S SG. Grier P Page, Ph.D. Associate Professor. ection. enetics. Department of Biostatistics School of Public Health. ON tatistical

Size: px
Start display at page:

Download "S SG. Grier P Page, Ph.D. Associate Professor. ection. enetics. Department of Biostatistics School of Public Health. ON tatistical"

Transcription

1 S SG ection ON tatistical enetics Grier P Page, Ph.D. Associate Professor Department of Biostatistics School of Public Health Quality Control of Microarray Studies

2 From Affymetrix.com mcd/research.html Microarrays

3 Quality Control In Microarray Studies

4 Which one is good or bad?

5 One view of the steps for a microarray study But essentially no quality checking of the data

6 From Drug Discov Today Sep 1;10(17):

7 The Myth That Data Mining has No Hypothesis There always needs to be a biological question in the experiment. If there is not even a question don t bother. The question could be nebulous: What happens to the gene expression of this tissue when I apply Drug A. The purpose of the question is to drive the experimental design. Make sure the samples answer the question: Cause vs. effect.

8 Design Issues - I Known sources of non-biological error (not exhaustive) that must be addressed Technician Chip lot Reagent lot Printer tip Time of printing Date Fluidics well/ Scanner Order of scanning Location Cage/ Field position Far and away the largest is cdna and crna labeling

9 cdna clones Plate effects printing (?) Sources of Artifacts excitation PCR product amplificatio n and purification RN A cdna Test sample Reference sample RNA Intensity effects cdna (labelling efficiency) green laser emission red laser overlay images scanning Intensity effects (quenching) Production Hybridize data: (R,G,...)

10 UMSA Analysis Day 1 Day 2 Insulin Resistant Insulin Sensitive

11 Example of Day or Batch Effect 800 PCA of muscle data Mean vs. Variance by Chip Average Intensity Phase1 U95A Phase 2 U95A Phase 3 U95A 0 0.E+00 1.E+06 2.E+06 3.E+06 4.E+06 5.E+06 6.E+06 Variance of Intensity

12 Design Issues II How to address these issues Make the experiment as uniform as possible Agree on exactly what defines the tissue to be used, use same technician, same chip lot, same reagents (always buy a little too much), same scanner, do sample extraction, labeling and hybridization on one day if possible, establish quality control Randomize when uniformity is not possible Don t do all of condition 1 on day 1 and condition 2 on day 2 Randomize the time a chips sits waiting to be scanned Randomize animal cage/plant field position Microarrays generate such a huge volume of data that is is possible to detect these issues, I suspect that northerns, Southerns, RT-PCR, westerns, and more have similar problems.

13 What is Orthogonalization vs Randomization? Orthogonalization- spreading the biological sources of error evenly across the nonbiological sources of error. Maximally powerful for known sources of error. Randomization spear the biological sources of error at random across the nonbiological sources of error. Useful for controlling for unknown sources of error

14 Examples of Orthogonalization and Randomization? Variety Treatment Sample # Sample Order Sample Order The experiment Orthogonalize Randomize

15 RNA Quality

16 Quality control of RNA Confirmation of RNA integrity, based on an 28S:18S ratio greater than 1.5 as quantified by Agilent BioAnalyzer and formaldehyde gel electrophoresis However, The Drosophila RNA has a split peak for the 28s ribosomal RNA on thebioanalyzer. Intact RNA Degraded RNA Images from Agilent

17 Be aware of what your specific Species should look like The Drosophila RNA has a split peak for the 28s ribosomal RNA on the Bioanalyzer. And no 18S peak

18 Affymetrix QC metrics The average background is calculated from the 2% probes with the weakest signal. The average background is an estimate of general nonspecific binding based on low-intensity features across an array. Bio B isa probe set designed to measure prelabeled bacterial nucleotides. Bio B is the signal from internal prelabeled standards and measures the efficacy of hybridization, washing, and scanning. Bio B is free of RNA, amplification, and labeling effects. The actin 3/5 ratio is a ratio of probe sets designed to detect the 3 and 5 regions of the actin mrna transcript and is reputed to detect RNA degradation. This ratio is thought to indicate RNA quality a well as the bias inherent in the Affymetrix labeling assay. The scale factor is a global normalization constant based on the trimmed mean of probe set signals or average differences and is inversely related to chip brightness. Percent present is an array level summary of the results of a statistical function designed to predict the presence or absence of each transcript. Percent present is a quality metric that is sensitive to any error source from RNA sampling to scanning and data extraction. Percent present is influenced by all stages in the microarray process including scanner brightness, background, RNA quality, algorithm, and chip design.

19 Relationship among metrics From Finkelstein. Mol Methods xxx

20 RNA digestion plot ' <-----> 3' Probe Number Mean Intensity : shifted and scaled

21 Does one size fit all?

22 The red/green ratios can be spatially biased. Top 2.5%of ratios red, bottom 2.5% of ratios green

23 Spatial plots: background from the two slides

24 Image and Data Quality Checking

25

26 Y X An illustration of principle of a geography index: A full polynomial model is used to detect spatial patterns (e.g. upper right corner). Geography index (GEODEX). A full polynomial model was used to detect spatial patterns: z = x + y + x 2 + xy + y 2 + x 3 + x 2 y + xy 2 + y 3 + xy 3 + x 2 y 2 + x 3 y + x 2 y 3 + x 3 y 2 + x 3 y 3, where z expression level and x & y Cartesian coordinates of an array. Foreground and background readings for each channel were processed separately. Geography indices were determined as follows: GEODEX = 1 - R 2, where R 2 is a coefficient of determination for a polynomial model.

27 Distribution of the geography index (GEODEX) for individual chips GEODEX Image of chip Chip ID Image of the right corner on the bottom.

