nM, 45%) Salmeterol (1.1nM, 63%) Formoterol (2.9nM, 16%) log [Compound] M Both ligand potency and extent of internalization were measured in under 4 minutes 12

13 The Nano-Glo HiBiT Blotting System 13

14 Application: Confirming protein expression/size HiBiT Fusion Standard protocol Rinse blot briefly in TBST Incubate overnight with LgBiT at 4 C Incubation with substrate for 5 minutes kd Image luminescence 25 Expression of full-length fusions confirmed 14

15 How is HiBiT introduced into the cell? Method 1: Heterologous expression of HiBiT-tagged protein Protein of Interest HiBiT Tag Standard Cloning Transfect Cytoplasmic Protein or Potential for over-expression artifacts Transmembrane Protein 15

16 A second approach to introducing HiBiT Method 2: Expression of HiBiT-tagged protein from endogenous locus RNP Complex Cas9 Guide RNA HiBiT Tag Donor DNA Cytoplasmic Protein or Transmembrane Protein 16

17 HiBiT is ideal for studying endogenous biology Small Less effect on protein Easily knocked in Endogenous Biology Simple Homogeneous, add-and-read assays Protein quantification in <10 minutes Quantitative Subattomole sensitivity Dynamic range spanning >7 orders of magnitude 17

18 Using CRISPR to introduce HiBiT Step 1: Cas9/guide RNA complex generates double-strand break Step 2: Cell repairs itself Modified image by H. Adam Steinberg Key Components: 1. Cas9 2. Guide RNA 3. Donor DNA 18

19 Generating knockouts with CRISPR Genomic Locus Guide RNA 5 Exon Exon Exon 3 UTR 3 Main application for CRISPR editing is gene knockout One or more guide RNA designed to target exons Cas9 will cut in exon Cell repairs itself and can introduce insertion or deletion in the gene Deletion Insertion 5 Exon Exon 3 UTR 3 5 Exon Exon 3 UTR 3 19

20 Generating knock-ins with CRISPR Genomic Locus Guide RNA 5 Exon Exon Exon 3 UTR 3 Donor DNA For inserting a tag at the terminus, guide RNA target the end of the gene exon or UTR Cas9 generates a double strand break Gene remains intact and cell repairs itself using a donor DNA template The resulting product is a gene that carries a sequence for the tag Endogenous Tag 5 Exon Exon Exon 3 UTR 3 20

21 Workflow for CRISPR-mediated HiBiT tagging Ribonucleoprotein Complex Identify Target and Find Genomic Sequence Design and Order Guide RNA, Cas9 and Donor DNA No Cloning! Assemble Ribonucleoprotein (RNP) Complex Deliver RNP/Donor (Electroporation) Detect Edit by Luminescence Assay in ~24 hours 21

22 Identify target and find genomic sequence You must access the correct genomic sequence before beginning! - NCBI: 22

23 Identify target and find genomic sequence Next, locate position where the HiBiT insertion will occur - C-terminal fusion occurs before stop codon - N-terminal fusion occurs after start codon 23

24 Design and order guide RNA Identify guide RNA sequences - 20nt upstream of PAM (NGG) - Search close to insert site (<40nt away) - Manually or with program (e.g., 24

25 Design and order guide RNA Choose optimal guide - PAM site close to HiBiT insertion - Cut site in untranslated region - Spans insertion site to avoid recutting Order ~3 different grnas - Recommendation: IDT Alt-R CRISPR-Cas9 system (duplex guide) 25

26 Design and order HiBiT donor DNA template Design donor template - Homology arms nt upstream and downstream of insertion - HiBiT sequence between arms - Silent mutations to prevent recutting Order donor DNA template - Single-stranded oligodeoxynucleotide (ssodn) - Recommendation: IDT Ultramer DNA Oligonucleotides TTTCATCTTCTAGGTATGACAACGAATTTGGCTACAGCAACAGGGTGGTGGACCTCATGGCCCACATGGCCTCCAAGGAGGTGAGCGGCTGGCGGCTGTTCAAGAAGATT Homology Arm HiBiT AGCTAAGACCCCTGGACCACCAGCCCCAGCAAGAGCACAAGAGGAAGAGAGAGACCCTCACTGCTGGGGAGTCCCTGCCACACTCA 26

27 Recommendations for donor DNA/guide RNA design Guide RNA Genomic Locus 5 Exon Exon Exon 3 UTR 3 Single-Stranded Oligodeoxynucleotide 5 80nt 33 nucleotide sequence Homology HiBiT Arm Guide RNA - PAM site close to HiBiT insertion site - Cut site in untranslated regions - Span insertion site to avoid recutting TGA 80nt Stop Homology Codon Arm Donor DNA template - Single-stranded oligodeoxynucleotide - HiBiT sequence between homology arms (40 80nt) - Introduce silent mutations to prevent recutting 3 27

