Geoff Barton: Multiple alignment and Analysis Session 2: Alignment & alignment analysis. Session 3: Annotating sequences & alignments
|
|
|
- Ophelia Fields
- 5 years ago
- Views:
Transcription
1 am. 9.15am am. Overview of the day Session 1. Introduction to Jalview starting the application, importing alignments, basic editing and creating figures am. 11am 11.30am 11.30am pm. Coffee Geoff Barton: Multiple alignment and Analysis Session 2: Alignment & alignment analysis Creating sequence alignments, importing and calculating trees, tree based alignment analysis 12.30pm to 1.30pm. 1.30pm 3.00pm. Lunch Creating and viewing sequence annotation Protein Secondary structure prediction 3.00pm 3.30pm 3.30pm 4.30pm. Session 3: Annotating sequences & alignments Coffee Session 4: Working with molecular structures Viewing 3D Structures, superimpositions, mapping disorder and alignment quality Viewing RNA Secondary Structure 4.30pm 4.45pm. Wrapup what we didn t cover today
2 Course materials Everything is online These slides Jalview v2.8.2 Manual (v1.5.0) Log in and Open the manual in your PDF Viewer NOW
3 Session 4 Working with structures Viewing PDB data Superimposing structures Mapping data onto structure Disorder prediction RNA helix shading
4 Desktop Structure Visualization 3D structures and 2D RNA diagrams VARNA Visual Analysis of RNA
5 Linked tree viewer allows subgroups to be identified in alignment Group selections Colours and mouseovers Linked Jmol viewer shows one or more structures coloured by alignment
6 Associating structures with Local PDB file sequences Attach PDB file to sequence manually drag and drop to match files to sequences by ID Structures in the PDB database Provide PDB id (and chain) for sequence Discover references via sequence database
7 New Structure tab in Jalview Preferences Checkboxes for: Secondary structure Protein DSSP built in RNAView web service Temperature factor Set default 3D viewer Jmol Chimera
8 When Protein annotation is enabled Add Reference Annotations Available when any sequence associated annotation can be added to the current view Access via Sequence ID and Selection submenu
9 Task Protein Structures in Jalview Sec 2.1. Exercise 14 Discover PDB structures for ferredoxin sequence(s) Note use Fetch Database Refs->UNIPROT->Uniprot Save and load structures and manipulate colouring Questions How does Jalview match up sequence data to structural data
10 Task Protein Structures in Jalview Sec 2.1. Exercise 14 Discover PDB structures for ferredoxin sequence(s) Save and load structures and manipulate colouring Questions How does Jalview match up sequence data to structural data Did anyone try Add Reference Annotation?
11 many structures can be shown in a single view Structures can be Superimposed using the visible region of alignment
12 Superposing Structures using Alignments Sec Exercise 15 Task Align structures using the ferredoxin alignment If View all N structures doesn t align structures: Use Jmol->Align menu Experiment with views to control what part of the alignment is used to superimpose the structures
13 Superposing Structures using Alignments Sec Exercise 15 Task Align structures using the ferredoxin alignment Experiment with views to control what part of the alignment is used to superimpose the structures Questions What colourscheme would highlight the conserved parts of the structures? Which view gave the best structure superposition? How did you decide this?
