Getting started with CRISPR: A review of gene knockout and homology-directed repair
|
|
- Paulina Allen
- 6 years ago
- Views:
Transcription
1 Getting started with CRISPR: A review of gene knockout and homology-directed repair Justin Barr Product Manager, Functional Genomics Integrated DNA Technologies 1
2 Agenda: Getting started with CRISPR Background Overview of the basic CRISPR workflow Planning for gene knockout Designing the guide RNA Comparing delivery methods Homology-directed repair (HDR) Designing repair templates 2
3 CRISPR editing Guide RNA Ribonucleoprotein (RNP) DNA repair pathways Non-homologous end joining (NHEJ) Cas9 protein Disrupt a gene Homology directed repair (HDR) Insertion or change sequence specifically 3
4 Implementing CRISPR-Cas9 genome editing 4
5 Basic workflow Lipofection Design grnas Assemble RNP Electroporation Collect genomic DNA Microinjection Analyze 5
6 Gene disruption/knockout 6
7 Considerations for CRISPR design tools Species/cell line(s) tested Cas9 source Guide RNA source Method of delivery Basis for results ranking Off-target score On-target score Filtering 7
8 Tools used in these examples UCSC Genome Browser genome.ucsc.edu CRISPR Design Zhang Lab, MIT crispr.mit.edu 8
9 Basic workflow Lipofection Design grnas Assemble RNP Electroporation Collect genomic DNA Microinjection Analyze 9
10 3-step transfection: Alt-R CRISPR System 1:1 Step 1 + grna complex formation 15 min 1:1 Step 2 + RNP complex formation 10 min RNP delivery Step 3 Lipofection: 10 nm Electroporation: 1 4 µm Microinjection min 10
11 Basic workflow Lipofection Design grnas Assemble RNP Electroporation Collect genomic DNA Microinjection Analyze 11
12 Delivery method comparison Lipofection No instrument required Low RNP amount High-throughput Inexpensive Not compatible with all cell types Risk of toxicity Electroporation Works with most cell types (primary, ipsc) High-throughput options available High RNP amount Requires instrument purchase Consumables can be expensive Microinjection Model organism generation Pronuclear delivery often possible Lower RNP amount Requires experienced technician Requires special equipment Can be expensive 12
13 Detailed protocols available online User methods: Detailed lipofection and electroporation guides: 13
14 Basic workflow Lipofection Design grnas Assemble RNP Electroporation (primary cells, ipscs, etc.) Microinjection Mouse model generation and other research organisms Collect genomic DNA Analyze 14
15 Collecting genomic DNA Wash cells Lyse cells Transfer & vortex Heat Dilute & spin down 15
16 Analyzing results: T7 endonuclease I (T7EI) assay 1. PCR amplify region targeted by CRISPR 2. Heat and cool PCR products to allow heteroduplex formation 3. Incubate with T7EI enzyme (cleaves DNA at mismatches) 4. Visualize products by electrophoresis 16
17 Homology-directed repair (HDR) 17
18 3-step transfection: Alt-R CRISPR System 1:1 Step 1 + grna complex formation 15 min 1:1 Step 2 + RNP complex formation 10 min Step 3 RNP delivery Lipofection: 10 nm Electroporation: 1 4 µm Microinjection + HDR template Ultramer Oligonucleotides min 18
19 HDR considerations Desired mutation size should determine template choice Point mutations and small insertions or tags Single-stranded oligos (Ultramer DNA Oligonucleotides) Standard desalting purification Total unit length: 200 nt or less, including homology arms of typically nt Large corrections and insertion of new coding material Longer homology arms ( bases) HDR donor plasmid dsdna (gblocks Gene Fragments) Design HDR template as close to cut site as possible 19
20 Homology directed repair symmetric templates Flanking arm length Cas9 cleavage crrna guide EcoRI restriction enzyme site (6 bases) inserted into EMX1 10 nm Alt-R CRISPR RNP transfected into HEK-293 cells via lipofection Single stranded HDR oligos: standard desalt Ultramer Oligos 3 nm dsdna or ssdna HDR template co-transfected with RNP Isolated genomic DNA 48 hr post lipofection PCR amplified gdna with PCR primers designed outside the flanking arms of the HDR template sequence Digested PCR product with T7EI to determine total editing, and EcoRI to determine insertion 20