28 A. Foreground - high GEODEX values C. Background - high GEODEX values B. Foreground - low GEODEX values D. Background - low GEODEX values X-axis and Y-axis - Cartesian coordinates of an array; Z-axis - foreground or background signal readings. In this analysis lower GEODEX is considered a worse outcome.

29 These are OK

30 These are not OK

31 Quality Control Using Deleted Residuals Page GP, Edwards JW, Yelisetti P, & Allison DB Assessing Quality of Microarrays Using Studentized Deleted Residuals using normative data from 4358 arrays from a public database. In preparation

32 Using Deleted Residual Plots & Statistics to Assess Array Quality Traditional tools for detecting outliers do not work when n is small. Deleted residuals can work when n is small. Within a single gene, the distribution of the deleted residuals is t with n-2 degrees of freedom. By looking at all the genes on a chip, we may be able to use apparent departure from t n-2 among the deleted residuals as a measure of array quality. Compare are the observed deleted residuals to the expected t with a Kolmogorov-Smirnov test with genes-1 df.

33 Presumed Bad Chip Presumed Good Chip

34 Empirical percentile cut offs derived from 10,447 comparisons using the 4358 chips taken from GEO. Percentile Mean Stdev Skewness Kurtosis K-S D 1% % % % % % % % % % % % %

35 Histogram of p-values

36 Potentially Bad Chip

37 Histogram of p-values with bad chip removed

38 Quality Control in Data sources

39 Understand What Databases Include, don t include, and assumptions Just because a database says something does not mean it is right. Read the evidence. Databases are biased. Databases are incomplete Databases have lots of data Understand data before you use it

40

41 TCA cycle from Ingenuity

42 TCA from GeneMAPP

43 TCA cycle from Ingenuity

44 Issues in the Annotation of Genes

45 Annotation is inconsistent across sources Gene Symbol p-value fc 50/21 Gene Ontology Biological Process Gene Ontology Cellular ComponentPathway Aco Krebs-TCA_Cycle // Pdk // acetyl-coa biosynthesis from pyru5739 // mitochondrion // Krebs-TCA_Cycle // Pdk // acetyl-coa biosynthesis from pyru5739 // mitochondrion // Krebs-TCA_Cycle // Pdha // glycolysis 5739 // mitochondrion Krebs-TCA_Cycle // Idh // tricarboxylic acid cycle 5829 // cytosol --- Acly // tricarboxylic acid cycle 5622 // intracellular Fatty_Acid_Synthes Aco2 1.22E Krebs-TCA_Cycle // Fh1 6.76E // tricarboxylic acid cycle // 5739 // mitochondrion Krebs-TCA_Cycle // Atp5g3 1.53E // tricarboxylic acid cycle // 5739 // mitochondrion --- Suclg1 8.87E // tricarboxylic acid cycle // 5739 // mitochondrion Krebs-TCA_Cycle // Mdh1 5.92E // tricarboxylic acid cycle // --- Krebs-TCA_Cycle // Mor1 4.24E // tricarboxylic acid cycle // 5739 // mitochondrion Krebs-TCA_Cycle // Idh1 2.36E // tricarboxylic acid cycle // 5829 // cytosol // --- Idh3g 2.19E // tricarboxylic acid cycle // 5739 // mitochondrion Krebs-TCA_Cycle // Dlst 2.49E Sdhd 5.13E // mitochondrial electron transport, s5749 // respiratory chain complex I Krebs-TCA_Cycle // Sdhc 1.82E RGD: E // dihydrolipoyl dehydrogenas --- Cs 1.56E // mitochondrion Krebs-TCA_Cycle // RGD: E // tricarboxylic acid cycle // 5829 // cytosol --- Idh3B 2.57E Krebs-TCA_Cycle // Mdh1 1.08E // tricarboxylic acid cycle // --- Krebs-TCA_Cycle // Pc 1.91E // gluconeogenesis // 5739 // mitochondrion Krebs-TCA_Cycle // RGD: // cell-cell adherens junction Krebs-TCA_Cycle // RGD: // cell-cell adherens junction Krebs-TCA_Cycle // Dlat 4.76E // acetyl-coa biosynthesis from pyru5739 // mitochondrion // Krebs-TCA_Cycle // Sdhd 1.3E // mitochondrial electron transport, s5749 // respiratory chain complex I Krebs-TCA_Cycle // Sdha 7.85E // tricarboxylic acid cycle // 5739 // mitochondrion // Krebs-TCA_Cycle // Idh3a // tricarboxylic acid cycle // 5739 // mitochondrion // Krebs-TCA_Cycle // Pdk // acetyl-coa biosynthesis from pyru5739 // mitochondrion // Krebs-TCA_Cycle // Cs 1.36E // mitochondrion // Krebs-TCA_Cycle // Acly // acetyl-coa biosynthesis 5622 // intracellular // Fatty_Acid_Synthes

46 Nucleic Acids Research, 2005, Vol. 33, No. 3 e31

47 Nucleic Acids Research, 2005, Vol. 33, No. 3 e31

48 Nucleic Acids Research, 2005, Vol. 33, No. 3 e31

49 Mapping of Plant Arrays AG ATH1 Operon(75%) Operon(98%) CATMA(75%) CATMA(98%) AFGC(75%) AFGC(98%) Vendor Mapping Numbers Nil Entries from vendor (No Mapping for these probes) Exact Match * Present-Vendor Absent-Blast Absent-Vendor Present-Blast One-Vendor Many-Blast Many-Vendor One-Blast

50 MAQC Nature Biotechnololgy Oct 2006

51

52

53 Summary Design your experiment well Control for non-biological sources of error Know what is good and bad quality data at each stage including RNA, image, data, and annotation If you are aware of these issues and control for them highly powerful and reproducible microarray experimentation is possible.

