Basic aspects of Microarray Data Analysis
|
|
- Maximillian Cook
- 5 years ago
- Views:
Transcription
1 Hospital Universitari Vall d Hebron Institut de Recerca - VHIR Institut d Investigació Sanitària de l Instituto de Salud Carlos III (ISCIII) Basic aspects of Microarray Data Analysis Expression Data Analysis Course Ricardo Gonzalo Sanz ricardo.gonzalo@vhir.org 13/11/13
2 1 Introduction. 2 Software Installation. OneChannel GUI. 3 Quality control. 4 Normalization. 5 Filtering. 6 Statistical inference of diferential expression. 7 Clustering. 8 Annotation. 9 Biological interpretation. Extracted from Rafaele Callogero course slides
3 1 Introduction. Before beginning the analysis Any analysis of microarray data is useless if: there is not a clear biological question to be investigated biological experiments are not carefully designed to minimize error sources: human intervention, reagent lots, EXPERIMENTAL DESIGN equipments. etc.
4 1 Introduction. Experimental Design: Experiment should be designed with many replicas (>3) Time course experiments should be designed with many points (>4). Investigate part of the experiment by microarrays and use the rest for further validations. Discuss the experiment with the statistician/bioinformatician involved in data analysis
5 1 Introduction. Experimental Design: Experiments involving various samples and conditions need to be carefully designed to avoid unwanted effects. C 2C2C2 T 1T1T1 C 1C1C1 T 2T2 C 1C1C1 T 2T2 C 2C2 T 2 T 1T1 T 2 C 2 Day 1 Day 2 T 1 Day 1 Day 2
6 1 Introduction. To pool or not to pool? The basic assumption underlying sample pooling is biological averaging: the expression from a pooled sample averages out the expression from the individual contributing samples. Bioinformatics 2004, 20:3318
7 1 Introduction. To pool or not to pool? It is impossibile to associate the gene expression from the pooled sample with the individual phenotypic information: Making unfeasible certain statistical inference or predictions for individuals. Conclusions: Researcher has to be cautious about designing a pooled experiment. Pooling of samples is recommended when there is not enough RNA from each individual sample to run an array.
8 1 Introduction. Biological question Experimental design FAILED Microarray experiment QC Image analysis PASS Normalization Estimation Testing Analysis Clustering Discrimination Biological verification and interpretation
9 2 Software Installation. OneChannel GUI. onechannelgui This is a graphical interface to Bioconductor libraries devoted to the analysis of data derived from single channel platforms. Able to analyze 3 IVT, Exon, Gene arrays Also able to analyze RNAseq.
10 2 Software Installation. OneChannel GUI. Open R software In the usb stick you will find a folder called onechannelgui. Copy to a known location of your computer. Select the script that is inside the onechannelgui folder previously copied Positionate the cursor in the first line and press Control+R line by line. And wait it will take a long.
11 Biological question Experimental design FAILED Microarray experiment QC Image analysis PASS Normalization Estimation Testing Analysis Clustering Discrimination Biological verification and interpretation
12 3 Quality control. Was the experiment a success??? Microarray experiments generate huge quantities of data It is hard to decide if things seem to be all right just by looking at the numbers. Standard statistical approach use plots to check the quality show all data together highlight structures may help to detect problems ( unusual patterns )
13 3 Quality control. Diagnostics plots for microarrays: Microarray data usually considered at two levels 1. Low level: Data directly coming from the scanner 2. High level: processed from low-level data. Expression values, normalized or not. Adjusted PLM model. Some plots specific for some type of arrays or for some level. Any previous classification may be misleading
14 3 Quality control. Diagnostics plots for microarrays: Low level: Layout image Degradation plots (only in 3 IVT) Histogram/Density plots PCA, Boxplot High level: MA plots Model based plots (NUSE, RLE,...) PCA, Boxplot
15 3 Quality control. Diagnostics plots for microarrays. Low level. Layout image.
16 3 Quality control. Diagnostics plots for microarrays. Low level. RNA degradation plot.
17 3 Quality control. Diagnostics plots for microarrays. Low level. Histogram/density plot.
18 3 Quality control. Diagnostics plots for microarrays. Low level. Boxplot.
19 3 Quality control. Diagnostics plots for microarrays. Low level. PCA. Principal component analysis involves a mathematical procedure that transforms a number of correlated variables into a (smaller) number of uncorrelated variables called principal components. The first principal component accounts for as much of the variability in the data as possible. Each succeeding component accounts for as much of the remaining variability as possible. The components can be thought of as axes in n-dimensional space, where n is the number of components. Each axis represents a different trend in the data.
20 3 Quality control. Diagnostics plots for microarrays. Low level. PCA.
21 3 Quality control. Diagnostics plots for microarrays. Low level. PCA.
22 3 Quality control. Diagnostics plots for microarrays. High level. RLE (Relative Log Expression) RLE values are computed for each probe set by comparing the expression value on each array against the median expression value for that probeset across all arrays. Assuming that most genes are not changing in expression across arrays means ideally most of these RLE values will be near 0. Boxplots of these values, for each array, provides a quality assessment tool.
23 3 Quality control. Diagnostics plots for microarrays. High level. RLE.
24 3 Quality control. Diagnostics plots for microarrays. High level. NUSE (Normalized Unscaled Standard Error). Normalized Unscaled Standard Errors (NUSE) can also be used for assessing quality. The standard error estimates obtained for each gene on each array from fitplm are taken and standardized across arrays so that the median standard error for that genes is 1 across all arrays. This process accounts for differences in variability between genes. An array were there are elevated SE relative to the other arrays is typically of lower quality. Boxplots of these values, separated by array can be used to compare arrays.