21 HDR efficiency is optimal with nt homology arms Cleavage (%) T7EI total editing EcoRI insertion Insertion into EMX1 Homology arm length 92 nt 27 nt 21
22 dsdna templates integrate by both NHEJ and HDR DSB Single-stranded HDR template HDR products ssdna HDR template HDR products or dsdna HDR template HDR Double-stranded HDR template or HDR NHEJ NHEJ products 22
23 HDR efficiency varies with integration site BCKDK-AS-1079 HIF1A-S-210 KHK-S-224 EGFR-S LDHA-S-2494 EcoRI cleavage (%) EcoRI insertion Homology arm length 57 nt 37 nt 23
24 Designing the HDR repair template WT sequence TTACGCTGATGAATATTCTA TATTCTAAGGCGTTACGCTGATGAATATTCTACGGAATTGCCATAGGCGTTGAACGCTAC ATAAGATTCCGCAATGCGACTACTTATAAGATGCCTTAACGGTATCCGCAACTTGCGATG Desired edit (stop codon) TATTCTAAGGCGTTACGCTGATGAATATTAAACGGAATTGCCATAGGCGTTGAACGCTAC ATAAGATTCCGCAATGCGACTACTTATAATTTGCCTTAACGGTATCCGCAACTTGCGATG HDR template TTACGCTGATGAATATTCTA xx TATTCTAAGGCGTTACGCTGATGAATATTAAACGGAATTGCCATAGGCGTTGAACGCTAC base arm base arm mutation 24
25 Designing the HDR repair template WT sequence TTACGCTGATGAATATTCTA TATTCTAAGGCGTTACGCTGATGAATATTCTACGGAATTGCCATAGGCGTTGAACGCTAC ATAAGATTCCGCAATGCGACTACTTATAAGATGCCTTAACGGTATCCGCAACTTGCGATG Desired edit (stop codon) TATTCTAAGGCGTTACGCTGATGAATA TTCTACGGAATTGCCATAGGCGTTGAACGCTAC 33 bp insert ATAAGATTCCGCAATGCGACTACTTAT AAGATGCCTTAACGGTATCCGCAACTTGCGATG TTACGCTGATGAATATTCTA xx TTAAACGGAATTGCCATAGGCGTTGAACGCTAC HDR template TATTCTAAGGCGTTACGCTGATGAATA 33 nt insert base arm base arm 25
26 Synthesis options for HDR templates Standard DNA oligonucleotides Up to 100 bases in length Ultramer Oligonucleotides Up to 200 bases in length Coming soon: Very long, single-stranded DNA fragments bases Currently in limited beta testing phase Interested? Sign up at: 26
27 Summary CRISPR guide RNA design has become fast and easy with the availability of many free online tools. It is important to understand design tool rankings and recommendations, and how these relate to your experiment. Efficient ribonucleoprotein delivery can be achieved through lipofection, electroporation, and microinjection. Optimized protocols are available for many applications. Homology-directed repair allows for simple mutations and small insertions. Oligonucleotide repair templates can be easily designed and synthesized for your experiment. 27
28 Thanks to the scientists who contributed to these studies Mark Behlke, CSO Nicole Bode Michael Christodoulou Michael Collingwood Joe Dobosy Ashley Jacobi Sarah Jacobi Kim Lennox Jessica Lister Garrett Rettig Mollie Schubert Bernice Thommandru Rolf Turk Chris Vakulskas 28
29 Additional resources and support Protocols, methods, and FAQs Visit the Support tab IDT Scientific Applications Support or visit 29
30 THANK YOU 30
Optimizing CRISPR ribonucleoprotein components for precision genome editing
Optimizing CRISPR ribonucleoprotein components for precision genome editing Justin Barr Sr. Product Manager, Integrated DNA Technologies VIB CRISPR User Meeting 18 September 2018 1 Agenda Overview of CRISPR-Cas9
More informationOptimized, chemically-modified crrna:tracrrna complexes for CRISPR gene editing
Optimized, chemically-modified crrna:tracrrna complexes for CRISPR gene editing Mark Behlke MD, PhD Chief Scientific Officer February 24, 2016 1 Implementing CRISPR/Cas9 gene editing 2 To focus on RNA
More informationApplications of Cas9 nickases for genome engineering
application note genome editing Applications of Cas9 nickases for genome engineering Shuqi Yan, Mollie Schubert, Maureen Young, Brian Wang Integrated DNA Technologies, 17 Commercial Park, Coralville, IA,
More informationISU CBC CRISPR Workshop. Michael Collingwood & Mollie Schubert
ISU CBC CRISPR Workshop Michael Collingwood & Mollie Schubert 1 Genome editing (Cas12a) 2 Alt-R CRISPR System complete workflow Design Cut Repair Analyze Cas9/Cas12a + Guide RNA (grna) 3 CRISPR-Cas9 genome
More informationAlt-Ring the genome with CRISPR- Cas9
Alt-Ring the genome with CRISPR- Cas9 Genome editing done easily and fast CHIA Jin Ngee Regional Application Specialist 1 Integrated DNA Technologies The Custom Biology Company 2 IDT was founded by a scientist
More informationCRISPR/Cas9 Genome Editing: Transfection Methods
