Getting started with CRISPR: A review of gene knockout and homology-directed repair

Size: px
Start display at page:

Download "Getting started with CRISPR: A review of gene knockout and homology-directed repair"

Transcription

1 Getting started with CRISPR: A review of gene knockout and homology-directed repair Justin Barr Product Manager, Functional Genomics Integrated DNA Technologies 1

2 Agenda: Getting started with CRISPR Background Overview of the basic CRISPR workflow Planning for gene knockout Designing the guide RNA Comparing delivery methods Homology-directed repair (HDR) Designing repair templates 2

3 CRISPR editing Guide RNA Ribonucleoprotein (RNP) DNA repair pathways Non-homologous end joining (NHEJ) Cas9 protein Disrupt a gene Homology directed repair (HDR) Insertion or change sequence specifically 3

4 Implementing CRISPR-Cas9 genome editing 4

5 Basic workflow Lipofection Design grnas Assemble RNP Electroporation Collect genomic DNA Microinjection Analyze 5

6 Gene disruption/knockout 6

7 Considerations for CRISPR design tools Species/cell line(s) tested Cas9 source Guide RNA source Method of delivery Basis for results ranking Off-target score On-target score Filtering 7

8 Tools used in these examples UCSC Genome Browser genome.ucsc.edu CRISPR Design Zhang Lab, MIT crispr.mit.edu 8

9 Basic workflow Lipofection Design grnas Assemble RNP Electroporation Collect genomic DNA Microinjection Analyze 9

10 3-step transfection: Alt-R CRISPR System 1:1 Step 1 + grna complex formation 15 min 1:1 Step 2 + RNP complex formation 10 min RNP delivery Step 3 Lipofection: 10 nm Electroporation: 1 4 µm Microinjection min 10

11 Basic workflow Lipofection Design grnas Assemble RNP Electroporation Collect genomic DNA Microinjection Analyze 11

12 Delivery method comparison Lipofection No instrument required Low RNP amount High-throughput Inexpensive Not compatible with all cell types Risk of toxicity Electroporation Works with most cell types (primary, ipsc) High-throughput options available High RNP amount Requires instrument purchase Consumables can be expensive Microinjection Model organism generation Pronuclear delivery often possible Lower RNP amount Requires experienced technician Requires special equipment Can be expensive 12

13 Detailed protocols available online User methods: Detailed lipofection and electroporation guides: 13

14 Basic workflow Lipofection Design grnas Assemble RNP Electroporation (primary cells, ipscs, etc.) Microinjection Mouse model generation and other research organisms Collect genomic DNA Analyze 14

15 Collecting genomic DNA Wash cells Lyse cells Transfer & vortex Heat Dilute & spin down 15

16 Analyzing results: T7 endonuclease I (T7EI) assay 1. PCR amplify region targeted by CRISPR 2. Heat and cool PCR products to allow heteroduplex formation 3. Incubate with T7EI enzyme (cleaves DNA at mismatches) 4. Visualize products by electrophoresis 16

17 Homology-directed repair (HDR) 17

18 3-step transfection: Alt-R CRISPR System 1:1 Step 1 + grna complex formation 15 min 1:1 Step 2 + RNP complex formation 10 min Step 3 RNP delivery Lipofection: 10 nm Electroporation: 1 4 µm Microinjection + HDR template Ultramer Oligonucleotides min 18

19 HDR considerations Desired mutation size should determine template choice Point mutations and small insertions or tags Single-stranded oligos (Ultramer DNA Oligonucleotides) Standard desalting purification Total unit length: 200 nt or less, including homology arms of typically nt Large corrections and insertion of new coding material Longer homology arms ( bases) HDR donor plasmid dsdna (gblocks Gene Fragments) Design HDR template as close to cut site as possible 19

20 Homology directed repair symmetric templates Flanking arm length Cas9 cleavage crrna guide EcoRI restriction enzyme site (6 bases) inserted into EMX1 10 nm Alt-R CRISPR RNP transfected into HEK-293 cells via lipofection Single stranded HDR oligos: standard desalt Ultramer Oligos 3 nm dsdna or ssdna HDR template co-transfected with RNP Isolated genomic DNA 48 hr post lipofection PCR amplified gdna with PCR primers designed outside the flanking arms of the HDR template sequence Digested PCR product with T7EI to determine total editing, and EcoRI to determine insertion 20

21 HDR efficiency is optimal with nt homology arms Cleavage (%) T7EI total editing EcoRI insertion Insertion into EMX1 Homology arm length 92 nt 27 nt 21

22 dsdna templates integrate by both NHEJ and HDR DSB Single-stranded HDR template HDR products ssdna HDR template HDR products or dsdna HDR template HDR Double-stranded HDR template or HDR NHEJ NHEJ products 22

23 HDR efficiency varies with integration site BCKDK-AS-1079 HIF1A-S-210 KHK-S-224 EGFR-S LDHA-S-2494 EcoRI cleavage (%) EcoRI insertion Homology arm length 57 nt 37 nt 23

24 Designing the HDR repair template WT sequence TTACGCTGATGAATATTCTA TATTCTAAGGCGTTACGCTGATGAATATTCTACGGAATTGCCATAGGCGTTGAACGCTAC ATAAGATTCCGCAATGCGACTACTTATAAGATGCCTTAACGGTATCCGCAACTTGCGATG Desired edit (stop codon) TATTCTAAGGCGTTACGCTGATGAATATTAAACGGAATTGCCATAGGCGTTGAACGCTAC ATAAGATTCCGCAATGCGACTACTTATAATTTGCCTTAACGGTATCCGCAACTTGCGATG HDR template TTACGCTGATGAATATTCTA xx TATTCTAAGGCGTTACGCTGATGAATATTAAACGGAATTGCCATAGGCGTTGAACGCTAC base arm base arm mutation 24