14 Colouring structures using many multiple alignments Sect Exercise 16
15 Protein Disorder prediction Exercise 27 Complementary problem to secondary structure prediction Recognise structured & unstructured domains Predict holes in density maps (REM450) Detect flexible loops ( HOTLOOPS ) Programs provided by JABAWS 2 employ Machine learning methods (DisEMBL) Similarity to disordered sequences (RONN) Empirical amino acid statistics (IUPred, GlobPlot)
16 Disorder Predictions from JABAWS JABAWS Analysis Service Disorder Predictions Create annotation and features Features highlight disordered region or structured domain predictions Use Threshold & Per-sequence option on Colour by Annotation dialog to shade alignment using raw scores
17 Disorder in Interleukin 7 Orthologs
18 RNA 2 nd -ary Structure Try it now: 1. Import RF00162 from Rfam (Full) 2. Select Colour by RNA Helices RALEE style colouring highlights distinct stems and helices
19 Selections and mouse positions shared between alignment view and VARNA Try it now: 1. Open VARNA with Structure->View Structure->RNA Secondary Structure 2. Explore difference between trimmed and untrimmed 3. Bonus points add and link a Jmol structure view Bacillus_amyloliquef.9 corresponds to PDB 3NPB VARNA has a wide range of 2D RNA plots and supports interactive annotation VARNA: Interactive drawing and editing of the RNA secondary structure Kévin Darty, Alain Denise and Yann Ponty Bioinformatics (2009)
20 Interactive Alignment based RNA 2 nd -ary Structure Prediction
21 Interactive Alignment based RNA 2 nd -ary Structure Prediction Can be enabled for any view Updated if alignment changes settings & results saved in Jalview project Implemented by our 2013 Summer student
22 Tooltips show alternative base pairs
23 DNA and Protein in Jalview Discussed in Section 2.10 of manual From DNA to Protein Calculations => Translate cdna View protein annotation on exons using EMBL records From protein to DNA Recover DNA for proteins using EMBL cross references
24 Jalview 2.8 and RNA 2 nd -ary Structure RALEE style colouring highlights distinct stems and helices
25 RNAView, pyrna Fabrice Jossinet s pyrna server includes RNAView * Identify and characterise base pair interactions in 3D structure Used by Jalview to obtain secondary structure for RNA 3D data * RNAView will shortly be replaced by DSSR (Xiang-Jun Lu)
26
27 Multi-windowed UI Visualization & Analysis Jalview Flavours Common Data & Analysis Editing, messaging and File Input/Output Lightweight UI Integrate with web sites
28 Alignment on Web Google Jalview Illustrator Word/LaTeX.. Etc...
29 Clustal Fasta Pile-Up BLC Stockholm PIR..etc.. PDB Newick & New Hampshire Extended Jalview Features & GFF Jalview Annotation & T-Coffee Scores
30 NEW FOR 2014 Clustal Fasta Pile-Up ViennaRNA BLC Stockholm PIR Ronny Lorenz et al. Algorithms for Molecular..etc.. Biology, 2011 doi: / JPred3 Chris Cole, Jon Barber and Geoff Barton NAR Web Server Issue 2008 doi: /nar/gkn238 PDB MSAprobs: multiple alignment with pair HMMs Yongchao Liu, Bertil Schmidt, and Douglas L. Maskell Bioinformatics GLProbs adaptive sequence alignment Yongtao Ye et al. Proc. ACM BCB, 2013 pp Newick & New Hampshire Extended Jalview Features & GFF Jalview Annotation & T-Coffee Scores
31 Things I haven t talked about
32 T-COFFEE alignment reliability scores
33 Select column by feature
34 Jalview and Chimera Human Interleukin-7 structure in Chimera coloured according to IUPred disorder prediction made in Jalview, with a glutamate sidechain highlighted.
35 Jalview + VARNA + Chimera Jalview Desktop uses UCSF Chimera to show structures: Optional - Enabled as a user preference Structures coloured & superposed like with Jmol
36 Jalview & Dundee Protein Resource Developers Mungo Carstairs Tochukwu (Charles) Ofoegbu Alexey Drozdetskiy Jnet Protein prediction and analysis services
37 The Jalview developers Michele Clamp Harvard & MIT. James Cuff Harvard & MIT Steve Searle Sanger, UK Andrew Waterhouse Basel, Switzerland. RNA Features Lauren Lui UC Santa Cruz, USA. Jan Engelhardt Univ. Leipzig, Germany. Yann Ponty (VARNA) École Polytechnique, Fr. T-COFFEE Scores Paolo di Tomasso Notredame Group, CRG, Spain. Geoff Barton David Martin (Teaching) Sasha Sherstnev (JABAWS) Peter Troshin (JABAWS) Barry Strachan (logo) Tom Walsh (Apache) Ryan Maclaughlan (CSS) Andrew Millar (Drupal) All the Jalview users, and JALVIEW NEEDS
JPred and Jnet: Protein Secondary Structure Prediction.
JPred and Jnet: Protein Secondary Structure Prediction www.compbio.dundee.ac.uk/jpred ...A I L E G D Y A S H M K... FUNCTION? Protein Sequence a-helix b-strand Secondary Structure Fold What is the difference
Protein Architecture: Conserved Functional Domains
PROTOCOL Protein Motif Analysis compiled by John R. Finnerty Protein Architecture: Conserved Functional Domains Proteins are like machines in that different parts of the protein perform different sub-functions,
Textbook Reading Guidelines
Understanding Bioinformatics by Marketa Zvelebil and Jeremy Baum Last updated: May 1, 2009 Textbook Reading Guidelines Preface: Read the whole preface, and especially: For the students with Life Science
This practical aims to walk you through the process of text searching DNA and protein databases for sequence entries.
