Webinar: Genome Editing using Nucleofector Technology

Transcription

1 Pharma&Biotech BioResearch Webinar: Genome Editing using Nucleofector Technology Efficient Transfection of ZFN, TALEN and CRISPR/Cas In collaboration with: Lonza Walkersville, Inc., Walkersville, MD / 2014 Lonza

2 Speakers Dr. Claudia Schwartz Senior Scientific Support Specialist, Lonza Erika Holroyd ZFN and CRISPR Technical Specialist Moderation: Dr. Saskia Ihle, Scientific Support Specialist, Lonza 2

3 Agenda Basic Introduction to Genome Editing Tools Introduction to Nucleofector Technology Application Examples TALEN-based Genome Editing ZFN- and CRIPSR-based Genome Editing (by Sigma-Aldrich) Technical Tips For ZFN/CRISPR (by Sigma-Aldrich) For Nucleofection Summary 4

4 Methods for Modulating Gene Expression DNA RNA Protein Transcription Translation Zinc Finger Nucleases TALENs CRISPRs Transposons antisense Oligos Plasmids sirna shrna mirna Small Molecules mabs Aptamers 5

5 What is Genome Editing? Using engineered nucleases to introduce DNA insertions, deletions or replacements at sequence specific sites in a genome Engineered chimeric nucleases contain A non-specific DNA cleavage module (nuclease*): induces double-strand breaks in the genomic DNA targeted, which stimulates the DNA repair process Sequence-specific DNA binding domains (ZFN or TALE protein or CRISPRgRNA): can be customized to recognize virtually any sequence *Other options under evaluation: nickases, recombinases, transposases, transcription activators/repressors.. 6

6 Genome Editing Possibilities Add/delete TF binding sites Insert constitutive or inducible promoter Generate point mutation Fuse a reporter gene Delete/mutate promoter Disrupt gene (knockout) Insert new exon to generate gene fusions Add/delete mirna control element Transcription factor Promoter Exon UTR Gene knockouts Deletions of large sections of DNA Point mutations Incorporation of unique restriction sites Integration of loxp sites Integration of expression cassettes Adapted from Sigma-Aldrich with permission 7

7 Genome Editing Process Double-strand Break Breaks induce DNA repair and increase mutagenesis frequencies by >1000 fold DSB = Double strand break Plus donor DNA NHEJ = Non-homologous end joining Targeted mutagenesis/deletion HDR = Homology directed repair Targeted insertion/replacement 8

8 Genome Editing Process Example: ZFN DSB = Double strand break Plus donor DNA NHEJ = Non-homologous end joining Targeted mutagenesis/deletion HDR = Homology directed repair Targeted insertion/replacement 9

9 Genome Editing Process Example: TALEN DSB = Double strand break Plus donor DNA NHEJ = Non-homologous end joining Targeted mutagenesis/deletion HDR = Homology directed repair Targeted insertion/replacement 10

10 Genome Editing Process Example: CRISPR/Cas9 DSB = Double strand break Plus donor DNA NHEJ = Non-homologous end joining Targeted mutagenesis/deletion HDR = Homology directed repair Targeted insertion/replacement 11

11 Genome Editing Tools ZFN, TALEN and CRISPR ZFN TALEN CRISPR Nuclease Fok 1 Fok 1 Cas9 DNA Binding Via ZF protein TALE protein GuideRNA (grna) Type Fusion protein Fusion protein Protein + RNA High effort to modify for new targeting site High effort to modify for new targeting site Easy to modify Multiple targeting possible Binding Site 2 sites (15 or 18 bp each) High specificity Low risk for off-target effects 2 sites ( 13 bp each) High specificity Low risk for off-target effects 1 site (18-20 bp + 3bp NGG) Lower specificity Higher risk for off-target effects Summarized from: Gaj T et al (2013) Trends in Biotechnology 31(7):