25 Designing the HDR repair template WT sequence TTACGCTGATGAATATTCTA TATTCTAAGGCGTTACGCTGATGAATATTCTACGGAATTGCCATAGGCGTTGAACGCTAC ATAAGATTCCGCAATGCGACTACTTATAAGATGCCTTAACGGTATCCGCAACTTGCGATG Desired edit (stop codon) TATTCTAAGGCGTTACGCTGATGAATA TTCTACGGAATTGCCATAGGCGTTGAACGCTAC 33 bp insert ATAAGATTCCGCAATGCGACTACTTAT AAGATGCCTTAACGGTATCCGCAACTTGCGATG TTACGCTGATGAATATTCTA xx TTAAACGGAATTGCCATAGGCGTTGAACGCTAC HDR template TATTCTAAGGCGTTACGCTGATGAATA 33 nt insert base arm base arm 25

26 Synthesis options for HDR templates Standard DNA oligonucleotides Up to 100 bases in length Ultramer Oligonucleotides Up to 200 bases in length Coming soon: Very long, single-stranded DNA fragments bases Currently in limited beta testing phase Interested? Sign up at: 26

27 Summary CRISPR guide RNA design has become fast and easy with the availability of many free online tools. It is important to understand design tool rankings and recommendations, and how these relate to your experiment. Efficient ribonucleoprotein delivery can be achieved through lipofection, electroporation, and microinjection. Optimized protocols are available for many applications. Homology-directed repair allows for simple mutations and small insertions. Oligonucleotide repair templates can be easily designed and synthesized for your experiment. 27

28 Thanks to the scientists who contributed to these studies Mark Behlke, CSO Nicole Bode Michael Christodoulou Michael Collingwood Joe Dobosy Ashley Jacobi Sarah Jacobi Kim Lennox Jessica Lister Garrett Rettig Mollie Schubert Bernice Thommandru Rolf Turk Chris Vakulskas 28

29 Additional resources and support Protocols, methods, and FAQs Visit the Support tab IDT Scientific Applications Support or visit 29

30 THANK YOU 30

Optimizing CRISPR ribonucleoprotein components for precision genome editing

Optimizing CRISPR ribonucleoprotein components for precision genome editing Optimizing CRISPR ribonucleoprotein components for precision genome editing Justin Barr Sr. Product Manager, Integrated DNA Technologies VIB CRISPR User Meeting 18 September 2018 1 Agenda Overview of CRISPR-Cas9

More information

Optimized, chemically-modified crrna:tracrrna complexes for CRISPR gene editing

Optimized, chemically-modified crrna:tracrrna complexes for CRISPR gene editing Optimized, chemically-modified crrna:tracrrna complexes for CRISPR gene editing Mark Behlke MD, PhD Chief Scientific Officer February 24, 2016 1 Implementing CRISPR/Cas9 gene editing 2 To focus on RNA

More information

Applications of Cas9 nickases for genome engineering

Applications of Cas9 nickases for genome engineering application note genome editing Applications of Cas9 nickases for genome engineering Shuqi Yan, Mollie Schubert, Maureen Young, Brian Wang Integrated DNA Technologies, 17 Commercial Park, Coralville, IA,

More information

ISU CBC CRISPR Workshop. Michael Collingwood & Mollie Schubert

ISU CBC CRISPR Workshop. Michael Collingwood & Mollie Schubert ISU CBC CRISPR Workshop Michael Collingwood & Mollie Schubert 1 Genome editing (Cas12a) 2 Alt-R CRISPR System complete workflow Design Cut Repair Analyze Cas9/Cas12a + Guide RNA (grna) 3 CRISPR-Cas9 genome

More information

Alt-Ring the genome with CRISPR- Cas9

Alt-Ring the genome with CRISPR- Cas9 Alt-Ring the genome with CRISPR- Cas9 Genome editing done easily and fast CHIA Jin Ngee Regional Application Specialist 1 Integrated DNA Technologies The Custom Biology Company 2 IDT was founded by a scientist

More information

CRISPR/Cas9 Genome Editing: Transfection Methods

CRISPR/Cas9 Genome Editing: Transfection Methods CRISPR/ Genome Editing: Transfection Methods For over 20 years Mirus Bio has developed and manufactured high performance transfection products and technologies. That expertise is now being applied to the

More information

Designing CRISPR mediated Gene disruptions with gblocks Gene Fragments

Designing CRISPR mediated Gene disruptions with gblocks Gene Fragments Designing CRISPR mediated Gene disruptions with gblocks Gene Fragments Adam Clore, PhD Manager, Synthetic Biology Design Integrated DNA technology Typical CRISPR timeline in Mammalian cell lines Design

More information

CRISPR Ribonucleoprotein (RNP) User Manual

CRISPR Ribonucleoprotein (RNP) User Manual CRISPR Ribonucleoprotein (RNP) User Manual Description This user manual describes how to use GenScript s CRISPR Ribonucleoprotein (RNP) products for targeted genome editing. The RNP system is comprised

More information

Transfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX

Transfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX Transfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX INTRODUCTION The CRISPR/Cas genome editing system consists of a single guide RNA

More information

Alt-R CRISPR-Cas9 system:

Alt-R CRISPR-Cas9 system: Alt-R CRISPR-Cas9 system: Delivery of ribonucleoprotein complexes into Jurkat T cells using the Bio-Rad Gene Pulser Xcell Electroporation System See what more we can do for you at www.idtdna.com. For Research