CRISPR/ Genome Editing: Transfection Methods For over 20 years Mirus Bio has developed and manufactured high performance transfection products and technologies. That expertise is now being applied to the
More informationDesigning CRISPR mediated Gene disruptions with gblocks Gene Fragments
Designing CRISPR mediated Gene disruptions with gblocks Gene Fragments Adam Clore, PhD Manager, Synthetic Biology Design Integrated DNA technology Typical CRISPR timeline in Mammalian cell lines Design
More informationCRISPR Ribonucleoprotein (RNP) User Manual
CRISPR Ribonucleoprotein (RNP) User Manual Description This user manual describes how to use GenScript s CRISPR Ribonucleoprotein (RNP) products for targeted genome editing. The RNP system is comprised
More informationTransfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX
Transfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX INTRODUCTION The CRISPR/Cas genome editing system consists of a single guide RNA
More informationAlt-R CRISPR-Cas9 system:
Alt-R CRISPR-Cas9 system: Delivery of ribonucleoprotein complexes into Jurkat T cells using the Bio-Rad Gene Pulser Xcell Electroporation System See what more we can do for you at www.idtdna.com. For Research
More informationSimple protocol for gene editing using GenCrisprTM Cas9 nuclease
Simple protocol for gene editing using GenCrisprTM Cas9 nuclease Contents Protocol Step 1: Choose the target DNA sequence Step 2: Design sgrna Step 3: Preparation for sgrna 3.1 In vitro transcription of
More informationAmplicons, Heteroduplexes and Enzymes - Proper Processing Elevates Detection of CRISPR Gene Editing Events
Amplicons, Heteroduplexes and Enzymes - Proper Processing Elevates Detection of CRISPR Gene Editing Events Steve Siembieda, MS MBA VP Commercialization ABRF Conference February 2015 What Is CRISPR? Clustered
More informationXactEdit Cas9 Nuclease with NLS User Manual
XactEdit Cas9 Nuclease with NLS User Manual An RNA-guided recombinant endonuclease for efficient targeted DNA cleavage Catalog Numbers CE1000-50K, CE1000-50, CE1000-250, CE1001-250, CE1001-1000 Table of
More informationGenome Engineering with ZFNs, TALENs and CRISPR/Cas9
Genome Engineering with ZFNs, TALENs and CRISPR/Cas9 Designer Endonucleases ZFNs (zinc finger nucleases), TALENs (transcription activator-like effector nucleases) and CRISPR/Cas9 (clustered regularly interspaced
More informationAlt-R CRISPR-Cas9 System:
genome editing user guide Alt-R CRISPR-Cas9 System: Cationic lipid delivery of CRISPR ribonucleoprotein complex into mammalian cells See what more we can do for you at www.idtdna.com. For Research Use
More informationAlt-R CRISPR-Cpf1 System:
user guide Alt-R CRISPR-Cpf1 System: Delivery of ribonucleoprotein complexes in HEK-293 cells using the Amaxa Nucleofector System See what more we can do for you at www.idtdna.com. For Research Use Only
More informationjetcrispr RNP transfection reagent PROTOCOL
jetcrispr RNP transfection reagent PROTOCOL DESCRIPTION jetcrispr is a RiboNucleoProtein (RNP) transfection reagent designed to perform CRISPR-Cas9 genome editing in mammalian cells. This reagent has been
More informationUser Instructions:Transfection-ready CRISPR/Cas9 Reagents. Target DNA. NHEJ repair pathway. Nucleotide deletion. Nucleotide insertion Gene disruption
User Instructions:Transfection-ready CRISPR/Cas9 Reagents Background Introduction to CRISPR/Cas9 genome editing In bacteria and archaea, clustered regularly interspaced short palindromic repeats (CRISPR)
More informationAlt-R CRISPR-Cas9 System:
Alt-R CRISPR-Cas9 System: Cationic lipid delivery of CRISPR ribonucleoprotein complexes into mammalian cells See what more we can do for you at www.idtdna.com. For Research Use Only Version 4 genome editing
More informationGenome editing. Knock-ins
Genome editing Knock-ins Experiment design? Should we even do it? In mouse or rat, the HR-mediated knock-in of homologous fragments derived from a donor vector functions well. However, HR-dependent knock-in
More informationCRISPR 101: Optimizing Your Gene Editing Experiments
CRISPR 101: Optimizing Your Gene Editing Experiments PRESENTER Michele Auldridge, Ph.D. Senior Scientist, R&D MODERATOR Beth Frey Product Manager Agenda 1 Technology Overview 2 Experimental Decisions 3