25 3 Quality control. Diagnostics plots for microarrays. High level. NUSE.
26 3 Quality control. Diagnostics plots for microarrays. High level. MA plots. MA plots allow pair wise comparison of log-intensity of each array to a reference array and identification of intensity-dependent biases. The Y axis of the plot contains the log-ratio intensity of one array to the reference median array, which is called 'M' while the X axis contains the average log-intensity of both arrays - called 'A'. The normalization is expected to correct for intensity-dependent biases: these graphs plotted before and after normalization allow checking the efficiency of this correction. The probe levels are not likely to differ a lot so we expect a MA plot centered on the Y=0 axis from low to high intensities.
27 3 Quality control. Diagnostics plots for microarrays. High level. MA plots.
28 Biological question Experimental design FAILED Microarray experiment QC Image analysis PASS Normalization Estimation Testing Analysis Clustering Discrimination Biological verification and interpretation
29 4 Normalization. Why normalization? To remove systematic biases sample preparation Variability in hybridization Scanner settings Experimenter bias To achieve a measured scale such that Why not normalization? has the same origin for all spots Use the same unit for all arrays Linear relationship with RNA To cure poor data
30 4 Normalization. General Steps: Background correction (correcting the scale origin for spots) Normalization (standardizing the scale unit - rescaling) Probe level intensity calculation Summary of information of several spots into a single measure for each gene.
31 4 Normalization. Exists different methods: RMA methodology (Irizarry et al., 2003) performs background correction, normalization, and summarization in a modular way. RMA does not take in account unspecific probe hybridization in probe set background calculation. GCRMA is a version of RMA with a background correction component that makes use of probe sequence information (Wu et al., 2004). The PLIER (Probe Logarithmic Error Intensity Estimate) method produces an improved signal by accounting for experimentally observed patterns in probe behavior and handling error at the appropriately at low and high signal values.
32 4 Normalization.
33 5 Filtering. In a microarray experiment only a few hundreds/thousand of genes change their expression due to the different conditions. Genes that do not change introduce noise, therefore is better not to be present when the statistical analysis is done. Researcher is interested in keeping the number of tests/genes as low as possible while keeping the interesting genes in the selected subset. If the truly differentially expressed genes are overrepresented among those selected in the filtering step, the FDR associated with a certain threshold of the test statistic will be lowered due to the filtering.
34 5 Filtering. Exists different types of filtering: Annotation features (specific): Specific gene features (i.e. GO term, presence of transcriptional regulative elements in promoters, etc.) Signal features (non specific): % intensities greater of a user defined value Interquantile range (IQR) greater of a defined value
35 5 Filtering. Annotation filtering In transcriptional studies focusing on genes characterized by specific feature (i.e. transcription factor elements in promoters) the best filtering approach is selecting only those genes linked to the peculiar feature. For example: Identification of genes modulated by estradiol:er or IGF1 by direct binding to Estrogen-Responsive Elements (ERE): HGU133plus2: probe sets Entrez Genes HGU133plus2 with ERE in putative promoter regions: 6764 probe sets 3058 Entrez Genes
36 5 Filtering. Anotation filtering. How? Data derived from specifically devoted annotation data set can be used for functional filtering. The Ingenuity Pathways Knowledge Base is the world's largest curated database of biological networks created from millions of individually modeled relationships The Ingenuity Pathways Analysis software (IPA) identifies relations between genes.
37 5 Filtering. Signal filtering. This technique has as its premise the removal of genes that are deemed to be not expressed or unchanged according to some specific criterion that is under the control of the user. The aim of non specific filtering is to remove genes that, e. g. due to their low overall intensity or variability, are unlikely to carry information about the phenotypes under investigation.
38 5 Filtering. Signal filtering /42 SpikeIn Enrichment: 100% /42 SpikeIn Enrichment: 401%
39 Biological question Experimental design FAILED Microarray experiment QC Image analysis PASS Normalization Estimation Testing Analysis Clustering Discrimination Biological verification and interpretation
40 6 Statistical inference of diferential expression. Class comparison problem: Identify genes whose expression is significantly associated with different conditions Treatment, cell type, (qualitative variables) Dose, time, (quantitative variables) Estimate effects/differences between groups probably using log-ratios, i.e. the difference on log scale log(x)-log(y) [=log(x/y)]
41 6 Statistical inference of diferential expression. But.what is a significal change? Depends on the variability within groups, which may be different from gene to gene. Fold change it is not sufficient to indicate significance of the expression changes. Has to be supported by statistical information. To assess the statistical significance of differences, conduct a statistical test for each gene.
42 6 Statistical inference of diferential expression. Which situations can we found? Indirect comparisons: 2 groups, 2 samples, unpaired E.g. 10 individuals: 5 suffer diabetes, 5 healthy One sample fro each individual Typically: Two sample t-test or similar Direct comparisons: Two groups, two samples, paired E.g. 6 individuals with brain stroke. Two samples from each: one from healthy (region 1) and one from affected (region 2). Typically: One sample t-test (also called paired t-test) or similar based on the individual differences between conditions.