54 If time allows

55

56

57

58

59

60

Gene expression analysis: Introduction to microarrays

Gene expression analysis: Introduction to microarrays Gene expression analysis: Introduction to microarrays Adam Ameur The Linnaeus Centre for Bioinformatics, Uppsala University February 15, 2006 Overview Introduction Part I: How a microarray experiment is

More information

Technical Note. GeneChip 3 IVT PLUS Reagent Kit vs. GeneChip 3 IVT Express Reagent Kit Comparison. Introduction:

Technical Note. GeneChip 3 IVT PLUS Reagent Kit vs. GeneChip 3 IVT Express Reagent Kit Comparison. Introduction: Technical Note GeneChip 3 IVT PLUS Reagent Kit vs. GeneChip 3 IVT Express Reagent Kit Comparison Introduction: Affymetrix has launched a new 3 IVT PLUS Reagent Kit which creates hybridization ready target

More information

The Agilent Total RNA Isolation Kit

The Agilent Total RNA Isolation Kit Better RNA purity. Better data. Without DNase treatment. The Agilent Total RNA Isolation Kit Now you can isolate highly purified, intact RNA without DNase treatment Introducing the Agilent Total RNA Isolation

More information

Microarray pipeline & Pre-processing

Microarray pipeline & Pre-processing Microarray pipeline & Pre-processing Solveig Mjelstad Olafsrud J Express Analysis Course November 2010 Some slides adapted from Christine Stansberg thank you Christine! The microarray pipeline The goal

More information

ALLEN Human Brain Atlas

ALLEN Human Brain Atlas TECHNICAL WHITE PAPER: MICROARRAY DATA NORMALIZATION The is a publicly available online resource of gene expression information in the adult human brain. Comprising multiple datasets from various projects

More information

Affymetrix Gene Expression Service Lab Report

Affymetrix Gene Expression Service Lab Report Report file for #1 1 st QC of RNA quality Affymetrix Gene Expression Service Lab Report Assigned no Number we assigned Threshold User User name N/A User Sample ID Sample name that user give N/A Sample

More information

Quantitative Real Time PCR USING SYBR GREEN

Quantitative Real Time PCR USING SYBR GREEN Quantitative Real Time PCR USING SYBR GREEN SYBR Green SYBR Green is a cyanine dye that binds to double stranded DNA. When it is bound to D.S. DNA it has a much greater fluorescence than when bound to

More information

Measuring and Understanding Gene Expression

Measuring and Understanding Gene Expression Measuring and Understanding Gene Expression Dr. Lars Eijssen Dept. Of Bioinformatics BiGCaT Sciences programme 2014 Why are genes interesting? TRANSCRIPTION Genome Genomics Transcriptome Transcriptomics

More information

Expressed genes profiling (Microarrays) Overview Of Gene Expression Control Profiling Of Expressed Genes

Expressed genes profiling (Microarrays) Overview Of Gene Expression Control Profiling Of Expressed Genes Expressed genes profiling (Microarrays) Overview Of Gene Expression Control Profiling Of Expressed Genes Genes can be regulated at many levels Usually, gene regulation, are referring to transcriptional

More information

Lecture #1. Introduction to microarray technology

Lecture #1. Introduction to microarray technology Lecture #1 Introduction to microarray technology Outline General purpose Microarray assay concept Basic microarray experimental process cdna/two channel arrays Oligonucleotide arrays Exon arrays Comparing

More information

Rafael A Irizarry, Department of Biostatistics JHU

Rafael A Irizarry, Department of Biostatistics JHU Getting Usable Data from Microarrays it s not as easy as you think Rafael A Irizarry, Department of Biostatistics JHU rafa@jhu.edu http://www.biostat.jhsph.edu/~ririzarr http://www.bioconductor.org Acknowledgements

More information

Aim of lecture:to get an overview of the whole process of microarrays, from study design to publication

Aim of lecture:to get an overview of the whole process of microarrays, from study design to publication Microarray pipeline Aim of lecture:to get an overview of the whole process of microarrays, from study design to publication Rita Holdhus Intoduction to Microarray technology September 2010 Many of the

More information

Normalization. Getting the numbers comparable. DNA Microarray Bioinformatics - #27612

Normalization. Getting the numbers comparable. DNA Microarray Bioinformatics - #27612 Normalization Getting the numbers comparable The DNA Array Analysis Pipeline Question Experimental Design Array design Probe design Sample Preparation Hybridization Buy Chip/Array Image analysis Expression

More information

Selected Techniques Part I

Selected Techniques Part I 1 Selected Techniques Part I Gel Electrophoresis Can be both qualitative and quantitative Qualitative About what size is the fragment? How many fragments are present? Is there in insert or not? Quantitative

More information

Gene Expression Technology

Gene Expression Technology Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene

More information

Designing a Complex-Omics Experiments. Xiangqin Cui. Section on Statistical Genetics Department of Biostatistics University of Alabama at Birmingham

Designing a Complex-Omics Experiments. Xiangqin Cui. Section on Statistical Genetics Department of Biostatistics University of Alabama at Birmingham Designing a Complex-Omics Experiments Xiangqin Cui Section on Statistical Genetics Department of Biostatistics University of Alabama at Birmingham 1/7/2015 Some slides are from previous lectures of Grier

More information

Standard Data Analysis Report Agilent Gene Expression Service

Standard Data Analysis Report Agilent Gene Expression Service Standard Data Analysis Report Agilent Gene Expression Service Experiment: S534662 Date: 2011-01-01 Prepared for: Dr. Researcher Genomic Sciences Lab Prepared by S534662 Standard Data Analysis Report 2011-01-01

More information

DNA Microarray Technology

DNA Microarray Technology 2 DNA Microarray Technology 2.1 Overview DNA microarrays are assays for quantifying the types and amounts of mrna transcripts present in a collection of cells. The number of mrna molecules derived from

More information

DNA Arrays Affymetrix GeneChip System

DNA Arrays Affymetrix GeneChip System DNA Arrays Affymetrix GeneChip System chip scanner Affymetrix Inc. hybridization Affymetrix Inc. data analysis Affymetrix Inc. mrna 5' 3' TGTGATGGTGGGAATTGGGTCAGAAGGACTGTGGGCGCTGCC... GGAATTGGGTCAGAAGGACTGTGGC

More information

Optimizing crna fragmentation for microarray experiments using the Agilent 2100 bioanalyzer. Application Deborah Vitale.