More information

Simple protocol for gene editing using GenCrisprTM Cas9 nuclease

Simple protocol for gene editing using GenCrisprTM Cas9 nuclease Simple protocol for gene editing using GenCrisprTM Cas9 nuclease Contents Protocol Step 1: Choose the target DNA sequence Step 2: Design sgrna Step 3: Preparation for sgrna 3.1 In vitro transcription of

More information

Amplicons, Heteroduplexes and Enzymes - Proper Processing Elevates Detection of CRISPR Gene Editing Events

Amplicons, Heteroduplexes and Enzymes - Proper Processing Elevates Detection of CRISPR Gene Editing Events Amplicons, Heteroduplexes and Enzymes - Proper Processing Elevates Detection of CRISPR Gene Editing Events Steve Siembieda, MS MBA VP Commercialization ABRF Conference February 2015 What Is CRISPR? Clustered

More information

XactEdit Cas9 Nuclease with NLS User Manual

XactEdit Cas9 Nuclease with NLS User Manual XactEdit Cas9 Nuclease with NLS User Manual An RNA-guided recombinant endonuclease for efficient targeted DNA cleavage Catalog Numbers CE1000-50K, CE1000-50, CE1000-250, CE1001-250, CE1001-1000 Table of

More information

Genome Engineering with ZFNs, TALENs and CRISPR/Cas9

Genome Engineering with ZFNs, TALENs and CRISPR/Cas9 Genome Engineering with ZFNs, TALENs and CRISPR/Cas9 Designer Endonucleases ZFNs (zinc finger nucleases), TALENs (transcription activator-like effector nucleases) and CRISPR/Cas9 (clustered regularly interspaced

More information

Alt-R CRISPR-Cas9 System:

Alt-R CRISPR-Cas9 System: genome editing user guide Alt-R CRISPR-Cas9 System: Cationic lipid delivery of CRISPR ribonucleoprotein complex into mammalian cells See what more we can do for you at www.idtdna.com. For Research Use

More information

Alt-R CRISPR-Cpf1 System:

Alt-R CRISPR-Cpf1 System: user guide Alt-R CRISPR-Cpf1 System: Delivery of ribonucleoprotein complexes in HEK-293 cells using the Amaxa Nucleofector System See what more we can do for you at www.idtdna.com. For Research Use Only

More information

jetcrispr RNP transfection reagent PROTOCOL

jetcrispr RNP transfection reagent PROTOCOL jetcrispr RNP transfection reagent PROTOCOL DESCRIPTION jetcrispr is a RiboNucleoProtein (RNP) transfection reagent designed to perform CRISPR-Cas9 genome editing in mammalian cells. This reagent has been

More information

User Instructions:Transfection-ready CRISPR/Cas9 Reagents. Target DNA. NHEJ repair pathway. Nucleotide deletion. Nucleotide insertion Gene disruption

User Instructions:Transfection-ready CRISPR/Cas9 Reagents. Target DNA. NHEJ repair pathway. Nucleotide deletion. Nucleotide insertion Gene disruption User Instructions:Transfection-ready CRISPR/Cas9 Reagents Background Introduction to CRISPR/Cas9 genome editing In bacteria and archaea, clustered regularly interspaced short palindromic repeats (CRISPR)

More information

Alt-R CRISPR-Cas9 System:

Alt-R CRISPR-Cas9 System: Alt-R CRISPR-Cas9 System: Cationic lipid delivery of CRISPR ribonucleoprotein complexes into mammalian cells See what more we can do for you at www.idtdna.com. For Research Use Only Version 4 genome editing

More information

Genome editing. Knock-ins

Genome editing. Knock-ins Genome editing Knock-ins Experiment design? Should we even do it? In mouse or rat, the HR-mediated knock-in of homologous fragments derived from a donor vector functions well. However, HR-dependent knock-in

More information

CRISPR 101: Optimizing Your Gene Editing Experiments

CRISPR 101: Optimizing Your Gene Editing Experiments CRISPR 101: Optimizing Your Gene Editing Experiments PRESENTER Michele Auldridge, Ph.D. Senior Scientist, R&D MODERATOR Beth Frey Product Manager Agenda 1 Technology Overview 2 Experimental Decisions 3

More information

LabBOOK VIROMER CRISPR. for RNP delivery

LabBOOK VIROMER CRISPR. for RNP delivery LabBOOK VIROMER CRISPR for RNP delivery General information Technology Viromer are polymer-based transfection reagents featuring a viral mechanism of membrane fusion. They do form transfection complexes

More information

Protocols for cloning SEC-based repair templates using SapTrap assembly

Protocols for cloning SEC-based repair templates using SapTrap assembly Protocols for cloning SEC-based repair templates using SapTrap assembly Written by Dan Dickinson (ddickins@live.unc.edu) and last updated July 2016. Overview SapTrap (Schwartz and Jorgensen, 2016) is a

More information

Homology-directed repair with Dharmacon Edit-R CRISPR-Cas9 reagents and single-stranded DNA oligos

Homology-directed repair with Dharmacon Edit-R CRISPR-Cas9 reagents and single-stranded DNA oligos APPLICATION NOTE Homology-directed repair with Dharmacon Edit-R CRISPR- reagents and single-stranded DNA oligos John A. Schiel, Eldon Chou, Maren Mayer, Emily M. Anderson, and Anja van Brabant Smith Horizon

More information

Easi CRISPR for conditional and insertional alleles

Easi CRISPR for conditional and insertional alleles Easi CRISPR for conditional and insertional alleles C.B Gurumurthy, University Of Nebraska Medical Center Omaha, NE cgurumurthy@unmc.edu Types of Genome edits Gene disruption/inactivation Types of Genome

More information

Protocol for cloning SEC-based repair templates using Gibson assembly and ccdb negative selection