43 6 Statistical inference of diferential expression. Some issues in gene selection Gene expression values have peculiarities that have to be dealt with. Some related with small sample sizes Variance unstability (very low variances produces a high t statistic value) Non-normality of the data Other related to big number of variables Multiple testing Standard t test is not strictly correct to used here, it is better to use a moderated t-test
44 6 Statistical inference of diferential expression. To know if a gene is differentially expressed, we need to assign to each contrast a p-value: Genes with p-values falling below a prescribed level may be regarded as significant But what happens when you repeat the same test thousand of times.? Consider more than one test at once: Two tests each at 5% level. Now probability of getting a false positive is: *0.95 = Three tests : = n tests : n Converge towards 1 as n increases MULTIPLE TESTING PROBLEM
45 6 Statistical inference of diferential expression. MULTIPLE TESTING PROBLEM It is needed to control the type I error (False positives) FDR :Controls the proportion of false positives if you can tolerate more false positives you will get fewer false negatives No information lost
46 6 Statistical inference of diferential expression. After statistics is performed a nice (or not) Top Table is obtained: Gene Description Average intensity P-values AffyID Gene Symbol Log2 FC T statistics Log-odd statistics
47 6 Statistical inference of diferential expression. Visualization of the statistical inference: Venn diagrams and Volcano plots
48 7 Clustering. Types: Supervised clustering try to find the best partition for data that belong to a know set of classes Unsupervised clustering try to define the number and the size of the classes in which the transcription profiles can be fitted in.
49 7 Clustering. Distances: The ability to calculate a distance (or similarity, it s inverse) between two expression vectors is fundamental to clustering algorithms. Distance between vectors is the basis upon which decisions are made when grouping similar patterns of expression. Different types of distances: Euclidean distance, Manhattan distance, Mahalanobis distance. This can originate different sample grouping
50 7 Clustering. Hierarchical Clustering (HCL) HCL is an agglomerative/divisive clustering method. The iterative process continues until all groups are connected in a hierarchical tree. Samples more similar between them are closed.
51 7 Clustering. Heatmaps They allow the quick visualization of the possible expression patterns that could exists among samples.
52 8 Annotation. Relation between probes sets and genes: An important issue in microarray data analysis is the specific association of probe identifiers with genome annotated transcripts. A critical point in annotation is the way in which the association between probes and genes is produced. In Affymetrix arrays usually NetAffx (from Affymetrix web page) is used.
53 9 Biological interpretation. The goal of the Gene Ontology (GO) Consortium is to produce a controlled vocabulary that can be applied to all organisms even as knowledge of gene and protein roles in cells is accumulating and changing. For genes and gene products the Gene Ontology Consortium (GO) is an initiative that is designed to address the problem of defining common set of terms and descriptions for basic biological functions. GO provides a restricted vocabulary as well as clear indications of the relationships between terms.
54 9 Biological interpretation. GENE ONTOLOGY The Gene Ontology (GO) consortium produces three independent ontologies for gene products. The three ontologies are: molecular function of a gene product which is defined to be biochemical activity or action of the gene product (MF 7220). biological process interpreted as a biological objective to which the gene product contributes (BP 9529). cellular component is a component of a cell that is part of some larger object or structure (CC 1536).
55 9 Biological interpretation. The Graph Structure of GO The GO ontologies are structured as directed acyclic graphs (DAGs) that represent a network in which each term may be a child of one or more parents. GO node is interchangeable with GO term. Child terms are more specific than their parents: The term transmembrane receptor proteintyrosine kinase is child of transmembrane receptor and protein tyrosine kinase.
56 9 Biological interpretation. GO structure Graph of GO relationships for the term: transcription factor (GO: )
Analysis pipe-line. Analysis pipe
Bioconductor Bioconductor Platform specific Platform specific devices devices Analysis pipe Analysis pipe-line line Sample Sample Preparation Preparation Array Array Fabrication Fabrication Hybridization
More informationGene Expression Data Analysis
Gene Expression Data Analysis Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu BMIF 310, Fall 2009 Gene expression technologies (summary) Hybridization-based
More informationAnalysis of Microarray Data
Analysis of Microarray Data Lecture 3: Visualization and Functional Analysis George Bell, Ph.D. Senior Bioinformatics Scientist Bioinformatics and Research Computing Whitehead Institute Outline Review
More informationAnalysis of Microarray Data
Analysis of Microarray Data Lecture 3: Visualization and Functional Analysis George Bell, Ph.D. Bioinformatics Scientist Bioinformatics and Research Computing Whitehead Institute Outline Review Visualizing
More informationGene expression analysis: Introduction to microarrays