Optimizing crna fragmentation for microarray experiments using the Agilent 2100 bioanalyzer. Application Deborah Vitale. Optimizing crna fragmentation for microarray experiments using the Agilent 2100 bioanalyzer Application Deborah Vitale Introduction Oligonucleotide arrays are a powerful tool for gene expression studies.

More information

Microarray. Key components Array Probes Detection system. Normalisation. Data-analysis - ratio generation

Microarray. Key components Array Probes Detection system. Normalisation. Data-analysis - ratio generation Microarray Key components Array Probes Detection system Normalisation Data-analysis - ratio generation MICROARRAY Measures Gene Expression Global - Genome wide scale Why Measure Gene Expression? What information

More information

SIMS2003. Instructors:Rus Yukhananov, Alex Loguinov BWH, Harvard Medical School. Introduction to Microarray Technology.

SIMS2003. Instructors:Rus Yukhananov, Alex Loguinov BWH, Harvard Medical School. Introduction to Microarray Technology. SIMS2003 Instructors:Rus Yukhananov, Alex Loguinov BWH, Harvard Medical School Introduction to Microarray Technology. Lecture 1 I. EXPERIMENTAL DETAILS II. ARRAY CONSTRUCTION III. IMAGE ANALYSIS Lecture

More information

Introduction to gene expression microarray data analysis

Introduction to gene expression microarray data analysis Introduction to gene expression microarray data analysis Outline Brief introduction: Technology and data. Statistical challenges in data analysis. Preprocessing data normalization and transformation. Useful

More information

Designing Complex Omics Experiments

Designing Complex Omics Experiments Designing Complex Omics Experiments Xiangqin Cui Section on Statistical Genetics Department of Biostatistics University of Alabama at Birmingham 6/15/2015 Some slides are from previous lectures given by

More information

Measuring gene expression (Microarrays) Ulf Leser

Measuring gene expression (Microarrays) Ulf Leser Measuring gene expression (Microarrays) Ulf Leser This Lecture Gene expression Microarrays Idea Technologies Problems Quality control Normalization Analysis next week! 2 http://learn.genetics.utah.edu/content/molecules/transcribe/

More information

Recent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques)

Recent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques) Microarrays and Transcript Profiling Gene expression patterns are traditionally studied using Northern blots (DNA-RNA hybridization assays). This approach involves separation of total or polya + RNA on

More information

REAL TIME PCR USING SYBR GREEN

REAL TIME PCR USING SYBR GREEN REAL TIME PCR USING SYBR GREEN 1 THE PROBLEM NEED TO QUANTITATE DIFFERENCES IN mrna EXPRESSION SMALL AMOUNTS OF mrna LASER CAPTURE SMALL AMOUNTS OF TISSUE PRIMARY CELLS PRECIOUS REAGENTS 2 THE PROBLEM

More information

3.1.4 DNA Microarray Technology

3.1.4 DNA Microarray Technology 3.1.4 DNA Microarray Technology Scientists have discovered that one of the differences between healthy and cancer is which genes are turned on in each. Scientists can compare the gene expression patterns

More information

Molecular Cell Biology - Problem Drill 11: Recombinant DNA

Molecular Cell Biology - Problem Drill 11: Recombinant DNA Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna

More information

Mixed effects model for assessing RNA degradation in Affymetrix GeneChip experiments

Mixed effects model for assessing RNA degradation in Affymetrix GeneChip experiments Mixed effects model for assessing RNA degradation in Affymetrix GeneChip experiments Kellie J. Archer, Ph.D. Suresh E. Joel Viswanathan Ramakrishnan,, Ph.D. Department of Biostatistics Virginia Commonwealth

More information

DNA Microarray Technology

DNA Microarray Technology CHAPTER 1 DNA Microarray Technology All living organisms are composed of cells. As a functional unit, each cell can make copies of itself, and this process depends on a proper replication of the genetic

More information

Analysis of Microarray Data

Analysis of Microarray Data Analysis of Microarray Data Lecture 3: Visualization and Functional Analysis George Bell, Ph.D. Senior Bioinformatics Scientist Bioinformatics and Research Computing Whitehead Institute Outline Review

More information

Gene expression profiling experiments:

Gene expression profiling experiments: Gene expression profiling experiments: Problems, pitfalls, and solutions. Heli Borg The Alternatives in Microarray Experiments bacteria - eucaryots non poly(a) + - poly(a) + oligonucleotide Affymetrix

More information

The first thing you will see is the opening page. SeqMonk scans your copy and make sure everything is in order, indicated by the green check marks.

The first thing you will see is the opening page. SeqMonk scans your copy and make sure everything is in order, indicated by the green check marks. Open Seqmonk Launch SeqMonk The first thing you will see is the opening page. SeqMonk scans your copy and make sure everything is in order, indicated by the green check marks. SeqMonk Analysis Page 1 Create

More information

Outline. Analysis of Microarray Data. Most important design question. General experimental issues

Outline. Analysis of Microarray Data. Most important design question. General experimental issues Outline Analysis of Microarray Data Lecture 1: Experimental Design and Data Normalization Introduction to microarrays Experimental design Data normalization Other data transformation Exercises George Bell,

More information

Lecture 22 Eukaryotic Genes and Genomes III

Lecture 22 Eukaryotic Genes and Genomes III Lecture 22 Eukaryotic Genes and Genomes III In the last three lectures we have thought a lot about analyzing a regulatory system in S. cerevisiae, namely Gal regulation that involved a hand full of genes.