Protocol for cloning SEC-based repair templates using Gibson assembly and ccdb negative selection Protocol for cloning SEC-based repair templates using Gibson assembly and ccdb negative selection Written by Dan Dickinson (daniel.dickinson@austin.utexas.edu) and last updated January 2018. A version

More information

Introduction and History of Genome Modification. Adam Clore, PhD Director, Synthetic Biology Design

Introduction and History of Genome Modification. Adam Clore, PhD Director, Synthetic Biology Design Introduction and History of Genome Modification Adam Clore, PhD Director, Synthetic Biology Design Early Non-site Directed Genome Modification Homologous recombination in yeast TARGET GENE 5 Arm URA3 3

More information

CRISPR/Cas9 Gene Editing Tools

CRISPR/Cas9 Gene Editing Tools CRISPR/Cas9 Gene Editing Tools - Separations Simply Spectacular INDELS Identify indels Determine if one or both copies of your gene have indels The Guide-it Genotype Confirmation Kit: Simple detection

More information

character design & illustration: ryuji nouguchi Special Edition

character design & illustration: ryuji nouguchi Special Edition character design & illustration: ryuji nouguchi Special Edition Hmm... my sirna experiment worked, and now I want to know more about this gene. Can I completely knock out its expression in cells? Hello

More information

CRISPR/Cas9 Gene Editing Tools

CRISPR/Cas9 Gene Editing Tools CRISPR/Cas9 Gene Editing Tools - Guide-it Products for Successful CRISPR/Cas9 Gene Editing - Why choose Guide-it products? Optimized methods designed for speed and ease of use Complete kits that don t

More information

Guide-it sgrna In Vitro Transcription and Screening Systems User Manual

Guide-it sgrna In Vitro Transcription and Screening Systems User Manual Guide-it sgrna In Vitro Transcription and Screening Systems User Manual Cat. Nos. 632638, 632639, 632635, 632636, 632637 (040618) 1290 Terra Bella Avenue, Mountain View, CA 94043, USA U.S. Technical Support:

More information

Protocols for cloning SEC-based repair templates using SapTrap assembly

Protocols for cloning SEC-based repair templates using SapTrap assembly Protocols for cloning SEC-based repair templates using SapTrap assembly Written by Dan Dickinson (daniel.dickinson@austin.utexas.edu) and last updated January 2018. Overview SapTrap (Schwartz and Jorgensen,

More information

Genome edi3ng with the CRISPR-Cas9 system

Genome edi3ng with the CRISPR-Cas9 system CRISPR-Cas9 Genome Edi3ng Bootcamp AHA Council on Func3onal Genomics and Transla3onal Biology Narrated video link: hfps://youtu.be/h18hmftybnq Genome edi3ng with the CRISPR-Cas9 system Kiran Musunuru,

More information

Puro. Knockout Detection (KOD) Kit

Puro. Knockout Detection (KOD) Kit Puro Knockout Detection (KOD) Kit Cat. No. CC-03 18 Oct. 2016 Contents I. Kit Contents and Storage II. Product Overview III. Methods Experimental Outline Genomic DNA Preparation Obtain Hybrid DNA Digest

More information

Electroporation of human induced pluripotent stem (ips) cells

Electroporation of human induced pluripotent stem (ips) cells Electroporation of human induced pluripotent stem (ips) cells Ribonucleoprotein delivery using the Alt-R CRISPR-Cas9 System and the NEPA21 Electroporator Contributed by Nepa Gene, Chiba, Japan (info@nepagene.jp)

More information

Guide-it sgrna In Vitro Transcription and Screening Systems User Manual

Guide-it sgrna In Vitro Transcription and Screening Systems User Manual Clontech Laboratories, Inc. Guide-it sgrna In Vitro Transcription and Screening Systems User Manual Cat. Nos. 631438, 631439 & 631440 (042114) Clontech Laboratories, Inc. A Takara Bio Company 1290 Terra

More information

Large scale genome editing for. Senior Scientist, GenScript

Large scale genome editing for. Senior Scientist, GenScript Large scale genome editing for metabolic engineering of E. coli YifanLi Li, Ph.D PhD Senior Scientist, GenScript Metabolic engineering Cell factory Remove inhibition Substrate Overexpressing pathway genes

More information

Protocols for cell lines using CRISPR/CAS

Protocols for cell lines using CRISPR/CAS Protocols for cell lines using CRISPR/CAS Procedure overview Map Preparation of CRISPR/CAS plasmids Expression vectors for guide RNA (U6-gRNA) and Cas9 gene (CMV-p-Cas9) are ampicillin-resist ant and stable

More information

Chapter 6 - Molecular Genetic Techniques

Chapter 6 - Molecular Genetic Techniques Chapter 6 - Molecular Genetic Techniques Two objects of molecular & genetic technologies For analysis For generation Molecular genetic technologies! For analysis DNA gel electrophoresis Southern blotting

More information

TECHNICAL MANUAL. Dharmacon Edit-R HDR plasmid donor kit for fluorescent reporter knock-in

TECHNICAL MANUAL. Dharmacon Edit-R HDR plasmid donor kit for fluorescent reporter knock-in Dharmacon Edit-R HDR plasmid donor kit for fluorescent reporter knock-in Contents 1 Introduction to the CRISPR-Cas9 system for gene engineering...3 CRISPR-Cas: an adaptive immunity defense mechanism in

More information

Development of High Quality CRISPR/Cas9 Agents

Development of High Quality CRISPR/Cas9 Agents Development of High Quality CRISPR/Cas9 Agents TIDES May 7 th, 2018 Terence Ta editasmedicine.com 1 Agenda Overview of CRISPR and Editas platform Development of NGS-based method for guide RNA QC Covalently-coupled