Gene expression analysis: Introduction to microarrays Adam Ameur The Linnaeus Centre for Bioinformatics, Uppsala University February 15, 2006 Overview Introduction Part I: How a microarray experiment is
More informationAgilent GeneSpring GX 10: Beyond. Pam Tangvoranuntakul Product Manager, GeneSpring October 1, 2008
Agilent GeneSpring GX 10: Gene Expression and Beyond Pam Tangvoranuntakul Product Manager, GeneSpring October 1, 2008 GeneSpring GX 10 in the News Our Goals for GeneSpring GX 10 Goal 1: Bring back GeneSpring
More informationIntroduction to gene expression microarray data analysis
Introduction to gene expression microarray data analysis Outline Brief introduction: Technology and data. Statistical challenges in data analysis. Preprocessing data normalization and transformation. Useful
More informationArray Quality Metrics. Audrey Kauffmann
Array Quality Metrics Audrey Kauffmann Introduction Microarrays are widely/routinely used Technology and protocol improvements trustworthy Variance and noise Technical causes: Platform Lab, experimentalist
More informationGenerating quality metrics reports for microarray data sets. Audrey Kauffmann
Generating quality metrics reports for microarray data sets Audrey Kauffmann Introduction Microarrays are widely/routinely used Technology and protocol improvements trustworthy Variance and noise Technical
More informationBioinformatics for Biologists
Bioinformatics for Biologists Microarray Data Analysis. Lecture 1. Fran Lewitter, Ph.D. Director Bioinformatics and Research Computing Whitehead Institute Outline Introduction Working with microarray data
More informationOutline. Analysis of Microarray Data. Most important design question. General experimental issues
Outline Analysis of Microarray Data Lecture 1: Experimental Design and Data Normalization Introduction to microarrays Experimental design Data normalization Other data transformation Exercises George Bell,
More informationIdentification of biological themes in microarray data from a mouse heart development time series using GeneSifter
Identification of biological themes in microarray data from a mouse heart development time series using GeneSifter VizX Labs, LLC Seattle, WA 98119 Abstract Oligonucleotide microarrays were used to study
More informationA Distribution Free Summarization Method for Affymetrix GeneChip Arrays
A Distribution Free Summarization Method for Affymetrix GeneChip Arrays Zhongxue Chen 1,2, Monnie McGee 1,*, Qingzhong Liu 3, and Richard Scheuermann 2 1 Department of Statistical Science, Southern Methodist
More informationMeasuring and Understanding Gene Expression
Measuring and Understanding Gene Expression Dr. Lars Eijssen Dept. Of Bioinformatics BiGCaT Sciences programme 2014 Why are genes interesting? TRANSCRIPTION Genome Genomics Transcriptome Transcriptomics
More informationNormalization. Getting the numbers comparable. DNA Microarray Bioinformatics - #27612
Normalization Getting the numbers comparable The DNA Array Analysis Pipeline Question Experimental Design Array design Probe design Sample Preparation Hybridization Buy Chip/Array Image analysis Expression
More informationAnalysis of Microarray Data
Analysis of Microarray Data Lecture 1: Experimental Design and Data Normalization George Bell, Ph.D. Senior Bioinformatics Scientist Bioinformatics and Research Computing Whitehead Institute Outline Introduction
More informationRNA Degradation and NUSE Plots. Austin Bowles STAT 5570/6570 April 22, 2011
RNA Degradation and NUSE Plots Austin Bowles STAT 5570/6570 April 22, 2011 References Sections 3.4 and 3.5.1 of Bioinformatics and Computational Biology Solutions Using R and Bioconductor (Gentleman et
More informationAGILENT S BIOINFORMATICS ANALYSIS SOFTWARE
ACCELERATING PROGRESS IS IN OUR GENES AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE GENESPRING GENE EXPRESSION (GX) MASS PROFILER PROFESSIONAL (MPP) PATHWAY ARCHITECT (PA) See Deeper. Reach Further. BIOINFORMATICS
More informationAnalysis of Microarray Data
Analysis of Microarray Data Lecture 1: Experimental Design and Data Normalization George Bell, Ph.D. Senior Bioinformatics Scientist Bioinformatics and Research Computing Whitehead Institute Outline Introduction
More informationadvanced analysis of gene expression microarray data aidong zhang World Scientific State University of New York at Buffalo, USA
advanced analysis of gene expression microarray data aidong zhang State University of New York at Buffalo, USA World Scientific NEW JERSEY LONDON SINGAPORE BEIJING SHANGHAI HONG KONG TAIPEI CHENNAI Contents
More informationBioinformatics for Biologists
Bioinformatics for Biologists Functional Genomics: Microarray Data Analysis Fran Lewitter, Ph.D. Head, Biocomputing Whitehead Institute Outline Introduction Working with microarray data Normalization Analysis
More informationComputing with large data sets
Computing with large data sets Richard Bonneau, spring 2009 Lecture 16 (week 10): bioconductor: an example R multi-developer project Acknowledgments and other sources: Ben Bolstad, Biostats lectures, Berkely
More informationMicroarray Informatics
Microarray Informatics Donald Dunbar MSc Seminar 4 th February 2009 Aims To give a biologistʼs view of microarray experiments To explain the technologies involved To describe typical microarray experiments
More informationGS Analysis of Microarray Data
GS01 0163 Analysis of Microarray Data Keith Baggerly and Brad Broom Department of Bioinformatics and Computational Biology UT M. D. Anderson Cancer Center kabagg@mdanderson.org bmbroom@mdanderson.org 7
More informationProbe-Level Data Normalisation: RMA and GC-RMA Sam Robson Images courtesy of Neil Ward, European Application Engineer, Agilent Technologies.