More information

Gene Expression Profiling of Prokaryotic Samples using Low Input Quick Amp WT Kit

Gene Expression Profiling of Prokaryotic Samples using Low Input Quick Amp WT Kit Gene Expression Profiling of Prokaryotic Samples using Low Input Quick Amp WT Kit Application Note Authors Nilanjan Guha and Becky Mullinax Abstract Agilent s Low Input Quick Amp Labeling WT (LIQA WT)

More information

High Performance Labeling Kits for cdna and Oligo Microarrays

High Performance Labeling Kits for cdna and Oligo Microarrays Agilent in Life Sciences > Genomics > Proteomics > Drug Discovery > Development > QA/QC High Performance Labeling Kits for cdna and Oligo Microarrays Get more from one experiment Agilent has perfected

More information

Analysis of Microarray Data

Analysis of Microarray Data Analysis of Microarray Data Lecture 3: Visualization and Functional Analysis George Bell, Ph.D. Bioinformatics Scientist Bioinformatics and Research Computing Whitehead Institute Outline Review Visualizing

More information

Technical Review. Real time PCR

Technical Review. Real time PCR Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously

More information

Analysis of Microarray Data

Analysis of Microarray Data Analysis of Microarray Data Lecture 1: Experimental Design and Data Normalization George Bell, Ph.D. Senior Bioinformatics Scientist Bioinformatics and Research Computing Whitehead Institute Outline Introduction

More information

Optimizing a Conventional Polymerase Chain Reaction (PCR) and Primer Design

Optimizing a Conventional Polymerase Chain Reaction (PCR) and Primer Design Optimizing a Conventional Polymerase Chain Reaction (PCR) and Primer Design The Polymerase Chain Reaction (PCR) is a powerful technique used for the amplification of a specific segment of a nucleic acid

More information

Image Analysis. Based on Information from Terry Speed s Group, UC Berkeley. Lecture 3 Pre-Processing of Affymetrix Arrays. Affymetrix Terminology

Image Analysis. Based on Information from Terry Speed s Group, UC Berkeley. Lecture 3 Pre-Processing of Affymetrix Arrays. Affymetrix Terminology Image Analysis Lecture 3 Pre-Processing of Affymetrix Arrays Stat 697K, CS 691K, Microbio 690K 2 Affymetrix Terminology Probe: an oligonucleotide of 25 base-pairs ( 25-mer ). Based on Information from

More information

Gene expression analysis. Biosciences 741: Genomics Fall, 2013 Week 5. Gene expression analysis

Gene expression analysis. Biosciences 741: Genomics Fall, 2013 Week 5. Gene expression analysis Gene expression analysis Biosciences 741: Genomics Fall, 2013 Week 5 Gene expression analysis From EST clusters to spotted cdna microarrays Long vs. short oligonucleotide microarrays vs. RT-PCR Methods

More information

Microarray Experiment Design

Microarray Experiment Design Microarray Experiment Design Samples used, extract preparation and labelling: AML blasts were isolated from bone marrow by centrifugation on a Ficoll- Hypaque gradient. Total RNA was extracted using TRIzol

More information

Performance verification of the automated NuGEN WT-Ovation FFPE RNA Amplification System

Performance verification of the automated NuGEN WT-Ovation FFPE RNA Amplification System TECHNICAL REPORT Performance verification of the automated NuGEN WT-Ovation FFPE RNA Amplification System FFPE specimens are routinely collected in clinical environments and are a rich source of well documented

More information

Humboldt Universität zu Berlin. Grundlagen der Bioinformatik SS Microarrays. Lecture

Humboldt Universität zu Berlin. Grundlagen der Bioinformatik SS Microarrays. Lecture Humboldt Universität zu Berlin Microarrays Grundlagen der Bioinformatik SS 2017 Lecture 6 09.06.2017 Agenda 1.mRNA: Genomic background 2.Overview: Microarray 3.Data-analysis: Quality control & normalization

More information

EECS730: Introduction to Bioinformatics

EECS730: Introduction to Bioinformatics EECS730: Introduction to Bioinformatics Lecture 14: Microarray Some slides were adapted from Dr. Luke Huan (University of Kansas), Dr. Shaojie Zhang (University of Central Florida), and Dr. Dong Xu and

More information

Bioinformatics for Biologists

Bioinformatics for Biologists Bioinformatics for Biologists Microarray Data Analysis. Lecture 1. Fran Lewitter, Ph.D. Director Bioinformatics and Research Computing Whitehead Institute Outline Introduction Working with microarray data

More information

Analysis of Microarray Data

Analysis of Microarray Data Analysis of Microarray Data Lecture 1: Experimental Design and Data Normalization George Bell, Ph.D. Senior Bioinformatics Scientist Bioinformatics and Research Computing Whitehead Institute Outline Introduction

More information

Background Correction and Normalization. Lecture 3 Computational and Statistical Aspects of Microarray Analysis June 21, 2005 Bressanone, Italy

Background Correction and Normalization. Lecture 3 Computational and Statistical Aspects of Microarray Analysis June 21, 2005 Bressanone, Italy Background Correction and Normalization Lecture 3 Computational and Statistical Aspects of Microarray Analysis June 21, 2005 Bressanone, Italy Feature Level Data Outline Affymetrix GeneChip arrays Two

More information

Agilent GeneSpring GX 10: Beyond. Pam Tangvoranuntakul Product Manager, GeneSpring October 1, 2008

Agilent GeneSpring GX 10: Beyond. Pam Tangvoranuntakul Product Manager, GeneSpring October 1, 2008 Agilent GeneSpring GX 10: Gene Expression and Beyond Pam Tangvoranuntakul Product Manager, GeneSpring October 1, 2008 GeneSpring GX 10 in the News Our Goals for GeneSpring GX 10 Goal 1: Bring back GeneSpring