PRACTICAL 1: BLAST and Sequence Alignment The EBI and NCBI websites, two of the most widely used life science web portals are introduced along with some of the principal databases: the NCBI Protein database,
Tutorial for Stop codon reassignment in the wild
Tutorial for Stop codon reassignment in the wild Learning Objectives This tutorial has two learning objectives: 1. Finding evidence of stop codon reassignment on DNA fragments. 2. Detecting and confirming
Ensembl workshop. Thomas Randall, PhD bioinformatics.unc.edu. handouts, papers, datasets
Ensembl workshop Thomas Randall, PhD tarandal@email.unc.edu bioinformatics.unc.edu www.unc.edu/~tarandal/ensembl handouts, papers, datasets Ensembl is a joint project between EMBL - EBI and the Sanger
ab initio and Evidence-Based Gene Finding
ab initio and Evidence-Based Gene Finding A basic introduction to annotation Outline What is annotation? ab initio gene finding Genome databases on the web Basics of the UCSC browser Evidence-based gene
Homework 4. Due in class, Wednesday, November 10, 2004
1 GCB 535 / CIS 535 Fall 2004 Homework 4 Due in class, Wednesday, November 10, 2004 Comparative genomics 1. (6 pts) In Loots s paper (http://www.seas.upenn.edu/~cis535/lab/sciences-loots.pdf), the authors
BIOINF525: INTRODUCTION TO BIOINFORMATICS LAB SESSION 1
BIOINF525: INTRODUCTION TO BIOINFORMATICS LAB SESSION 1 Bioinformatics Databases http://bioboot.github.io/bioinf525_w17/module1/#1.1 Dr. Barry Grant Jan 2017 Overview: The purpose of this lab session is
Sequence Analysis '17 -- lecture Secondary structure 3. Sequence similarity and homology 2. Secondary structure prediction
Sequence Analysis '17 -- lecture 16 1. Secondary structure 3. Sequence similarity and homology 2. Secondary structure prediction Alpha helix Right-handed helix. H-bond is from the oxygen at i to the nitrogen
1-D Predictions. Prediction of local features: Secondary structure & surface exposure
Programme 8.00-8.30 Last week s quiz results 8.30-9.00 Prediction of secondary structure & surface exposure 9.00-9.20 Protein disorder prediction 9.20-9.30 Break get computers upstairs 9.30-11.00 Ex.:
MOL204 Exam Fall 2015
MOL204 Exam Fall 2015 Exercise 1 15 pts 1. 1A. Define primary and secondary bioinformatical databases and mention two examples of primary bioinformatical databases and one example of a secondary bioinformatical
Introduction to Bioinformatics CPSC 265. What is bioinformatics? Textbooks
Introduction to Bioinformatics CPSC 265 Thanks to Jonathan Pevsner, Ph.D. Textbooks Johnathan Pevsner, who I stole most of these slides from (thanks!) has written a textbook, Bioinformatics and Functional
BIMM 143: Introduction to Bioinformatics (Winter 2018)
BIMM 143: Introduction to Bioinformatics (Winter 2018) Course Instructor: Dr. Barry J. Grant ( bjgrant@ucsd.edu ) Course Website: https://bioboot.github.io/bimm143_w18/ DRAFT: 2017-12-02 (20:48:10 PST
Bacteriophage Evolution Lab Week
Bacteriophage Evolution Lab Week 6 10-16-06 Introduction Items you must bring to this lab: 1. Write-up from Phage Lab 5 2. The number and letter of the original phage suspension (1A-16A, 1B-16B) that your
UCSC Genome Browser. Introduction to ab initio and evidence-based gene finding
UCSC Genome Browser Introduction to ab initio and evidence-based gene finding Wilson Leung 06/2006 Outline Introduction to annotation ab initio gene finding Basics of the UCSC Browser Evidence-based gene
Product Applications for the Sequence Analysis Collection
Product Applications for the Sequence Analysis Collection Pipeline Pilot Contents Introduction... 1 Pipeline Pilot and Bioinformatics... 2 Sequence Searching with Profile HMM...2 Integrating Data in a
FACULTY OF BIOCHEMISTRY AND MOLECULAR MEDICINE
FACULTY OF BIOCHEMISTRY AND MOLECULAR MEDICINE BIOMOLECULES COURSE: COMPUTER PRACTICAL 1 Author of the exercise: Prof. Lloyd Ruddock Edited by Dr. Leila Tajedin 2017-2018 Assistant: Leila Tajedin (leila.tajedin@oulu.fi)
Two Mark question and Answers
1. Define Bioinformatics Two Mark question and Answers Bioinformatics is the field of science in which biology, computer science, and information technology merge into a single discipline. There are three