Probe-Level Data Normalisation: RMA and GC-RMA Sam Robson Images courtesy of Neil Ward, European Application Engineer, Agilent Technologies. References Summaries of Affymetrix Genechip Probe Level Data,
More information6. GENE EXPRESSION ANALYSIS MICROARRAYS
6. GENE EXPRESSION ANALYSIS MICROARRAYS BIOINFORMATICS COURSE MTAT.03.239 16.10.2013 GENE EXPRESSION ANALYSIS MICROARRAYS Slides adapted from Konstantin Tretyakov s 2011/2012 and Priit Adlers 2010/2011
More informationGene expression analysis. Biosciences 741: Genomics Fall, 2013 Week 5. Gene expression analysis
Gene expression analysis Biosciences 741: Genomics Fall, 2013 Week 5 Gene expression analysis From EST clusters to spotted cdna microarrays Long vs. short oligonucleotide microarrays vs. RT-PCR Methods
More informationMicroarray Informatics
Microarray Informatics Donald Dunbar MSc Seminar 31 st January 2007 Aims To give a biologist s view of microarray experiments To explain the technologies involved To describe typical microarray experiments
More informationThe essentials of microarray data analysis
The essentials of microarray data analysis (from a complete novice) Thanks to Rafael Irizarry for the slides! Outline Experimental design Take logs! Pre-processing: affy chips and 2-color arrays Clustering
More informationIntroduction to Bioinformatics! Giri Narasimhan. ECS 254; Phone: x3748
Introduction to Bioinformatics! Giri Narasimhan ECS 254; Phone: x3748 giri@cs.fiu.edu www.cis.fiu.edu/~giri/teach/bioinfs11.html Reading! The following slides come from a series of talks by Rafael Irizzary
More informationBIOINF/BENG/BIMM/CHEM/CSE 184: Computational Molecular Biology. Lecture 2: Microarray analysis
BIOINF/BENG/BIMM/CHEM/CSE 184: Computational Molecular Biology Lecture 2: Microarray analysis Genome wide measurement of gene transcription using DNA microarray Bruce Alberts, et al., Molecular Biology
More informationSAS Microarray Solution for the Analysis of Microarray Data. Susanne Schwenke, Schering AG Dr. Richardus Vonk, Schering AG
for the Analysis of Microarray Data Susanne Schwenke, Schering AG Dr. Richardus Vonk, Schering AG Overview Challenges in Microarray Data Analysis Software for Microarray Data Analysis SAS Scientific Discovery
More informationMeasuring gene expression
Measuring gene expression Grundlagen der Bioinformatik SS2018 https://www.youtube.com/watch?v=v8gh404a3gg Agenda Organization Gene expression Background Technologies FISH Nanostring Microarrays RNA-seq
More informationBioinformatics. Microarrays: designing chips, clustering methods. Fran Lewitter, Ph.D. Head, Biocomputing Whitehead Institute
Bioinformatics Microarrays: designing chips, clustering methods Fran Lewitter, Ph.D. Head, Biocomputing Whitehead Institute Course Syllabus Jan 7 Jan 14 Jan 21 Jan 28 Feb 4 Feb 11 Feb 18 Feb 25 Sequence
More informationFrom CEL files to lists of interesting genes. Rafael A. Irizarry Department of Biostatistics Johns Hopkins University
From CEL files to lists of interesting genes Rafael A. Irizarry Department of Biostatistics Johns Hopkins University Contact Information e-mail Personal webpage Department webpage Bioinformatics Program
More informationStandard Data Analysis Report Agilent Gene Expression Service
Standard Data Analysis Report Agilent Gene Expression Service Experiment: S534662 Date: 2011-01-01 Prepared for: Dr. Researcher Genomic Sciences Lab Prepared by S534662 Standard Data Analysis Report 2011-01-01
More informationIntegrative Genomics 1a. Introduction
2016 Course Outline Integrative Genomics 1a. Introduction ggibson.gt@gmail.com http://www.cig.gatech.edu 1a. Experimental Design and Hypothesis Testing (GG) 1b. Normalization (GG) 2a. RNASeq (MI) 2b. Clustering
More informationSeven Keys to Successful Microarray Data Analysis
Seven Keys to Successful Microarray Data Analysis Experiment Design Platform Selection Data Management System Access Differential Expression Biological Significance Data Publication Type of experiment
More information10.1 The Central Dogma of Biology and gene expression
126 Grundlagen der Bioinformatik, SS 09, D. Huson (this part by K. Nieselt) July 6, 2009 10 Microarrays (script by K. Nieselt) There are many articles and books on this topic. These lectures are based
More informationMicroarray Data Analysis in GeneSpring GX 11. Month ##, 200X
Microarray Data Analysis in GeneSpring GX 11 Month ##, 200X Agenda Genome Browser GO GSEA Pathway Analysis Network building Find significant pathways Extract relations via NLP Data Visualization Options
More informationMicroarray Analysis of Gene Expression in Huntington's Disease Peripheral Blood - a Platform Comparison. CodeLink compatible
Microarray Analysis of Gene Expression in Huntington's Disease Peripheral Blood - a Platform Comparison CodeLink compatible Microarray Analysis of Gene Expression in Huntington's Disease Peripheral Blood
More informationImage Analysis. Based on Information from Terry Speed s Group, UC Berkeley. Lecture 3 Pre-Processing of Affymetrix Arrays. Affymetrix Terminology
Image Analysis Lecture 3 Pre-Processing of Affymetrix Arrays Stat 697K, CS 691K, Microbio 690K 2 Affymetrix Terminology Probe: an oligonucleotide of 25 base-pairs ( 25-mer ). Based on Information from
More informationGS Analysis of Microarray Data
GS01 0163 Analysis of Microarray Data Keith Baggerly and Brad Broom Department of Bioinformatics and Computational Biology UT M. D. Anderson Cancer Center kabagg@mdanderson.org bmbroom@mdanderson.org 8
More informationDeakin Research Online
Deakin Research Online This is the published version: Church, Philip, Goscinski, Andrzej, Wong, Adam and Lefevre, Christophe 2011, Simplifying gene expression microarray comparative analysis., in BIOCOM
More informationMeasuring gene expression (Microarrays) Ulf Leser
Measuring gene expression (Microarrays) Ulf Leser This Lecture Gene expression Microarrays Idea Technologies Problems Quality control Normalization Analysis next week! 2 http://learn.genetics.utah.edu/content/molecules/transcribe/
More informationMicroarray Data Analysis Workshop. Preprocessing and normalization A trailer show of the rest of the microarray world.