More information

Rapid Method for the Purification of Total RNA from Formalin- Fixed Paraffin-Embedded (FFPE) Tissue Samples

Rapid Method for the Purification of Total RNA from Formalin- Fixed Paraffin-Embedded (FFPE) Tissue Samples Application Note 17 RNA Sample Preparation Rapid Method for the Purification of Total RNA from Formalin- Fixed Paraffin-Embedded (FFPE) Tissue Samples M. Melmogy 1, V. Misic 1, B. Lam, PhD 1, C. Dobbin,

More information

Background Analysis and Cross Hybridization. Application

Background Analysis and Cross Hybridization. Application Background Analysis and Cross Hybridization Application Pius Brzoska, Ph.D. Abstract Microarray technology provides a powerful tool with which to study the coordinate expression of thousands of genes in

More information

Q: Using at least 3 biological replicates in an experiment is recommended to do. What do you suggest: At which step of calculation of the relative

Q: Using at least 3 biological replicates in an experiment is recommended to do. What do you suggest: At which step of calculation of the relative The questions below have been asked by attendees of the qpcr webinar series, Part 2: Analyzing Your Data. All the questions, including the questions that could not be answered during the webinar have been

More information

Measuring gene expression

Measuring gene expression Measuring gene expression Grundlagen der Bioinformatik SS2018 https://www.youtube.com/watch?v=v8gh404a3gg Agenda Organization Gene expression Background Technologies FISH Nanostring Microarrays RNA-seq

More information

Motivation From Protein to Gene

Motivation From Protein to Gene MOLECULAR BIOLOGY 2003-4 Topic B Recombinant DNA -principles and tools Construct a library - what for, how Major techniques +principles Bioinformatics - in brief Chapter 7 (MCB) 1 Motivation From Protein

More information

Identification of biological themes in microarray data from a mouse heart development time series using GeneSifter

Identification of biological themes in microarray data from a mouse heart development time series using GeneSifter Identification of biological themes in microarray data from a mouse heart development time series using GeneSifter VizX Labs, LLC Seattle, WA 98119 Abstract Oligonucleotide microarrays were used to study

More information

Microarray Gene Expression Analysis at CNIO

Microarray Gene Expression Analysis at CNIO Microarray Gene Expression Analysis at CNIO Orlando Domínguez Genomics Unit Biotechnology Program, CNIO 8 May 2013 Workflow, from samples to Gene Expression data Experimental design user/gu/ubio Samples

More information

Introduction to Bioinformatics: Chapter 11: Measuring Expression of Genome Information

Introduction to Bioinformatics: Chapter 11: Measuring Expression of Genome Information HELSINKI UNIVERSITY OF TECHNOLOGY LABORATORY OF COMPUTER AND INFORMATION SCIENCE Introduction to Bioinformatics: Chapter 11: Measuring Expression of Genome Information Jarkko Salojärvi Lecture slides by

More information

Clones. Glass Slide PCR. Purification. Array Printing. Post-process. Hybridize. Scan. Array Fabrication. Sample Preparation/Hybridization.

Clones. Glass Slide PCR. Purification. Array Printing. Post-process. Hybridize. Scan. Array Fabrication. Sample Preparation/Hybridization. Terminologies Reporter: the nucleotide sequence present in a particular location on the array (a.k.a. probe) Feature: the location of a reporter on the array Composite sequence: a set of reporters used

More information

Design. Construction. Characterization

Design. Construction. Characterization Design Construction Characterization DNA mrna (messenger) A C C transcription translation C A C protein His A T G C T A C G Plasmids replicon copy number incompatibility selection marker origin of replication

More information

DNA/RNA MICROARRAYS NOTE: USE THIS KIT WITHIN 6 MONTHS OF RECEIPT.

DNA/RNA MICROARRAYS NOTE: USE THIS KIT WITHIN 6 MONTHS OF RECEIPT. DNA/RNA MICROARRAYS This protocol is based on the EDVOTEK protocol DNA/RNA Microarrays. 10 groups of students NOTE: USE THIS KIT WITHIN 6 MONTHS OF RECEIPT. 1. EXPERIMENT OBJECTIVE The objective of this

More information

Rapid Method for the Purification of Total RNA from Formalin-Fixed Paraffin-Embedded (FFPE) Tissue Samples

Rapid Method for the Purification of Total RNA from Formalin-Fixed Paraffin-Embedded (FFPE) Tissue Samples Application Note 17 RNA Sample Preparation Rapid Method for the Purification of Total RNA from Formalin-Fixed Paraffin-Embedded (FFPE) Tissue Samples M. Melmogy 1, V. Misic 1, B. Lam, PhD 1, C. Dobbin,

More information

FACTORS CONTRIBUTING TO VARIABILITY IN DNA MICROARRAY RESULTS: THE ABRF MICROARRAY RESEARCH GROUP 2002 STUDY

FACTORS CONTRIBUTING TO VARIABILITY IN DNA MICROARRAY RESULTS: THE ABRF MICROARRAY RESEARCH GROUP 2002 STUDY FACTORS CONTRIBUTING TO VARIABILITY IN DNA MICROARRAY RESULTS: THE ABRF MICROARRAY RESEARCH GROUP 2002 STUDY K. L. Knudtson 1, C. Griffin 2, A. I. Brooks 3, D. A. Iacobas 4, K. Johnson 5, G. Khitrov 6,

More information

Pre processing and quality control of microarray data

Pre processing and quality control of microarray data Pre processing and quality control of microarray data Christine Stansberg, 20.04.10 Workflow microarray experiment 1 Problem driven experimental design Wet lab experiments RNA labelling 2 Data pre processing

More information

Wu et al., Determination of genetic identity in therapeutic chimeric states. We used two approaches for identifying potentially suitable deletion loci