More informationLabBOOK VIROMER CRISPR. for RNP delivery
LabBOOK VIROMER CRISPR for RNP delivery General information Technology Viromer are polymer-based transfection reagents featuring a viral mechanism of membrane fusion. They do form transfection complexes
More informationProtocols for cloning SEC-based repair templates using SapTrap assembly
Protocols for cloning SEC-based repair templates using SapTrap assembly Written by Dan Dickinson (ddickins@live.unc.edu) and last updated July 2016. Overview SapTrap (Schwartz and Jorgensen, 2016) is a
More informationHomology-directed repair with Dharmacon Edit-R CRISPR-Cas9 reagents and single-stranded DNA oligos
APPLICATION NOTE Homology-directed repair with Dharmacon Edit-R CRISPR- reagents and single-stranded DNA oligos John A. Schiel, Eldon Chou, Maren Mayer, Emily M. Anderson, and Anja van Brabant Smith Horizon
More informationEasi CRISPR for conditional and insertional alleles
Easi CRISPR for conditional and insertional alleles C.B Gurumurthy, University Of Nebraska Medical Center Omaha, NE cgurumurthy@unmc.edu Types of Genome edits Gene disruption/inactivation Types of Genome
More informationProtocol for cloning SEC-based repair templates using Gibson assembly and ccdb negative selection
Protocol for cloning SEC-based repair templates using Gibson assembly and ccdb negative selection Written by Dan Dickinson (daniel.dickinson@austin.utexas.edu) and last updated January 2018. A version
More informationIntroduction and History of Genome Modification. Adam Clore, PhD Director, Synthetic Biology Design
Introduction and History of Genome Modification Adam Clore, PhD Director, Synthetic Biology Design Early Non-site Directed Genome Modification Homologous recombination in yeast TARGET GENE 5 Arm URA3 3
More informationCRISPR/Cas9 Gene Editing Tools
CRISPR/Cas9 Gene Editing Tools - Separations Simply Spectacular INDELS Identify indels Determine if one or both copies of your gene have indels The Guide-it Genotype Confirmation Kit: Simple detection
More informationcharacter design & illustration: ryuji nouguchi Special Edition
character design & illustration: ryuji nouguchi Special Edition Hmm... my sirna experiment worked, and now I want to know more about this gene. Can I completely knock out its expression in cells? Hello
More informationCRISPR/Cas9 Gene Editing Tools
CRISPR/Cas9 Gene Editing Tools - Guide-it Products for Successful CRISPR/Cas9 Gene Editing - Why choose Guide-it products? Optimized methods designed for speed and ease of use Complete kits that don t
More informationGuide-it sgrna In Vitro Transcription and Screening Systems User Manual
Guide-it sgrna In Vitro Transcription and Screening Systems User Manual Cat. Nos. 632638, 632639, 632635, 632636, 632637 (040618) 1290 Terra Bella Avenue, Mountain View, CA 94043, USA U.S. Technical Support:
More informationProtocols for cloning SEC-based repair templates using SapTrap assembly
Protocols for cloning SEC-based repair templates using SapTrap assembly Written by Dan Dickinson (daniel.dickinson@austin.utexas.edu) and last updated January 2018. Overview SapTrap (Schwartz and Jorgensen,
More informationGenome edi3ng with the CRISPR-Cas9 system
CRISPR-Cas9 Genome Edi3ng Bootcamp AHA Council on Func3onal Genomics and Transla3onal Biology Narrated video link: hfps://youtu.be/h18hmftybnq Genome edi3ng with the CRISPR-Cas9 system Kiran Musunuru,
More informationPuro. Knockout Detection (KOD) Kit
Puro Knockout Detection (KOD) Kit Cat. No. CC-03 18 Oct. 2016 Contents I. Kit Contents and Storage II. Product Overview III. Methods Experimental Outline Genomic DNA Preparation Obtain Hybrid DNA Digest
More informationElectroporation of human induced pluripotent stem (ips) cells
Electroporation of human induced pluripotent stem (ips) cells Ribonucleoprotein delivery using the Alt-R CRISPR-Cas9 System and the NEPA21 Electroporator Contributed by Nepa Gene, Chiba, Japan (info@nepagene.jp)
More informationGuide-it sgrna In Vitro Transcription and Screening Systems User Manual