More information

Molecular Genetics Techniques. BIT 220 Chapter 20

Molecular Genetics Techniques. BIT 220 Chapter 20 Molecular Genetics Techniques BIT 220 Chapter 20 What is Cloning? Recombinant DNA technologies 1. Producing Recombinant DNA molecule Incorporate gene of interest into plasmid (cloning vector) 2. Recombinant

More information

Surrogate reporter-based enrichment of cells containing RNA-guided Cas9 nucleaseinduced

Surrogate reporter-based enrichment of cells containing RNA-guided Cas9 nucleaseinduced Supplementary Data Surrogate reporter-based enrichment of cells containing RNA-guided Cas9 nucleaseinduced mutations Suresh Ramakrishna 1, Seung Woo Cho 2, Sojung Kim 2, Myungjae Song 1, Ramu Gopalappa

More information

Improving CRISPR-Cas9 Gene Knockout with a Validated Guide RNA Algorithm

Improving CRISPR-Cas9 Gene Knockout with a Validated Guide RNA Algorithm Improving CRISPR-Cas9 Gene Knockout with a Validated Guide RNA Algorithm Anja Smith Director R&D Dharmacon, part of GE Healthcare Imagination at work crrna:tracrrna program Cas9 nuclease Active crrna is

More information

Lentiviral CRISPR guild RNA Cloning Kit for constructing CRISPR targeting grna lentivectors

Lentiviral CRISPR guild RNA Cloning Kit for constructing CRISPR targeting grna lentivectors Lentiviral CRISPR guild RNA Cloning Kit for constructing CRISPR targeting grna lentivectors Cat# Product Name Amount Application grna-h1-gb grna-h1-gp grna-h1-rb grna-h1-rp grna-h1-puro grna-h1-bsd grna-u6-gb

More information

For designing necessary primers and oligos for grna, online CRISPR designing tools can be used (e.g.

For designing necessary primers and oligos for grna, online CRISPR designing tools can be used (e.g. DESIGN OF grnas For designing necessary primers and oligos for grna, online CRISPR designing tools can be used (e.g. http://crispr.mit.edu/, https://benchling.com). Assembly of grna transcriptional cassettes

More information

Recitation CHAPTER 9 DNA Technologies

Recitation CHAPTER 9 DNA Technologies Recitation CHAPTER 9 DNA Technologies DNA Cloning: General Scheme A cloning vector and eukaryotic chromosomes are separately cleaved with the same restriction endonuclease. (A single chromosome is shown

More information

CRISPR GENOMIC SERVICES PRODUCT CATALOG

CRISPR GENOMIC SERVICES PRODUCT CATALOG CRISPR GENOMIC SERVICES PRODUCT CATALOG DESIGN BUILD ANALYZE The experts at Desktop Genetics can help you design, prepare and manufacture all of the components needed for your CRISPR screen. We provide

More information

Using CRISPR for genetic alteration

Using CRISPR for genetic alteration Using CRISPR for genetic alteration Joffrey Mianné. j.mianne@har.mrc.ac.uk Mary Lyon Centre, MRC Harwell. CRISPR/Cas origins Origin of the CRISPR/Cas system: Clustered-Regularly Interspaced Short Palindromic

More information

Genetics and Genomics in Medicine Chapter 3. Questions & Answers

Genetics and Genomics in Medicine Chapter 3. Questions & Answers Genetics and Genomics in Medicine Chapter 3 Multiple Choice Questions Questions & Answers Question 3.1 Which of the following statements, if any, is false? a) Amplifying DNA means making many identical

More information

Nature Biotechnology: doi: /nbt Supplementary Figure 1. In vitro validation of OTC sgrnas and donor template.

Nature Biotechnology: doi: /nbt Supplementary Figure 1. In vitro validation of OTC sgrnas and donor template. Supplementary Figure 1 In vitro validation of OTC sgrnas and donor template. (a) In vitro validation of sgrnas targeted to OTC in the MC57G mouse cell line by transient transfection followed by 4-day puromycin

More information

A Practical Guide to CRISPR-Mediated Gene Tagging with a Bioluminescent Peptide

A Practical Guide to CRISPR-Mediated Gene Tagging with a Bioluminescent Peptide A Practical Guide to CRISPR-Mediated Gene Tagging with a Bioluminescent Peptide Marie K. Schwinn, PhD Senior Research Scientist For Research Use Only. Not for use in diagnostic procedures. Why endogenous

More information

Incorporating SeqStudio Genetic Analyzer and Sanger sequencing into genome editing workflows

Incorporating SeqStudio Genetic Analyzer and Sanger sequencing into genome editing workflows Incorporating SeqStudio Genetic Analyzer and Sanger sequencing into genome editing workflows Stephen Jackson, Ph.D 27 May 2017 The world leader in serving science Key Applications for Genome Editing Research

More information

CRISPR/Cas9 Gene Editing

CRISPR/Cas9 Gene Editing CRISPR/Cas9 Gene Editing Fragment Analyzer Automated CE System Identify single-cell mutations and determine mutation frequency. Mutation analysis by capillary electrophoresis provides significant benefits

More information

A Guide to CRISPR/Cas9

A Guide to CRISPR/Cas9 Genome editing and beyond freepik A Guide to CRISPR/Cas9 The latest advance in genomic DNA editing is the Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR)/Cas9 system. This simple-touse

More information

Lipofection of Cas9/synthetic RNA ribonucleoprotein (RNP) complexes for CRISPR/Cas9 genome editing (Thermo CRISPRMAX Kit)