28 Deliver guide RNA, donor DNA and Cas9 Components can be introduced to cell as plasmids, mrna, ribonucleoprotein (RNP) complexes or a combination 3. Ribonucleoprotein Complex - Purified Cas9 + Guide RNA - 10 minute incubation Deliver RNP with DNA to cell by electroporation - Sample protocol can be found on Innovative Genomics Institute website Lonza-dm649d 28

29 Example: Endogenous HiBiT-tagged GAPDH Nano-Glo HiBiT Lytic Detection Nano-Glo Live Cell Assay 10 7 RLU RLU GAPDH-HiBiT Cells Unedited Cells Mock #1 # 2 #3 #4 # 5 C trl #1 C trl #2 +LgBiT -LgBiT guide RNA Five different grna screened with differing levels of luminescence Live cell assays can be performed by transfecting in LgBiT-expressing plasmid 29

30 Confirming GAPDH-HiBiT expression by HiBiT blotting HiBiT Blotting 1. Run lysates on gel 2. Transfer to membrane Bands correspond to molecular weight of GAPDH-HiBiT 30

31 Confirming GAPDH-HiBiT expression by imaging Bioluminescence Imaging grna 1 grna 2 Chambered coverglass grna 3 grna 4 LV200 Imaging System Provides information on expression, localization and editing efficiency 31

32 Stability of edit in cell pools % H ib it Positive C ells GAPDH-HiBiT Stability Passage GAPDH-HiBiT population is stable without selective pressure 32

33 Beyond GAPDH: HiBiT enables detection of many targets Nano-Glo HiBiT Lytic Detection 10 7 Worked w/ GFP11 GFP11 = 16 amino acid tag Missed 18 of 48 targets (38%) Often required tag repeats Heavy focus on imaging RLU Failed w / G FP Target HiBiT detected 12 of 14 missed targets No tag repeats needed! 1-RAB5B 2-ATL3 3-SACM1L 4-ESYT1 5-GOLGA7 6-GOSR1 7-SRPRB 8-SMC3 9-NUP35 10-TFRC1 11-RTN4 12-LMAN1 13-FIS1 14-ILK 15-CBX1 16-CLTA 17-FBL 18-LMNA 19-RAB11 20-VIM 33

34 Validating edit with bioluminescence imaging CBX1 LMNA FBL Nucleus Nuclear lamina Nucleoli fibrillar center HiBiT is bright enough for imaging Expression and proper localization confirmed 34

35 A more relevant example: HIF1α abundance Hypoxia Induction Chemical Induction Phenanthroline Dose Response RLU Norm oxia 6X Hypoxia RLU (Background Corrected) U ntreated Phenanthroline ML228 DFO MLN4924 Hypoxia-induced accumulation in HIF1α-HiBiT was detected FG2216 RLU (Background Corrected) [Compound] (nm) EC50 = 5.4µM HIF1α-HiBiT accumulation also detected in response to hypoxia mimetics Potency of compound was accurately measured Schwinn, M.K., et al. (2017) CRISPR-mediated tagging of endogenous proteins with a luminescent peptide. ACS Chem. Biol. DOI: /acschembio.7b

36 Assay using endogenous HiBiT performs best 50 HIF1α-HiBiT Accumulation Fold Response Endogenous Expression Overexpressed (Low) Overexpressed (High) [Phenanthroline] (M) Expression levels above endogenous reduce measured response Endogenously expressed HIF1α-HiBiT generates strongest response 36

37 Take-home message HiBiT is ideal tag for endogenous applications - Small size - Sensitivity - Large dynamic range - Simple - Flexible assay formats CRISPR-mediated HiBiT tagging is simple and fast - No cloning required - Pools of cells can be used within 24 hours By combining HiBiT and CRISPR/Cas9, functional analysis of endogenous proteins is simple and fast! 37

38 Time to get started! Design and order your guide RNA, donor DNA and Cas9 Obtain rights to synthesize the HiBiT tag at: Obtain reagents to analyze your edited cells Nano-Glo HiBiT Lytic Detection System Nano-Glo HiBiT Extracellular Detection System Nano-Glo HiBiT Blotting System 38

39 Thank You! For questions, please contact Promega Technical Services: Additional information on HiBiT Schwinn, M.K., et al. (2017) CRISPRmediated tagging of endogenous proteins with a luminescent peptide, ACS Chem Biol. DOI: /acschembio.7b00549 Webinar: Applications of a Bioluminescent Peptide Tag: Simple, Quantitative Protein Detection Down to Endogenous Levels 39