Clontech Laboratories, Inc. Guide-it sgrna In Vitro Transcription and Screening Systems User Manual Cat. Nos. 631438, 631439 & 631440 (042114) Clontech Laboratories, Inc. A Takara Bio Company 1290 Terra
More informationLarge scale genome editing for. Senior Scientist, GenScript
Large scale genome editing for metabolic engineering of E. coli YifanLi Li, Ph.D PhD Senior Scientist, GenScript Metabolic engineering Cell factory Remove inhibition Substrate Overexpressing pathway genes
More informationProtocols for cell lines using CRISPR/CAS
Protocols for cell lines using CRISPR/CAS Procedure overview Map Preparation of CRISPR/CAS plasmids Expression vectors for guide RNA (U6-gRNA) and Cas9 gene (CMV-p-Cas9) are ampicillin-resist ant and stable
More informationChapter 6 - Molecular Genetic Techniques
Chapter 6 - Molecular Genetic Techniques Two objects of molecular & genetic technologies For analysis For generation Molecular genetic technologies! For analysis DNA gel electrophoresis Southern blotting
More informationTECHNICAL MANUAL. Dharmacon Edit-R HDR plasmid donor kit for fluorescent reporter knock-in
Dharmacon Edit-R HDR plasmid donor kit for fluorescent reporter knock-in Contents 1 Introduction to the CRISPR-Cas9 system for gene engineering...3 CRISPR-Cas: an adaptive immunity defense mechanism in
More informationDevelopment of High Quality CRISPR/Cas9 Agents
Development of High Quality CRISPR/Cas9 Agents TIDES May 7 th, 2018 Terence Ta editasmedicine.com 1 Agenda Overview of CRISPR and Editas platform Development of NGS-based method for guide RNA QC Covalently-coupled
More informationMolecular Genetics Techniques. BIT 220 Chapter 20
Molecular Genetics Techniques BIT 220 Chapter 20 What is Cloning? Recombinant DNA technologies 1. Producing Recombinant DNA molecule Incorporate gene of interest into plasmid (cloning vector) 2. Recombinant
More informationSurrogate reporter-based enrichment of cells containing RNA-guided Cas9 nucleaseinduced
Supplementary Data Surrogate reporter-based enrichment of cells containing RNA-guided Cas9 nucleaseinduced mutations Suresh Ramakrishna 1, Seung Woo Cho 2, Sojung Kim 2, Myungjae Song 1, Ramu Gopalappa
More informationImproving CRISPR-Cas9 Gene Knockout with a Validated Guide RNA Algorithm
Improving CRISPR-Cas9 Gene Knockout with a Validated Guide RNA Algorithm Anja Smith Director R&D Dharmacon, part of GE Healthcare Imagination at work crrna:tracrrna program Cas9 nuclease Active crrna is
More informationLentiviral CRISPR guild RNA Cloning Kit for constructing CRISPR targeting grna lentivectors
Lentiviral CRISPR guild RNA Cloning Kit for constructing CRISPR targeting grna lentivectors Cat# Product Name Amount Application grna-h1-gb grna-h1-gp grna-h1-rb grna-h1-rp grna-h1-puro grna-h1-bsd grna-u6-gb
More informationFor designing necessary primers and oligos for grna, online CRISPR designing tools can be used (e.g.
DESIGN OF grnas For designing necessary primers and oligos for grna, online CRISPR designing tools can be used (e.g. http://crispr.mit.edu/, https://benchling.com). Assembly of grna transcriptional cassettes
More informationRecitation CHAPTER 9 DNA Technologies
Recitation CHAPTER 9 DNA Technologies DNA Cloning: General Scheme A cloning vector and eukaryotic chromosomes are separately cleaved with the same restriction endonuclease. (A single chromosome is shown
More informationCRISPR GENOMIC SERVICES PRODUCT CATALOG
CRISPR GENOMIC SERVICES PRODUCT CATALOG DESIGN BUILD ANALYZE The experts at Desktop Genetics can help you design, prepare and manufacture all of the components needed for your CRISPR screen. We provide
More informationUsing CRISPR for genetic alteration
Using CRISPR for genetic alteration Joffrey Mianné. j.mianne@har.mrc.ac.uk Mary Lyon Centre, MRC Harwell. CRISPR/Cas origins Origin of the CRISPR/Cas system: Clustered-Regularly Interspaced Short Palindromic
More informationGenetics and Genomics in Medicine Chapter 3. Questions & Answers
Genetics and Genomics in Medicine Chapter 3 Multiple Choice Questions Questions & Answers Question 3.1 Which of the following statements, if any, is false? a) Amplifying DNA means making many identical
More informationNature Biotechnology: doi: /nbt Supplementary Figure 1. In vitro validation of OTC sgrnas and donor template.