Lipofection of Cas9/synthetic RNA ribonucleoprotein (RNP) complexes for CRISPR/Cas9 genome editing (Thermo CRISPRMAX Kit) Lipofection of Cas9/synthetic RNA ribonucleoprotein (RNP) complexes for CRISPR/Cas9 genome editing (Thermo CRISPRMAX Kit) BACKGROUND This protocol describes how to transfect cultured cells with ribonucleoprotein

More information

GenBuilder TM Plus Cloning Kit User Manual

GenBuilder TM Plus Cloning Kit User Manual GenBuilder TM Plus Cloning Kit User Manual Cat. No. L00744 Version 11242017 Ⅰ. Introduction... 2 I.1 Product Information... 2 I.2 Kit Contents and Storage... 2 I.3 GenBuilder Cloning Kit Workflow... 2

More information

GenBuilder TM Plus Cloning Kit User Manual

GenBuilder TM Plus Cloning Kit User Manual GenBuilder TM Plus Cloning Kit User Manual Cat.no L00744 Version 11242017 Ⅰ. Introduction... 2 I.1 Product Information... 2 I.2 Kit Contents and Storage... 2 I.3 GenBuilder Cloning Kit Workflow... 2 Ⅱ.

More information

Supplementary Figure 1. Diagram for CATCHA construct. Nature Biotechnology doi: /nbt.3444

Supplementary Figure 1. Diagram for CATCHA construct. Nature Biotechnology doi: /nbt.3444 Supplementary Figure 1 Diagram for CATCHA construct. Supplementary Figure 2 Representative view of ebony (left) and non-ebony (right) F2 flies from experiments described in Fig. 1c. F0 #1 F0 #2 F0 #3 F0

More information

Allele-specific locus binding and genome editing by CRISPR at the

Allele-specific locus binding and genome editing by CRISPR at the Supplementary Information Allele-specific locus binding and genome editing by CRISPR at the p6ink4a locus Toshitsugu Fujita, Miyuki Yuno, and Hodaka Fujii Supplementary Figure Legends Supplementary Figure

More information

PLNT2530 (2018) Unit 9. Genome Editing

PLNT2530 (2018) Unit 9. Genome Editing PLNT2530 (2018) Unit 9 Genome Editing Unless otherwise cited or referenced, all content of this presenataion is licensed under the Creative Commons License Attribution Share-Alike 2.5 Canada 1 Genome Editing

More information

Maximizing your NGS sequencing with IDT. Adam Chernick, PhD Field Applications Manager, Functional Genomics

Maximizing your NGS sequencing with IDT. Adam Chernick, PhD Field Applications Manager, Functional Genomics Maximizing your NGS sequencing with IDT Adam Chernick, PhD Field Applications Manager, Functional Genomics 1 Contents Expanding our NGS portfolio what s next? xgen technology and Lockdown probe advantages

More information

CRISPRcraft S.p. Cas9 Nuclease. CRISPRcraft S.p. Cas9 Control Kit

CRISPRcraft S.p. Cas9 Nuclease. CRISPRcraft S.p. Cas9 Control Kit CRISPRcraft S.p. Cas9 Control Kit FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE Lucigen Corporation 2905 Parmenter St, Middleton, WI 53562 USA Toll Free: (888) 575-9695 (608) 831-9011 FAX: (608)

More information

Return to Web Version

Return to Web Version Page 1 of 7 Page 1 of 7 Return to Web Version ZFN Technology Biowire Volume 10 Article 1 Have your genomic work cut out for you The genomes of several organisms, including humans, have been sequenced,

More information

Genome Editing: Cas9 Stable Cell Lines for CRISPR sgrna Validation, Library Screening, and More. Ed Davis, Ph.D.

Genome Editing: Cas9 Stable Cell Lines for CRISPR sgrna Validation, Library Screening, and More. Ed Davis, Ph.D. TECHNICAL NOTE Genome Editing: Cas9 Stable Cell Lines for CRISPR sgrna Validation, Library Screening, and More Introduction Ed Davis, Ph.D. The CRISPR-Cas9 system has become greatly popular for genome

More information

A universal chassis plasmid pwh34 was first constructed to facilitate the

A universal chassis plasmid pwh34 was first constructed to facilitate the 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 File name: Supplementary method Plasmids construction A universal chassis plasmid pwh34 was first constructed to facilitate the construction

More information

Technical tips Session 4

Technical tips Session 4 Technical tips Session 4 Biotinylation assay: Streptavidin is a small bacterial protein that binds with high affinity to the vitamin biotin. This streptavidin-biotin combination can be used to link molecules

More information

Versatility and performance of Lipofectamine Stem Transfection Reagent

Versatility and performance of Lipofectamine Stem Transfection Reagent PPLICTION NOTE Stem Transfection Reagent Versatility and performance of Stem Transfection Reagent Introduction The ability of stem cells to self-renew and differentiate into various specialized cell types

More information

EnGen Mutation Detection Kit

EnGen Mutation Detection Kit DNA MODIFYING ENZYMES EnGen Mutation Detection Kit Instruction Manual NEB #E3321S 25 reactions Version 2.0 6/18 be INSPIRED drive DISCOVERY stay GENUINE This product is intended for research purposes only.