12 Genome Editing Requires Co-Transfection ZFN or TALEN CRIPSR/Cas 2x or or Fok1 ZFN fusion or Fok1-TALE fusion Repair plasmid or ssodn (optional) Cas9 + grna Repair plasmid or ssodn (optional) 2x or or Fok1 ZFN fusion mrna or Fok1-TALE fusion mrna Repair plasmid or ssodn (optional) Cas9 grna Repair plasmid or ssodn (optional) or Cas9 grna PCR cassette Repair plasmid or ssodn (optional) 13

13 Agenda Basic Introduction to Genome Editing Tools Introduction to Nucleofector Technology Application Examples TALEN-based Genome Editing ZFN- and CRIPSR-based Genome Editing (by Sigma-Aldrich) Technical Tips For ZFN/CRISPR (by Sigma-Aldrich) For Nucleofection Summary 14

14 Nucleofection Principle Notebook Control Unit High transfection efficiency combined with low mortality DNA is directed into the nucleus giving faster gene expression Nucleofection Principle Other transfection methods 15

15 Components of Nucleofector Technology Notebook Control Unit A Unique Combination: Nucleofector Device Specific Nucleofector Kits Detailed optimized protocols Enabling excellent transfection performance combined with high functionality! For more information, check out: 16

16 More Than 80 Primary Cell Types Successfully Transfected % Transfection Efficiency Analysis time: h post Nucleofection Notebook Control Unit Reporter genes H-2K k egfp (customer data) maxgfp Reporter Protein GFP/YFP (customer data) 17

17 Agenda Basic Introduction to Genome Editing Tools Introduction to Nucleofector Technology Application Examples TALEN-based Genome Editing ZFN- and CRIPSR-based Genome Editing (by Sigma-Aldrich) Technical Tips For ZFN/CRISPR (by Sigma-Aldrich) For Nucleofection Summary 18

18 Nucleofection of TALEN or CRISPR/Cas9 into ips Cells Yang L et al (2013) Optimization of scarless human stem cell genome editing. NAR 41: (George Church Lab) Functional re-coding of TALEs (retalens) that simplify TALE synthesis Optimization of ssodn donor design Using Nucleofection to transfect hipscs: Comparison of integration efficiencies of retalens and Cas9-gRNA targeting CCR5 Combined optimized ssodns with both methods for introducing specific mutations Result: retalens Cas9-gRNA NHEJ 0.4% 3% HDR with ssodn 0.6% 1% Both nuclease platforms serve as robust tools for genome editing, but Cas9-gRNA achieved 7-8 x higher NHEJ 19

19 Nucleofection for Genome Editing Further Applications Tool Authors Citation Year Cell type ZFN Fung H et al PLOS ONE May 2011, e hesc Zou J et al Blood 117: ipsc Zou J et al Blood 118: ipsc Torikai H et al Blood 119(24): Human TC Liu X et al PLOS ONE, May 2012, e hes Schjoldager K PNAS 109: HepG2 Wang J et al Genome Res 22: K562 Ou W et al PLOS ONE, Nov 2013, e ipsc Qu X et al Nucleic Acids Res 41: HIV-infected PBL + CD4 T cells Richter S et al PLOS ONE, Jun 2013, e HTC116 + H460 Robbez-Masson LJ et al PLOS ONE 8(11):e MCF7 Samsonov A et al PLOS ONE, July 2013, e A549 Toscano MG et al Dis Model Mech 6: K562 Genovese P et al. Nature 510:235ff 2014 hcd34 TALEN Piganeau M et al Genome Res 23: hes and Jurkat cells Yang L et al Nucleic Acids Res 41: ipsc Zhu F et al. Nucleic Acids Res /nar/gkt ipsc + H9 hes CRISPR Petit Cs et al J Cell Biol 202: HeLa Ran FA et al Cell 154: various cell lines, e.g. HEK293FT Ran FA et al* Nat Prot 8(11): HUES62 + HEK293 *Provides a comprehensive protocol for use of the 4D-Nucleofector with CRIPS/Cas 20

20 Agenda Basic Introduction to Genome Editing Tools Introduction to Nucleofector Technology Application Examples TALEN-based Genome Editing ZFN- and CRIPSR-based Genome Editing (by Sigma-Aldrich) Technical Tips For ZFN/CRISPR (by Sigma-Aldrich) For Nucleofection Summary 21