Supplementary Figure 1 In vitro validation of OTC sgrnas and donor template. (a) In vitro validation of sgrnas targeted to OTC in the MC57G mouse cell line by transient transfection followed by 4-day puromycin
More informationA Practical Guide to CRISPR-Mediated Gene Tagging with a Bioluminescent Peptide
A Practical Guide to CRISPR-Mediated Gene Tagging with a Bioluminescent Peptide Marie K. Schwinn, PhD Senior Research Scientist For Research Use Only. Not for use in diagnostic procedures. Why endogenous
More informationIncorporating SeqStudio Genetic Analyzer and Sanger sequencing into genome editing workflows
Incorporating SeqStudio Genetic Analyzer and Sanger sequencing into genome editing workflows Stephen Jackson, Ph.D 27 May 2017 The world leader in serving science Key Applications for Genome Editing Research
More informationCRISPR/Cas9 Gene Editing
CRISPR/Cas9 Gene Editing Fragment Analyzer Automated CE System Identify single-cell mutations and determine mutation frequency. Mutation analysis by capillary electrophoresis provides significant benefits
More informationA Guide to CRISPR/Cas9
Genome editing and beyond freepik A Guide to CRISPR/Cas9 The latest advance in genomic DNA editing is the Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR)/Cas9 system. This simple-touse
More informationLipofection of Cas9/synthetic RNA ribonucleoprotein (RNP) complexes for CRISPR/Cas9 genome editing (Thermo CRISPRMAX Kit)
Lipofection of Cas9/synthetic RNA ribonucleoprotein (RNP) complexes for CRISPR/Cas9 genome editing (Thermo CRISPRMAX Kit) BACKGROUND This protocol describes how to transfect cultured cells with ribonucleoprotein
More informationGenBuilder TM Plus Cloning Kit User Manual
GenBuilder TM Plus Cloning Kit User Manual Cat. No. L00744 Version 11242017 Ⅰ. Introduction... 2 I.1 Product Information... 2 I.2 Kit Contents and Storage... 2 I.3 GenBuilder Cloning Kit Workflow... 2
More informationGenBuilder TM Plus Cloning Kit User Manual
GenBuilder TM Plus Cloning Kit User Manual Cat.no L00744 Version 11242017 Ⅰ. Introduction... 2 I.1 Product Information... 2 I.2 Kit Contents and Storage... 2 I.3 GenBuilder Cloning Kit Workflow... 2 Ⅱ.
More informationSupplementary Figure 1. Diagram for CATCHA construct. Nature Biotechnology doi: /nbt.3444
Supplementary Figure 1 Diagram for CATCHA construct. Supplementary Figure 2 Representative view of ebony (left) and non-ebony (right) F2 flies from experiments described in Fig. 1c. F0 #1 F0 #2 F0 #3 F0
More informationAllele-specific locus binding and genome editing by CRISPR at the
Supplementary Information Allele-specific locus binding and genome editing by CRISPR at the p6ink4a locus Toshitsugu Fujita, Miyuki Yuno, and Hodaka Fujii Supplementary Figure Legends Supplementary Figure
More informationPLNT2530 (2018) Unit 9. Genome Editing
PLNT2530 (2018) Unit 9 Genome Editing Unless otherwise cited or referenced, all content of this presenataion is licensed under the Creative Commons License Attribution Share-Alike 2.5 Canada 1 Genome Editing
More informationMaximizing your NGS sequencing with IDT. Adam Chernick, PhD Field Applications Manager, Functional Genomics
Maximizing your NGS sequencing with IDT Adam Chernick, PhD Field Applications Manager, Functional Genomics 1 Contents Expanding our NGS portfolio what s next? xgen technology and Lockdown probe advantages
More informationCRISPRcraft S.p. Cas9 Nuclease. CRISPRcraft S.p. Cas9 Control Kit
CRISPRcraft S.p. Cas9 Control Kit FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE Lucigen Corporation 2905 Parmenter St, Middleton, WI 53562 USA Toll Free: (888) 575-9695 (608) 831-9011 FAX: (608)
More informationReturn to Web Version
Page 1 of 7 Page 1 of 7 Return to Web Version ZFN Technology Biowire Volume 10 Article 1 Have your genomic work cut out for you The genomes of several organisms, including humans, have been sequenced,
More informationGenome Editing: Cas9 Stable Cell Lines for CRISPR sgrna Validation, Library Screening, and More. Ed Davis, Ph.D.
TECHNICAL NOTE Genome Editing: Cas9 Stable Cell Lines for CRISPR sgrna Validation, Library Screening, and More Introduction Ed Davis, Ph.D. The CRISPR-Cas9 system has become greatly popular for genome
More informationA universal chassis plasmid pwh34 was first constructed to facilitate the
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 File name: Supplementary method Plasmids construction A universal chassis plasmid pwh34 was first constructed to facilitate the construction
More informationTechnical tips Session 4
Technical tips Session 4 Biotinylation assay: Streptavidin is a small bacterial protein that binds with high affinity to the vitamin biotin. This streptavidin-biotin combination can be used to link molecules
More informationVersatility and performance of Lipofectamine Stem Transfection Reagent
PPLICTION NOTE Stem Transfection Reagent Versatility and performance of Stem Transfection Reagent Introduction The ability of stem cells to self-renew and differentiate into various specialized cell types
More informationEnGen Mutation Detection Kit
DNA MODIFYING ENZYMES EnGen Mutation Detection Kit Instruction Manual NEB #E3321S 25 reactions Version 2.0 6/18 be INSPIRED drive DISCOVERY stay GENUINE This product is intended for research purposes only.