Wu et al., Determination of genetic identity in therapeutic chimeric states. We used two approaches for identifying potentially suitable deletion loci SUPPLEMENTARY METHODS AND DATA General strategy for identifying deletion loci We used two approaches for identifying potentially suitable deletion loci for PDP-FISH analysis. In the first approach, we

More information

Introduction to Bioinformatics and Gene Expression Technologies

Introduction to Bioinformatics and Gene Expression Technologies Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 1 Vocabulary Gene: hereditary DNA sequence at a

More information

Introduction to Bioinformatics and Gene Expression Technologies

Introduction to Bioinformatics and Gene Expression Technologies Vocabulary Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 Gene: Genetics: Genome: Genomics: hereditary

More information

Quality Measures for CytoChip Microarrays

Quality Measures for CytoChip Microarrays Quality Measures for CytoChip Microarrays How to evaluate CytoChip Oligo data quality in BlueFuse Multi software. Data quality is one of the most important aspects of any microarray experiment. This technical

More information

Microarray Data Analysis Workshop. Preprocessing and normalization A trailer show of the rest of the microarray world.

Microarray Data Analysis Workshop. Preprocessing and normalization A trailer show of the rest of the microarray world. Microarray Data Analysis Workshop MedVetNet Workshop, DTU 2008 Preprocessing and normalization A trailer show of the rest of the microarray world Carsten Friis Media glna tnra GlnA TnrA C2 glnr C3 C5 C6

More information

Rapid Transcriptome Characterization for a nonmodel organism using 454 pyrosequencing

Rapid Transcriptome Characterization for a nonmodel organism using 454 pyrosequencing Rapid Transcriptome Characterization for a nonmodel organism using 454 pyrosequencing "#$%&'()*+,"(-*."#$%&/.,"*01*0.,(%-*.&0("2*01*3,$,45,"-*4#66&*71** 3"#)(82,"-*2&9:)($*)1*"(03&"2-*#)66(*.(8$6#*;

More information

Validation Study of FUJIFILM QuickGene System for Affymetrix GeneChip

Validation Study of FUJIFILM QuickGene System for Affymetrix GeneChip Validation Study of FUJIFILM QuickGene System for Affymetrix GeneChip Reproducibility of Extraction of Genomic DNA from Whole Blood samples in EDTA using FUJIFILM membrane technology on the QuickGene-810

More information

Microarray Technologies. Julie Støve Bødker cand scient, PhD

Microarray Technologies. Julie Støve Bødker cand scient, PhD Microarray Technologies Julie Støve Bødker cand scient, PhD 2 Microarray Technologies - Outline I. Lecture, ~30 minutes II. Presentation of articles, ~30 minutes 1. Alizadeh et al., 2000: Maria Rodrigo

More information

DNA Microarrays and Clustering of Gene Expression Data

DNA Microarrays and Clustering of Gene Expression Data DNA Microarrays and Clustering of Gene Expression Data Martha L. Bulyk mlbulyk@receptor.med.harvard.edu Biophysics 205 Spring term 2008 Traditional Method: Northern Blot RNA population on filter (gel);

More information

Introduction to Microarray Technique, Data Analysis, Databases Maryam Abedi PhD student of Medical Genetics

Introduction to Microarray Technique, Data Analysis, Databases Maryam Abedi PhD student of Medical Genetics Introduction to Microarray Technique, Data Analysis, Databases Maryam Abedi PhD student of Medical Genetics abedi777@ymail.com Outlines Technology Basic concepts Data analysis Printed Microarrays In Situ-Synthesized

More information

Microarray Informatics

Microarray Informatics Microarray Informatics Donald Dunbar MSc Seminar 31 st January 2007 Aims To give a biologist s view of microarray experiments To explain the technologies involved To describe typical microarray experiments

More information

CAP BIOINFORMATICS Su-Shing Chen CISE. 10/5/2005 Su-Shing Chen, CISE 1

CAP BIOINFORMATICS Su-Shing Chen CISE. 10/5/2005 Su-Shing Chen, CISE 1 CAP 5510-9 BIOINFORMATICS Su-Shing Chen CISE 10/5/2005 Su-Shing Chen, CISE 1 Basic BioTech Processes Hybridization PCR Southern blotting (spot or stain) 10/5/2005 Su-Shing Chen, CISE 2 10/5/2005 Su-Shing

More information

Rough Draft Not For Distribution. Quality Control Metrics for Array Comparative Genomic Hybridization Data

Rough Draft Not For Distribution. Quality Control Metrics for Array Comparative Genomic Hybridization Data Rough Draft Not For Distribution Quality Control Metrics for Array Comparative Genomic Hybridization Data Jeffrey C. Miecznikowski ab1, Daniel P. Gaile ab, Conroy, Jeffrey, Norma J Nowak c a Department

More information

Site directed mutagenesis, Insertional and Deletion Mutagenesis. Mitesh Shrestha

Site directed mutagenesis, Insertional and Deletion Mutagenesis. Mitesh Shrestha Site directed mutagenesis, Insertional and Deletion Mutagenesis Mitesh Shrestha Mutagenesis Mutagenesis (the creation or formation of a mutation) can be used as a powerful genetic tool. By inducing mutations

More information

10.1 The Central Dogma of Biology and gene expression

10.1 The Central Dogma of Biology and gene expression 126 Grundlagen der Bioinformatik, SS 09, D. Huson (this part by K. Nieselt) July 6, 2009 10 Microarrays (script by K. Nieselt) There are many articles and books on this topic. These lectures are based

More information

Bioinformatics for Biologists

Bioinformatics for Biologists Bioinformatics for Biologists Functional Genomics: Microarray Data Analysis Fran Lewitter, Ph.D. Head, Biocomputing Whitehead Institute Outline Introduction Working with microarray data Normalization Analysis