21 PTEN Knockout with ZFN MCF10A - PTEN (-/-), clone A2A9 Genotype: del 19 / del 2 ZFN Binding site in upper case RED ZFN cut site in lowercase red CCATAACCCACCACAGCTAGAACTTATCAAACCCTtttgtGAAGATCTTGACCAATGGCTAAGTGAAGATGACAATCATG wt CCATAACCCACCACAGCTAGAACTTATC TTGACCAATGGCTAAGTGAAGATGACAATCATG -19 CCATAACCCACCACAGCTAGAACTTATCAAACCC- - ttgtgaagatcttgaccaatggctaagtgaagatgacaatcatg -2 22

22 PTEN Knockout with ZFN ELISA assay PTEN in wild type vs. knockout cell line luminus Conc. Lysate ug/ml Cytolysis of MCF10A vs. PTEN Knockout Targets % Cytolysis Ratio CTL to Target 23

23 Targeted Integration with Zinc Finger Nucleases xxxdonor Plasmid 24

24 Endogenous Tagging of TUBA1B Treatment of RFP-tagged TUBA1B MCF10A with paclitaxel - Paclitaxel, 0 min + Paclitaxel, 3 min + Paclitaxel, 26 min + Paclitaxel, 57 min + Paclitaxel, 98 min + Paclitaxel, 165 min Wild Type Clone RFP Clone 25

25 Multiple Modifications in the Same Cell BFP-Lamin RFP-Actin Overlay GFP-Tubulin DIC Sigma R&D 26

26 CRISPR Nickase System for Enhanced Specificity D10A 27

27 Cas9-D10A paired Nickase Configurations Nicking Cas9 Nicking Cas9 3 grna1 CUCCGCCCCACCUCCCCCAG-5 5 CCGGAGGCGGGGTGGAGGGGGTCGGGGCTCGCGGCGTCGCACTGAAACTTTTCGTCCAACTTCTGGGCTGTTCTCGCTTCGG < PAM spacing = 76 bp > (recommended limits = 30 to 150 bp) 3 GGCCTCCGCCCCACCTCCCCCAGCCCCGAGCGCCGCAGCGTGACTTTGAAAAGCAGGTTGAAGACCCGACAAGAGCGAAGCC 5 -CUUCUGGGCUGUUCUCGCUU grna2 3 28

28 Reduced Off-Target Activity with Cas9 Nickase Cas9 nuclease D10A nickase sgrna as2 sgrna s Indel (%) On-target Off-target Paired Cas9 nickase eliminates detectable modification at off-target location Sigma-Aldrich, unpublished data 29

29 Agenda Basic Introduction to Genome Editing Tools Introduction to Nucleofector Technology Application Examples TALEN-based Genome Editing ZFN- and CRIPSR-based Genome Editing (by Sigma-Aldrich) Technical Tips For ZFN/CRISPR (by Sigma-Aldrich) For Nucleofection Summary 30

30 Mismatch Detection Assay and Clone Screening General Guidelines when Deriving a Clone Modification <1%, do not single cell clone Modification = 1-3%, screen >300 clones (or use selection methods) Modification > 3%, screen at least 100 clones Percent of modified alleles in the transfected population 31

31 Enhancing ZFN Cutting Efficiency Using Cold Shock Culturing Doyon, Y., et al., Nature Methods 7, (2010) 32

32 Sorting for a Pool With Increased Activity 33

33 Targeted Integration of a MCS to AAVS1 Site in 11 Cell Lines Kb M ZFN DNA + Donor WT TI Donor alone WT 1. A DU HCT HEK HeLa 6. HepG2 7. IMR90 8. K LNCap 10. MCF7 11. U-2OS 34