More informationElectroporation of Cas9/Synthetic RNA Ribonucleoprotein (RNP) Complexes for CRISPR/Cas9 Genome Editing (Thermo Neon System)
Electroporation of Cas9/Synthetic RNA Ribonucleoprotein (RNP) Complexes for CRISPR/Cas9 Genome Editing (Thermo Neon System) BACKGROUND This protocol describes how to transfect cultured cells with ribonucleoprotein
More informationChapter 8: Recombinant DNA. Ways this technology touches us. Overview. Genetic Engineering
Chapter 8 Recombinant DNA and Genetic Engineering Genetic manipulation Ways this technology touches us Criminal justice The Justice Project, started by law students to advocate for DNA testing of Death
More informationDesign. Construction. Characterization
Design Construction Characterization DNA mrna (messenger) A C C transcription translation C A C protein His A T G C T A C G Plasmids replicon copy number incompatibility selection marker origin of replication
More informationGenome editing as a new powerful tool for wheat breeding
Genome editing as a new powerful tool for wheat breeding Vladimir Nekrasov 15 th WGIN Stakeholders Meeting Applying CRISPR Cas9 technology in model and crop plants Model plant: Crop plants: Nicotiana
More informationksierzputowska.com Research Title: Using novel TALEN technology to engineer precise mutations in the genome of D. melanogaster
Research Title: Using novel TALEN technology to engineer precise mutations in the genome of D. melanogaster Research plan: Specific aims: 1. To successfully engineer transgenic Drosophila expressing TALENs
More informationProtocol for Genome Editing via the RNA-guided Cas9 Nuclease in. Zebrafish Embryos 1
Protocol for Genome Editing via the RNA-guided Cas9 Nuclease in Zebrafish Embryos 1 1. In vitro synthesis of capped Cas9 mrna The full length of humanized Cas9 cdnas with double NLS were cloned into pxt7
More informationAutomated Electrophoresis Applications for Synthetic Biology
Automated Electrophoresis Applications for Synthetic Biology Melissa Huang Liu, Ph.D. Product Manager, Electrophoresis Agilent Technologies 1 Outline 2100 Bioanalyzer & 4200 TapeStation Systems Automated
More informationCat # Box1 Box2. DH5a Competent E. coli cells CCK-20 (20 rxns) 40 µl 40 µl 50 µl x 20 tubes. Choo-Choo Cloning TM Enzyme Mix
Molecular Cloning Laboratories User Manual Version 3.3 Product name: Choo-Choo Cloning Kits Cat #: CCK-10, CCK-20, CCK-096, CCK-384 Description: Choo-Choo Cloning is a highly efficient directional PCR
More informationEric Paul Bennett, MSc, Dr.med. Cellular Indel Profiles and Dynamics CRISPR/Cas9 delivery formats: Applying in vitro methodologies ex vivo
Copenhagen Center for Glycomics/Department of Odontology Eric Paul Bennett, MSc, Dr.med. Cellular Indel Profiles and Dynamics CRISPR/Cas9 delivery formats: Applying in vitro methodologies ex vivo Eric
More information3 Designing Primers for Site-Directed Mutagenesis
3 Designing Primers for Site-Directed Mutagenesis 3.1 Learning Objectives During the next two labs you will learn the basics of site-directed mutagenesis: you will design primers for the mutants you designed
More informationTesting Non-Transgenic CRISPR Technology for Wheat Improvement 13 TH IWGS - TULLN, AUSTRIA
Testing Non-Transgenic CRISPR Technology for Wheat Improvement KALI M BRANDT, HILARY L GUNN, BRETT L BUSCHKE, ADAM HEESACKER, NATHALIA MORET TI, ALEXANDER KARASEV, ROBERT S ZEMETRA 13 TH IWGS - TULLN,
More informationAmplified segment of DNA can be purified from bacteria in sufficient quantity and quality for :
Transformation Insertion of DNA of interest Amplification Amplified segment of DNA can be purified from bacteria in sufficient quantity and quality for : DNA Sequence. Understand relatedness of genes and
More informationNZYGene Synthesis kit
Kit components Component Concentration Amount NZYGene Synthesis kit Catalogue number: MB33901, 10 reactions GS DNA Polymerase 1U/ μl 30 μl Reaction Buffer for GS DNA Polymerase 10 150 μl dntp mix 2 mm
More informationLecture Four. Molecular Approaches I: Nucleic Acids
Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single
More informationComputational Biology I LSM5191
Computational Biology I LSM5191 Lecture 5 Notes: Genetic manipulation & Molecular Biology techniques Broad Overview of: Enzymatic tools in Molecular Biology Gel electrophoresis Restriction mapping DNA
More informationIntroducing Your Students To Gene Editing With CRISPR
Introducing Your Students To Gene Editing With CRISPR Brian Ell, Ph.D. Edvotek www.edvotek.com Follow @Edvotek EDVOTEK Biotech The Biotechnology Education Company Celebrating 30 years of science education!