Microarray Data Analysis Workshop MedVetNet Workshop, DTU 2008 Preprocessing and normalization A trailer show of the rest of the microarray world Carsten Friis Media glna tnra GlnA TnrA C2 glnr C3 C5 C6
More informationThis place covers: Methods or systems for genetic or protein-related data processing in computational molecular biology.
G16B BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY Methods or systems for genetic
More informationAnnotation. (Chapter 8)
Annotation (Chapter 8) Genome annotation Genome annotation is the process of attaching biological information to sequences: identify elements on the genome attach biological information to elements store
More informationChIP-seq and RNA-seq. Farhat Habib
ChIP-seq and RNA-seq Farhat Habib fhabib@iiserpune.ac.in Biological Goals Learn how genomes encode the diverse patterns of gene expression that define each cell type and state. Protein-DNA interactions
More informationExercise on Microarray data analysis
Exercise on Microarray data analysis Aim The aim of this exercise is to introduce basic data analysis of transcriptome data using the statistical software R. The exercise is divided in two parts. First,
More informationCS 5984: Application of Basic Clustering Algorithms to Find Expression Modules in Cancer
CS 5984: Application of Basic Clustering Algorithms to Find Expression Modules in Cancer T. M. Murali January 31, 2006 Innovative Application of Hierarchical Clustering A module map showing conditional
More informationExploration, Normalization, Summaries, and Software for Affymetrix Probe Level Data
Exploration, Normalization, Summaries, and Software for Affymetrix Probe Level Data Rafael A. Irizarry Department of Biostatistics, JHU March 12, 2003 Outline Review of technology Why study probe level
More informationDNA Microarray Data Oligonucleotide Arrays
DNA Microarray Data Oligonucleotide Arrays Sandrine Dudoit, Robert Gentleman, Rafael Irizarry, and Yee Hwa Yang Bioconductor Short Course 2003 Copyright 2002, all rights reserved Biological question Experimental
More informationRelease Notes. JMP Genomics. Version 3.1
JMP Genomics Version 3.1 Release Notes Creativity involves breaking out of established patterns in order to look at things in a different way. Edward de Bono JMP. A Business Unit of SAS SAS Campus Drive
More informationComparative Analysis using the Illumina DASL assay with FFPE tissue. Wendell Jones, PhD Vice President, Statistics and Bioinformatics
TM Comparative Analysis using the Illumina DASL assay with FFPE tissue Wendell Jones, PhD Vice President, Statistics and Bioinformatics Background EA has examined several protocol assay possibilities for
More informationGene expression: Microarray data analysis. Copyright notice. Outline: microarray data analysis. Schedule
Gene expression: Microarray data analysis Copyright notice Many of the images in this powerpoint presentation are from Bioinformatics and Functional Genomics by Jonathan Pevsner (ISBN -47-4-8). Copyright
More informationNew Statistical Algorithms for Monitoring Gene Expression on GeneChip Probe Arrays
GENE EXPRESSION MONITORING TECHNICAL NOTE New Statistical Algorithms for Monitoring Gene Expression on GeneChip Probe Arrays Introduction Affymetrix has designed new algorithms for monitoring GeneChip
More informationAffymetrix GeneChip Arrays. Lecture 3 (continued) Computational and Statistical Aspects of Microarray Analysis June 21, 2005 Bressanone, Italy
Affymetrix GeneChip Arrays Lecture 3 (continued) Computational and Statistical Aspects of Microarray Analysis June 21, 2005 Bressanone, Italy Affymetrix GeneChip Design 5 3 Reference sequence TGTGATGGTGGGGAATGGGTCAGAAGGCCTCCGATGCGCCGATTGAGAAT
More informationFEATURE-LEVEL EXPLORATION OF THE CHOE ET AL. AFFYMETRIX GENECHIP CONTROL DATASET
Johns Hopkins University, Dept. of Biostatistics Working Papers 3-17-2006 FEATURE-LEVEL EXPLORATION OF THE CHOE ET AL. AFFYETRIX GENECHIP CONTROL DATASET Rafael A. Irizarry Johns Hopkins Bloomberg School
More informationGene List Enrichment Analysis
Outline Gene List Enrichment Analysis George Bell, Ph.D. BaRC Hot Topics March 16, 2010 Why do enrichment analysis? Main types Selecting or ranking genes Annotation sources Statistics Remaining issues
More informationBioinformatics : Gene Expression Data Analysis
05.12.03 Bioinformatics : Gene Expression Data Analysis Aidong Zhang Professor Computer Science and Engineering What is Bioinformatics Broad Definition The study of how information technologies are used
More informationCS-E5870 High-Throughput Bioinformatics Microarray data analysis
CS-E5870 High-Throughput Bioinformatics Microarray data analysis Harri Lähdesmäki Department of Computer Science Aalto University September 20, 2016 Acknowledgement for J Salojärvi and E Czeizler for the
More informationAnalysis of microarray data
BNF078 Fall 2006 Analysis of microarray data Markus Ringnér Computational Biology and Biological Physics Department of Theoretical Physics Lund University markus@thep.lu.se 046-2229337 1 Contents Preface
More informationAnnotation and Function of Switch-like Genes in Health and Disease. A Thesis. Submitted to the Faculty. Drexel University. Adam M.