34 ZFN-directed DNA Integration Rates Vary Between Cell Lines TI of a 50 bp MCS 1 TI of 3 kb 2 TI of 5 kb 2 Cell Lines Nucleofection Electroporation Lipid Nucleofection Nucleofection K562 30% 40% 20% HEK % 10% 6% HeLa 3% 5% 10% A % 10-20% 10% 1.4% 0.3% MCF7 3-5% ~5% HCT % 10-20% 3.3%*/ 5.2% 0.4%*/ <0.35% U-2 OS 30% IMR 90 ~5% LNCap 5-10% DU % HepG2 5-10% 1) Pool analysis 2) Single cell cloning * In this experiment, transfection efficiency was only around 20% 35

35 Agenda Basic Introduction to Genome Editing Tools Introduction to Nucleofector Technology Application Examples TALEN-based Genome Editing ZFN- and CRIPSR-based Genome Editing (by Sigma-Aldrich) Technical Tips For ZFN/CRISPR (by Sigma-Aldrich) For Nucleofection Summary 36

36 Nucleofection Tips and Tricks Optimal Nucleofection Conditions Depending on the cell type, first verify optimal conditions (given in the ready-to-use protocol) using pmaxgfp Control or determine optimal conditions (e.g. for ipsc clones) 37

37 Nucleofection Tips and Tricks Co-Transfection Optimize total substrate amount and ratio Example ranges from publications: ZFN Plasmid mrna Donor Plasmid: µg/µl each µg/µl each µg/µl TALEN Plasmid Donor Plasmid: Donor dsdna (lin) Donor ssodn µg/µl each µg/µl 0.1 µg/µl 10 µm CRISPR Plasmid grna PCR Cassette Donor dsdna (lin) Donor ssodn Cas9: µg/µl grna: µg/µl 0.5 ng/µl µg/µl µm Cas9/gRNA: µg/µl 38

38 Nucleofection Tips and Tricks Nucleofection of mrna Follow the same protocol and use the same program that is used for the transfection of DNA with your cells The mrna should be capped and poly-adenylated Optimal amount has to be titrated, might be higher than for plasmid 2 µg to 20 µg of each When higher amount is required the volume should not exceed 10% of the total sample volume Depending on the cell type (e.g. for DCs) it might be best to add the mrna directly into the empty cuvettes and then add the cell-solution mix on top. After adding the cell suspension transfect the sample immediately 39

39 Agenda Basic Introduction to Genome Editing Tools Introduction to Nucleofector Technology Application Examples TALEN-based Genome Editing ZFN- and CRIPSR-based Genome Editing (by Sigma-Aldrich) Technical Tips For ZFN/CRISPR (by Sigma-Aldrich) For Nucleofection Summary 40

40 Summary Nucleofection for Genome Editing Non-viral technology allows easy adaptation to different genome editing systems, be it ZFN, TALEN, or CRISPR Substrate flexibility and simple co-transfection due to same conditions for various substrates A reliable, proven technology, with > 30 genome editing publications and used by renowned players in the field Successful combination of ZFN and CRISPR tools from Sigma Aldrich with Nucleofector Technology for the generation of genetically modified cell lines 41

41 Sources of Information For Nucleofector Technology Our Online Databases Citations: Cell Transfection: Optimized Protocols: Transfection Experts Scientific Support Team EU: Scientific Support Team US: (toll free) For more information visit 42

42 Sources of Information For Genome Editing Tools Sigma-Aldrich Genome Editing Information Zinc Finger Nucleases: CRISPRs: Technical Experts ZFN Support: CRISPR Support: 43

43 Questions & Answers To submit a question: Please use the Questions feature located in your control panel, which you can access by clicking on the orange arrow on the right hand side of your screen. 44

44 Interested in Learning More? Do not miss Lonza s 2015 webinars series! Subscribe to our BioResearch Webinar Information service and receive personal event invitations per Sign up for our Cell Culture or Transfection enews Follow us on LinkedIn 45

45 Thank You for Your Kind Attention Disclaimer: Lonza is not responsible for the content of the Sigma-Aldrich slides. Sigma-Aldrich is not responsible for the content of the Lonza slides. The views and opinions expressed by one company do not necessarily reflect or represent the views and opinions of the other.