More information

Electroporation of Cas9/Synthetic RNA Ribonucleoprotein (RNP) Complexes for CRISPR/Cas9 Genome Editing (Thermo Neon System)

Electroporation of Cas9/Synthetic RNA Ribonucleoprotein (RNP) Complexes for CRISPR/Cas9 Genome Editing (Thermo Neon System) Electroporation of Cas9/Synthetic RNA Ribonucleoprotein (RNP) Complexes for CRISPR/Cas9 Genome Editing (Thermo Neon System) BACKGROUND This protocol describes how to transfect cultured cells with ribonucleoprotein

More information

Chapter 8: Recombinant DNA. Ways this technology touches us. Overview. Genetic Engineering

Chapter 8: Recombinant DNA. Ways this technology touches us. Overview. Genetic Engineering Chapter 8 Recombinant DNA and Genetic Engineering Genetic manipulation Ways this technology touches us Criminal justice The Justice Project, started by law students to advocate for DNA testing of Death

More information

Design. Construction. Characterization

Design. Construction. Characterization Design Construction Characterization DNA mrna (messenger) A C C transcription translation C A C protein His A T G C T A C G Plasmids replicon copy number incompatibility selection marker origin of replication

More information

Genome editing as a new powerful tool for wheat breeding

Genome editing as a new powerful tool for wheat breeding Genome editing as a new powerful tool for wheat breeding Vladimir Nekrasov 15 th WGIN Stakeholders Meeting Applying CRISPR Cas9 technology in model and crop plants Model plant: Crop plants: Nicotiana

More information

ksierzputowska.com Research Title: Using novel TALEN technology to engineer precise mutations in the genome of D. melanogaster

ksierzputowska.com Research Title: Using novel TALEN technology to engineer precise mutations in the genome of D. melanogaster Research Title: Using novel TALEN technology to engineer precise mutations in the genome of D. melanogaster Research plan: Specific aims: 1. To successfully engineer transgenic Drosophila expressing TALENs

More information

Protocol for Genome Editing via the RNA-guided Cas9 Nuclease in. Zebrafish Embryos 1

Protocol for Genome Editing via the RNA-guided Cas9 Nuclease in. Zebrafish Embryos 1 Protocol for Genome Editing via the RNA-guided Cas9 Nuclease in Zebrafish Embryos 1 1. In vitro synthesis of capped Cas9 mrna The full length of humanized Cas9 cdnas with double NLS were cloned into pxt7

More information

Automated Electrophoresis Applications for Synthetic Biology

Automated Electrophoresis Applications for Synthetic Biology Automated Electrophoresis Applications for Synthetic Biology Melissa Huang Liu, Ph.D. Product Manager, Electrophoresis Agilent Technologies 1 Outline 2100 Bioanalyzer & 4200 TapeStation Systems Automated

More information

Cat # Box1 Box2. DH5a Competent E. coli cells CCK-20 (20 rxns) 40 µl 40 µl 50 µl x 20 tubes. Choo-Choo Cloning TM Enzyme Mix

Cat # Box1 Box2. DH5a Competent E. coli cells CCK-20 (20 rxns) 40 µl 40 µl 50 µl x 20 tubes. Choo-Choo Cloning TM Enzyme Mix Molecular Cloning Laboratories User Manual Version 3.3 Product name: Choo-Choo Cloning Kits Cat #: CCK-10, CCK-20, CCK-096, CCK-384 Description: Choo-Choo Cloning is a highly efficient directional PCR

More information

Eric Paul Bennett, MSc, Dr.med. Cellular Indel Profiles and Dynamics CRISPR/Cas9 delivery formats: Applying in vitro methodologies ex vivo

Eric Paul Bennett, MSc, Dr.med. Cellular Indel Profiles and Dynamics CRISPR/Cas9 delivery formats: Applying in vitro methodologies ex vivo Copenhagen Center for Glycomics/Department of Odontology Eric Paul Bennett, MSc, Dr.med. Cellular Indel Profiles and Dynamics CRISPR/Cas9 delivery formats: Applying in vitro methodologies ex vivo Eric

More information

3 Designing Primers for Site-Directed Mutagenesis

3 Designing Primers for Site-Directed Mutagenesis 3 Designing Primers for Site-Directed Mutagenesis 3.1 Learning Objectives During the next two labs you will learn the basics of site-directed mutagenesis: you will design primers for the mutants you designed

More information

Testing Non-Transgenic CRISPR Technology for Wheat Improvement 13 TH IWGS - TULLN, AUSTRIA

Testing Non-Transgenic CRISPR Technology for Wheat Improvement 13 TH IWGS - TULLN, AUSTRIA Testing Non-Transgenic CRISPR Technology for Wheat Improvement KALI M BRANDT, HILARY L GUNN, BRETT L BUSCHKE, ADAM HEESACKER, NATHALIA MORET TI, ALEXANDER KARASEV, ROBERT S ZEMETRA 13 TH IWGS - TULLN,

More information

Amplified segment of DNA can be purified from bacteria in sufficient quantity and quality for :

Amplified segment of DNA can be purified from bacteria in sufficient quantity and quality for : Transformation Insertion of DNA of interest Amplification Amplified segment of DNA can be purified from bacteria in sufficient quantity and quality for : DNA Sequence. Understand relatedness of genes and

More information

NZYGene Synthesis kit

NZYGene Synthesis kit Kit components Component Concentration Amount NZYGene Synthesis kit Catalogue number: MB33901, 10 reactions GS DNA Polymerase 1U/ μl 30 μl Reaction Buffer for GS DNA Polymerase 10 150 μl dntp mix 2 mm

More information

Lecture Four. Molecular Approaches I: Nucleic Acids

Lecture Four. Molecular Approaches I: Nucleic Acids Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single

More information

Computational Biology I LSM5191

Computational Biology I LSM5191 Computational Biology I LSM5191 Lecture 5 Notes: Genetic manipulation & Molecular Biology techniques Broad Overview of: Enzymatic tools in Molecular Biology Gel electrophoresis Restriction mapping DNA

More information

Introducing Your Students To Gene Editing With CRISPR

Introducing Your Students To Gene Editing With CRISPR Introducing Your Students To Gene Editing With CRISPR Brian Ell, Ph.D. Edvotek www.edvotek.com Follow @Edvotek EDVOTEK Biotech The Biotechnology Education Company Celebrating 30 years of science education!