Annotation and Function of Switch-like Genes in Health and Disease A Thesis Submitted to the Faculty of Drexel University by Adam M. Ertel in partial fulfillment of the requirements for the degree of Doctor
More informationThe first and only fully-integrated microarray instrument for hands-free array processing
The first and only fully-integrated microarray instrument for hands-free array processing GeneTitan Instrument Transform your lab with a GeneTitan Instrument and experience the unparalleled power of streamlining
More informationA Parallel Approach to Microarray Preprocessing and Analysis
A Parallel Approach to Microarray and Patrick Breheny 2007 Outline The Central Dogma Purifying and labeling RNA Measuring of the amount of RNA corresponding to specific genes requires a number of steps,
More informationGS Analysis of Microarray Data
GS01 0163 Analysis of Microarray Data Keith Baggerly and Kevin Coombes Department of Bioinformatics and Computational Biology UT M. D. Anderson Cancer Center kabagg@mdanderson.org kcoombes@mdanderson.org
More informationMultivariate Methods to detecting co-related trends in data
Multivariate Methods to detecting co-related trends in data Canonical correlation analysis Partial least squares Co-inertia analysis Classical CCA and PLS require n>p. Can apply Penalized CCA and sparse
More informationDETERMINING SIGNIFICANT FOLD DIFFERENCES IN GENE EXPRESSION ANALYSIS
DETERMINING SIGNIFICANT FOLD DIFFERENCES IN GENE EXPRESSION ANALYSIS A. J. BUTTE 1, J. YE, G. NIEDERFELLNER 3, K. RETT 3, H. U. HÄRING 3, M. F. WHITE, I. S. KOHANE 1 1 Children s Hospital Informatics Program,
More informationTechnical Note. GeneChip 3 IVT PLUS Reagent Kit vs. GeneChip 3 IVT Express Reagent Kit Comparison. Introduction:
Technical Note GeneChip 3 IVT PLUS Reagent Kit vs. GeneChip 3 IVT Express Reagent Kit Comparison Introduction: Affymetrix has launched a new 3 IVT PLUS Reagent Kit which creates hybridization ready target
More informationFrom hybridization theory to microarray data analysis: performance evaluation
RESEARCH ARTICLE Open Access From hybridization theory to microarray data analysis: performance evaluation Fabrice Berger * and Enrico Carlon * Abstract Background: Several preprocessing methods are available
More informationA WEB-BASED TOOL FOR GENOMIC FUNCTIONAL ANNOTATION, STATISTICAL ANALYSIS AND DATA MINING
A WEB-BASED TOOL FOR GENOMIC FUNCTIONAL ANNOTATION, STATISTICAL ANALYSIS AND DATA MINING D. Martucci a, F. Pinciroli a,b, M. Masseroli a a Dipartimento di Bioingegneria, Politecnico di Milano, Milano,
More informationFinal exam: Introduction to Bioinformatics and Genomics DUE: Friday June 29 th at 4:00 pm
Final exam: Introduction to Bioinformatics and Genomics DUE: Friday June 29 th at 4:00 pm Exam description: The purpose of this exam is for you to demonstrate your ability to use the different biomolecular
More informationComputational Biology I
Computational Biology I Microarray data acquisition Gene clustering Practical Microarray Data Acquisition H. Yang From Sample to Target cdna Sample Centrifugation (Buffer) Cell pellets lyse cells (TRIzol)
More informationIntroduction to Bioinformatics and Gene Expression Technology
Vocabulary Introduction to Bioinformatics and Gene Expression Technology Utah State University Spring 2014 STAT 5570: Statistical Bioinformatics Notes 1.1 Gene: Genetics: Genome: Genomics: hereditary DNA
More informationGenomic data visualisation
Genomic data visualisation Dr Jason Wong Prince of Wales Clinical School Introductory bioinformatics for human genomics workshop, UNSW Day 1 Thursday 29 th January 2016 Structure of human genome Consist
More informationExpression summarization
Expression Quantification: Affy Affymetrix Genechip is an oligonucleotide array consisting of a several perfect match (PM) and their corresponding mismatch (MM) probes that interrogate for a single gene.
More informationChIP-seq and RNA-seq
ChIP-seq and RNA-seq Biological Goals Learn how genomes encode the diverse patterns of gene expression that define each cell type and state. Protein-DNA interactions (ChIPchromatin immunoprecipitation)
More informationBasic GO Usage. R. Gentleman. October 13, 2014
Basic GO Usage R. Gentleman October 13, 2014 Introduction In this vignette we describe some of the basic characteristics of the data available from the Gene Ontology (GO), (The Gene Ontology Consortium,
More informationNext-Generation Sequencing Gene Expression Analysis Using Agilent GeneSpring GX
Next-Generation Sequencing Gene Expression Analysis Using Agilent GeneSpring GX Technical Overview Introduction RNA Sequencing (RNA-Seq) is one of the most commonly used next-generation sequencing (NGS)
More informationUpstream/Downstream Relation Detection of Signaling Molecules using Microarray Data
Vol 1 no 1 2005 Pages 1 5 Upstream/Downstream Relation Detection of Signaling Molecules using Microarray Data Ozgun Babur 1 1 Center for Bioinformatics, Computer Engineering Department, Bilkent University,
More informationExpression data analysis with Chipster. Eija Korpelainen, Massimiliano Gentile
Expression data analysis with Chipster Eija Korpelainen, Massimiliano Gentile chipster@csc.fi Understanding data analysis - why? Bioinformaticians might not always be available when needed Biologists know
More informationHumboldt Universität zu Berlin. Grundlagen der Bioinformatik SS Microarrays. Lecture
Humboldt Universität zu Berlin Microarrays Grundlagen der Bioinformatik SS 2017 Lecture 6 09.06.2017 Agenda 1.mRNA: Genomic background 2.Overview: Microarray 3.Data-analysis: Quality control & normalization
More informationCodeLink Human Whole Genome Bioarray
CodeLink Human Whole Genome Bioarray 55,000 human gene targets on a single bioarray The CodeLink Human Whole Genome Bioarray comprises one of the most comprehensive coverages of the human genome, as it
More informationMicroarray analysis challenges.