More information

Introduction to Real-Time PCR: Basic Principles and Chemistries

Introduction to Real-Time PCR: Basic Principles and Chemistries Introduction to Real-Time PCR: Basic Principles and Chemistries Leta Steffen, PhD Applications Scientist Promega Corporation Outline I. Real-Time PCR overview Basics of Real-Time PCR Understanding the

More information

Comparative Analysis using the Illumina DASL assay with FFPE tissue. Wendell Jones, PhD Vice President, Statistics and Bioinformatics

Comparative Analysis using the Illumina DASL assay with FFPE tissue. Wendell Jones, PhD Vice President, Statistics and Bioinformatics TM Comparative Analysis using the Illumina DASL assay with FFPE tissue Wendell Jones, PhD Vice President, Statistics and Bioinformatics Background EA has examined several protocol assay possibilities for

More information

Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods

Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/

More information

Introduction to microarray technology and data analysis

Introduction to microarray technology and data analysis Introduction to microarray technology and data analysis Aron C. Eklund eklund@cbs.dtu.dk Cancer Systems Biology group Center for Biological Sequence Analysis Technical University of Denmark Introduction

More information

Deoxyribonucleic Acid DNA

Deoxyribonucleic Acid DNA Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/

More information

ChIP-seq and RNA-seq

ChIP-seq and RNA-seq ChIP-seq and RNA-seq Biological Goals Learn how genomes encode the diverse patterns of gene expression that define each cell type and state. Protein-DNA interactions (ChIPchromatin immunoprecipitation)

More information

Microarray Informatics

Microarray Informatics Microarray Informatics Donald Dunbar MSc Seminar 4 th February 2009 Aims To give a biologistʼs view of microarray experiments To explain the technologies involved To describe typical microarray experiments

More information

Integrated NGS Sample Preparation Solutions for Limiting Amounts of RNA and DNA. March 2, Steven R. Kain, Ph.D. ABRF 2013

Integrated NGS Sample Preparation Solutions for Limiting Amounts of RNA and DNA. March 2, Steven R. Kain, Ph.D. ABRF 2013 Integrated NGS Sample Preparation Solutions for Limiting Amounts of RNA and DNA March 2, 2013 Steven R. Kain, Ph.D. ABRF 2013 NuGEN s Core Technologies Selective Sequence Priming Nucleic Acid Amplification

More information

2100 Bioanalyzer. Overview & News. Ralph Beneke Dec 2010

2100 Bioanalyzer. Overview & News. Ralph Beneke Dec 2010 2100 Bioanalyzer Overview & News Ralph Beneke Dec 2010 RNA QC in Gene Expression Workflows Cited in over 10,000 peer-reviewed papers RIN is the industry standard for RNA QC For any size and at low sample

More information

Bioinformatics: Microarray Technology. Assc.Prof. Chuchart Areejitranusorn AMS. KKU.

Bioinformatics: Microarray Technology. Assc.Prof. Chuchart Areejitranusorn AMS. KKU. Introduction to Bioinformatics: Microarray Technology Assc.Prof. Chuchart Areejitranusorn AMS. KKU. ความจร งเก ยวก บ ความจรงเกยวกบ Cell and DNA Cell Nucleus Chromosome Protein Gene (mrna), single strand

More information

GeneChip Expression 3 - Amplification Reagents

GeneChip Expression 3 - Amplification Reagents GeneChip Expression 3 - Amplification Reagents Two-Cycle Target Labeling Assay and Two-Cycle cdna Synthesis Kit July 2004 Outline Overview Procedural modifications Technical performance compared with a

More information

Automated Electrophoresis Applications for Synthetic Biology

Automated Electrophoresis Applications for Synthetic Biology Automated Electrophoresis Applications for Synthetic Biology Melissa Huang Liu, Ph.D. Product Manager, Electrophoresis Agilent Technologies 1 Outline 2100 Bioanalyzer & 4200 TapeStation Systems Automated

More information

Gene expression. What is gene expression?

Gene expression. What is gene expression? Gene expression What is gene expression? Methods for measuring a single gene. Northern Blots Reporter genes Quantitative RT-PCR Operons, regulons, and stimulons. DNA microarrays. Expression profiling Identifying

More information

7.03, 2006, Lecture 23 Eukaryotic Genes and Genomes IV

7.03, 2006, Lecture 23 Eukaryotic Genes and Genomes IV 1 Fall 2006 7.03 7.03, 2006, Lecture 23 Eukaryotic Genes and Genomes IV In the last three lectures we have thought a lot about analyzing a regulatory system in S. cerevisiae, namely Gal regulation that

More information

7.05, 2005, Lecture 23 Eukaryotic Genes and Genomes IV

7.05, 2005, Lecture 23 Eukaryotic Genes and Genomes IV 7.05, 2005, Lecture 23 Eukaryotic Genes and Genomes IV In the last three lectures we have thought a lot about analyzing a regulatory system in S. cerevisiae, namely Gal regulation that involved a hand

More information

The essentials of microarray data analysis

The essentials of microarray data analysis The essentials of microarray data analysis (from a complete novice) Thanks to Rafael Irizarry for the slides! Outline Experimental design Take logs! Pre-processing: affy chips and 2-color arrays Clustering

More information

The Affymetrix platform for gene expression analysis Affymetrix recommended QA procedures The RMA model for probe intensity data Application of the

The Affymetrix platform for gene expression analysis Affymetrix recommended QA procedures The RMA model for probe intensity data Application of the 1 The Affymetrix platform for gene expression analysis Affymetrix recommended QA procedures The RMA model for probe intensity data Application of the fitted RMA model to quality assessment 2 3 Probes are

More information

Introduction to Bioinformatics and Gene Expression Technology

Introduction to Bioinformatics and Gene Expression Technology Vocabulary Introduction to Bioinformatics and Gene Expression Technology Utah State University Spring 2014 STAT 5570: Statistical Bioinformatics Notes 1.1 Gene: Genetics: Genome: Genomics: hereditary DNA

More information