More information

Bi 8 Lecture 4. Ellen Rothenberg 14 January Reading: from Alberts Ch. 8

Bi 8 Lecture 4. Ellen Rothenberg 14 January Reading: from Alberts Ch. 8 Bi 8 Lecture 4 DNA approaches: How we know what we know Ellen Rothenberg 14 January 2016 Reading: from Alberts Ch. 8 Central concept: DNA or RNA polymer length as an identifying feature RNA has intrinsically

More information

Manipulating DNA. Nucleic acids are chemically different from other macromolecules such as proteins and carbohydrates.

Manipulating DNA. Nucleic acids are chemically different from other macromolecules such as proteins and carbohydrates. Lesson Overview 14.3 Studying the Human Genome Nucleic acids are chemically different from other macromolecules such as proteins and carbohydrates. Nucleic acids are chemically different from other macromolecules

More information

Supplementary Methods pcfd5 cloning protocol

Supplementary Methods pcfd5 cloning protocol Supplementary Methods cloning protocol vermilion trna grna trna grna U6:3 Terminator AmpR attb is a vector for expressing one or multiple trna-flanked Cas9 grnas under the control of the strong, ubiquitous

More information

CRISPR/Cas9 Mouse Production

CRISPR/Cas9 Mouse Production CRISPR/Cas9 Mouse Production Emory Transgenic and Gene Targeting Core http://cores.emory.edu/tmc Tamara Caspary, Ph.D. Scientific Director Teresa Quackenbush --- Lab Operations and Communications Coordinator

More information

Introducing new DNA into the genome requires cloning the donor sequence, delivery of the cloned DNA into the cell, and integration into the genome.

Introducing new DNA into the genome requires cloning the donor sequence, delivery of the cloned DNA into the cell, and integration into the genome. Key Terms Chapter 32: Genetic Engineering Cloning describes propagation of a DNA sequence by incorporating it into a hybrid construct that can be replicated in a host cell. A cloning vector is a plasmid

More information

Genome Editing: Considerations for Therapeutic Applications Cecilia Fernandez TIDES,

Genome Editing: Considerations for Therapeutic Applications Cecilia Fernandez TIDES, Genome Editing: Considerations for Therapeutic Applications Cecilia Fernandez TIDES, 2017 www.editasmedicine.com 1 The Potential to Repair Any Broken Gene Transformative new category of medicines for genetically-defined

More information

GenBuilder TM Cloning Kit User Manual

GenBuilder TM Cloning Kit User Manual GenBuilder TM Cloning Kit User Manual Cat.no L00701 Version 11242017 Ⅰ. Introduction... 2 I.1 Product Information... 2 I.2 Kit Contents and Storage... 2 I.3 GenBuilder Cloning Kit Workflow... 2 Ⅱ. DNA

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID myeloperoxidase MPO Human Myeloperoxidase (MPO) is a heme protein synthesized during

More information

EnGen sgrna Synthesis Kit, S. pyogenes

EnGen sgrna Synthesis Kit, S. pyogenes RNA ENZYMES & GENE ANALYSIS EnGen sgrna Synthesis Kit, S. pyogenes Instruction Manual NEB #E3322S 20 reactions Version 2.0 7/18 be INSPIRED drive DISCOVERY stay GENUINE This product is intended for research

More information

Bi 8 Lecture 5. Ellen Rothenberg 19 January 2016

Bi 8 Lecture 5. Ellen Rothenberg 19 January 2016 Bi 8 Lecture 5 MORE ON HOW WE KNOW WHAT WE KNOW and intro to the protein code Ellen Rothenberg 19 January 2016 SIZE AND PURIFICATION BY SYNTHESIS: BASIS OF EARLY SEQUENCING complex mixture of aborted DNA

More information

Genome-scale engineering for systems and synthetic biology 彭文磊

Genome-scale engineering for systems and synthetic biology 彭文磊 Genome-scale engineering for systems and synthetic biology 彭文磊 Part 1 Part 2 Part 3 Introduction. Review current technologies and methodologies for genome-scale engineering. Discuss the prospects for extending

More information

TECH NOTE Ligation-Free ChIP-Seq Library Preparation

TECH NOTE Ligation-Free ChIP-Seq Library Preparation TECH NOTE Ligation-Free ChIP-Seq Library Preparation The DNA SMART ChIP-Seq Kit Ligation-free template switching technology: Minimize sample handling in a single-tube workflow >> Simplified protocol with

More information

Pooled CRISPR guide RNA libraries for functional genomics screening: Do you know what s in your library?

Pooled CRISPR guide RNA libraries for functional genomics screening: Do you know what s in your library? Pooled CRISPR guide RNA libraries for functional genomics screening: Do you know what s in your library? Peter Sheffield R&D Scientific Program Director Agilent Technologies INTRODUCTION CRISPR: A Programmable

More information

Efficient generation of conditional knockout mice by CLICK

Efficient generation of conditional knockout mice by CLICK Efficient generation of conditional knockout mice by CLICK Tomoji Mashimo Genome Editing Research and Development (R&D) Center and Institute of Experimental Animal Sciences, Graduate School of Medicine,

More information

Generating stable cell lines expressing various Cas9 proteins from AAVS1 locus

Generating stable cell lines expressing various Cas9 proteins from AAVS1 locus IGI Protocol prepared by Chong Park 1 Generating stable cell lines expressing various Cas9 proteins from AAVS1 locus This is modified from original protocol from the Conklin laboratory (Mandegar et al.

More information