Microarray analysis challenges. While not quite as bad as my hobby of ice climbing you, need the right equipment! T. F. Smith Bioinformatics Boston Univ. Experimental Design Issues Reference and Controls
More informationMicroarray Technique. Some background. M. Nath
Microarray Technique Some background M. Nath Outline Introduction Spotting Array Technique GeneChip Technique Data analysis Applications Conclusion Now Blind Guess? Functional Pathway Microarray Technique
More informationPackage TIN. March 19, 2019
Type Package Title Transcriptome instability analysis Version 1.14.0 Date 2014-07-14 Package TIN March 19, 2019 Author Bjarne Johannessen, Anita Sveen and Rolf I. Skotheim Maintainer Bjarne Johannessen
More informationA Genetic Algorithm Approach to DNA Microarrays Analysis of Pancreatic Cancer
A Genetic Algorithm Approach to DNA Microarrays Analysis of Pancreatic Cancer Nicolae Teodor MELITA 1, Stefan HOLBAN 2 1 Politehnica University of Timisoara, Faculty of Automation and Computers, Bd. V.
More informationMixture modeling for genome-wide localization of transcription factors
Mixture modeling for genome-wide localization of transcription factors Sündüz Keleş 1,2 and Heejung Shim 1 1 Department of Statistics 2 Department of Biostatistics & Medical Informatics University of Wisconsin,
More information2007/04/21.
2007/04/21 hmwu@stat.sinica.edu.tw http://idv.sinica.edu.tw/hmwu 1 GeneChip Expression Array Design Assay and Analysis Flow Chart Quality Assessment Low Level Analysis (from probe level data to expression
More informationExercise1 ArrayExpress Archive - High-throughput sequencing example
ArrayExpress and Atlas practical: querying and exporting gene expression data at the EBI Gabriella Rustici gabry@ebi.ac.uk This practical will introduce you to the data content and query functionality
More informationIntroduction to Bioinformatics
Introduction to Bioinformatics If the 19 th century was the century of chemistry and 20 th century was the century of physic, the 21 st century promises to be the century of biology...professor Dr. Satoru
More informationALLEN Human Brain Atlas
TECHNICAL WHITE PAPER: MICROARRAY DATA NORMALIZATION The is a publicly available online resource of gene expression information in the adult human brain. Comprising multiple datasets from various projects
More informationIntroduction to microarrays. Overview The analysis process Limitations Extensions (NGS)
Introduction to microarrays Overview The analysis process Limitations Extensions (NGS) Outline An overview (a review) of microarrays Experiments with microarrays The data analysis process Microarray limitations
More informationPreprocessing Affymetrix GeneChip Data. Affymetrix GeneChip Design. Terminology TGTGATGGTGGGGAATGGGTCAGAAGGCCTCCGATGCGCCGATTGAGAAT
Preprocessing Affymetrix GeneChip Data Credit for some of today s materials: Ben Bolstad, Leslie Cope, Laurent Gautier, Terry Speed and Zhijin Wu Affymetrix GeneChip Design 5 3 Reference sequence TGTGATGGTGGGGAATGGGTCAGAAGGCCTCCGATGCGCCGATTGAGAAT
More informationGene Expression Data Analysis (I)
Gene Expression Data Analysis (I) Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Bioinformatics tasks Biological question Experiment design Microarray experiment
More informationComputational Approaches to Analysis of DNA Microarray Data
2006 IMI and Schattauer GmbH 91 Computational pproaches to nalysis of DN Microarray Data J. Quackenbush Department of Biostatistics and Computational Biology, Dana-Farber Cancer Institute and Department
More informationRafael A Irizarry, Department of Biostatistics JHU
Getting Usable Data from Microarrays it s not as easy as you think Rafael A Irizarry, Department of Biostatistics JHU rafa@jhu.edu http://www.biostat.jhsph.edu/~ririzarr http://www.bioconductor.org Acknowledgements
More informationTranscriptome Assembly, Functional Annotation (and a few other related thoughts)
Transcriptome Assembly, Functional Annotation (and a few other related thoughts) Monica Britton, Ph.D. Sr. Bioinformatics Analyst June 23, 2017 Differential Gene Expression Generalized Workflow File Types
More informationRNA-Seq Analysis. Simon Andrews, Laura v
RNA-Seq Analysis Simon Andrews, Laura Biggins simon.andrews@babraham.ac.uk @simon_andrews v2018-10 RNA-Seq Libraries rrna depleted mrna Fragment u u u u NNNN Random prime + RT 2 nd strand synthesis (+
More information