More informationBi 8 Lecture 4. Ellen Rothenberg 14 January Reading: from Alberts Ch. 8
Bi 8 Lecture 4 DNA approaches: How we know what we know Ellen Rothenberg 14 January 2016 Reading: from Alberts Ch. 8 Central concept: DNA or RNA polymer length as an identifying feature RNA has intrinsically
More informationManipulating DNA. Nucleic acids are chemically different from other macromolecules such as proteins and carbohydrates.
Lesson Overview 14.3 Studying the Human Genome Nucleic acids are chemically different from other macromolecules such as proteins and carbohydrates. Nucleic acids are chemically different from other macromolecules
More informationSupplementary Methods pcfd5 cloning protocol
Supplementary Methods cloning protocol vermilion trna grna trna grna U6:3 Terminator AmpR attb is a vector for expressing one or multiple trna-flanked Cas9 grnas under the control of the strong, ubiquitous
More informationCRISPR/Cas9 Mouse Production
CRISPR/Cas9 Mouse Production Emory Transgenic and Gene Targeting Core http://cores.emory.edu/tmc Tamara Caspary, Ph.D. Scientific Director Teresa Quackenbush --- Lab Operations and Communications Coordinator
More informationIntroducing new DNA into the genome requires cloning the donor sequence, delivery of the cloned DNA into the cell, and integration into the genome.
Key Terms Chapter 32: Genetic Engineering Cloning describes propagation of a DNA sequence by incorporating it into a hybrid construct that can be replicated in a host cell. A cloning vector is a plasmid
More informationGenome Editing: Considerations for Therapeutic Applications Cecilia Fernandez TIDES,
Genome Editing: Considerations for Therapeutic Applications Cecilia Fernandez TIDES, 2017 www.editasmedicine.com 1 The Potential to Repair Any Broken Gene Transformative new category of medicines for genetically-defined
More informationGenBuilder TM Cloning Kit User Manual
GenBuilder TM Cloning Kit User Manual Cat.no L00701 Version 11242017 Ⅰ. Introduction... 2 I.1 Product Information... 2 I.2 Kit Contents and Storage... 2 I.3 GenBuilder Cloning Kit Workflow... 2 Ⅱ. DNA
More informationPrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID myeloperoxidase MPO Human Myeloperoxidase (MPO) is a heme protein synthesized during
More informationEnGen sgrna Synthesis Kit, S. pyogenes
RNA ENZYMES & GENE ANALYSIS EnGen sgrna Synthesis Kit, S. pyogenes Instruction Manual NEB #E3322S 20 reactions Version 2.0 7/18 be INSPIRED drive DISCOVERY stay GENUINE This product is intended for research
More informationBi 8 Lecture 5. Ellen Rothenberg 19 January 2016
Bi 8 Lecture 5 MORE ON HOW WE KNOW WHAT WE KNOW and intro to the protein code Ellen Rothenberg 19 January 2016 SIZE AND PURIFICATION BY SYNTHESIS: BASIS OF EARLY SEQUENCING complex mixture of aborted DNA
More informationGenome-scale engineering for systems and synthetic biology 彭文磊
Genome-scale engineering for systems and synthetic biology 彭文磊 Part 1 Part 2 Part 3 Introduction. Review current technologies and methodologies for genome-scale engineering. Discuss the prospects for extending
More informationTECH NOTE Ligation-Free ChIP-Seq Library Preparation
TECH NOTE Ligation-Free ChIP-Seq Library Preparation The DNA SMART ChIP-Seq Kit Ligation-free template switching technology: Minimize sample handling in a single-tube workflow >> Simplified protocol with
More informationPooled CRISPR guide RNA libraries for functional genomics screening: Do you know what s in your library?
Pooled CRISPR guide RNA libraries for functional genomics screening: Do you know what s in your library? Peter Sheffield R&D Scientific Program Director Agilent Technologies INTRODUCTION CRISPR: A Programmable
More informationEfficient generation of conditional knockout mice by CLICK
Efficient generation of conditional knockout mice by CLICK Tomoji Mashimo Genome Editing Research and Development (R&D) Center and Institute of Experimental Animal Sciences, Graduate School of Medicine,
More informationGenerating stable cell lines expressing various Cas9 proteins from AAVS1 locus
IGI Protocol prepared by Chong Park 1 Generating stable cell lines expressing various Cas9 proteins from AAVS1 locus This is modified from original protocol from the Conklin laboratory (Mandegar et al.
More information