Bioinformatics & Protein Structural Analysis. Bioinformatics & Protein Structural Analysis. Learning Objective. Proteomics
The molecular structures of proteins are complex and can be defined at various levels. These structures can also be predicted from their amino-acid sequences. Protein structure prediction is one of the
Analyzing an individual sequence in the Sequence Editor
BioNumerics Tutorial: Analyzing an individual sequence in the Sequence Editor 1 Aim The Sequence editor window is a convenient tool implemented in BioNumerics to edit and analyze nucleotide and amino acid
Protein Bioinformatics Part I: Access to information
Protein Bioinformatics Part I: Access to information 260.655 April 6, 2006 Jonathan Pevsner, Ph.D. pevsner@kennedykrieger.org Outline [1] Proteins at NCBI RefSeq accession numbers Cn3D to visualize structures
The RNA tools registry
university of copenhagen f a c u lt y o f h e a lt h a n d m e d i c a l s c i e n c e s The RNA tools registry A community effort to catalog RNA bioinformatics resources and their relationships Anne Wenzel
ONLINE BIOINFORMATICS RESOURCES
Dedan Githae Email: d.githae@cgiar.org BecA-ILRI Hub; Nairobi, Kenya 16 May, 2014 ONLINE BIOINFORMATICS RESOURCES Introduction to Molecular Biology and Bioinformatics (IMBB) 2014 The larger picture.. Lower
DNA Glycosylase Exercise
Name StarBiochem DNA Glycosylase Exercise Background In this exercise, you will use StarBiochem, a protein 3-D viewer, to explore the structure of a DNA repair protein found in most species, including
Introduction to Bioinformatics
Introduction to Bioinformatics Dortmund, 16.-20.07.2007 Lectures: Sven Rahmann Exercises: Udo Feldkamp, Michael Wurst 1 Goals of this course Learn about Software tools Databases Methods (Algorithms) in
Bioinformatics Tools. Stuart M. Brown, Ph.D Dept of Cell Biology NYU School of Medicine
Bioinformatics Tools Stuart M. Brown, Ph.D Dept of Cell Biology NYU School of Medicine Bioinformatics Tools Stuart M. Brown, Ph.D Dept of Cell Biology NYU School of Medicine Overview This lecture will
Collect, analyze and synthesize. Annotation. Annotation for D. virilis. GEP goals: Evidence Based Annotation. Evidence for Gene Models 12/26/2018
Annotation Annotation for D. virilis Chris Shaffer July 2012 l Big Picture of annotation and then one practical example l This technique may not be the best with other projects (e.g. corn, bacteria) l
Lecture 2: Central Dogma of Molecular Biology & Intro to Programming
Lecture 2: Central Dogma of Molecular Biology & Intro to Programming Central Dogma of Molecular Biology Proteins: workhorse molecules of biological systems Proteins are synthesized from the genetic blueprints
Prot-SSP: A Tool for Amino Acid Pairing Pattern Analysis in Secondary Structures
Mol2Net, 2015, 1(Section F), pages 1-6, Proceedings 1 SciForum Mol2Net Prot-SSP: A Tool for Amino Acid Pairing Pattern Analysis in Secondary Structures Miguel de Sousa 1, *, Cristian R. Munteanu 2 and
DNA Repair Protein Exercise
Name StarBiochem DNA Repair Protein Exercise Background In this exercise, you will use StarBiochem, a protein 3-D viewer, to explore the structure of a DNA repair protein found in most species, including
Protein Structure Prediction. christian studer , EPFL
Protein Structure Prediction christian studer 17.11.2004, EPFL Content Definition of the problem Possible approaches DSSP / PSI-BLAST Generalization Results Definition of the problem Massive amounts of
Supplementary Materials for
advances.sciencemag.org/cgi/content/full/4/2/eaao0665/dc1 Supplementary Materials for Variant ribosomal RNA alleles are conserved and exhibit tissue-specific expression Matthew M. Parks, Chad M. Kurylo,
GenePainter 2 - Documentation
GenePainter 2 - Documentation Authors Stefanie Mühlhausen, Björn Hammesfahr, Florian Odronitz, Marcel Hellkamp, Stephan Waack, Martin Kollmar How to cite Stefanie Mühlhausen, Marcel Hellkamp & Martin Kollmar
Combining PSSM and physicochemical feature for protein structure prediction with support vector machine
See discussions, stats, and author profiles for this publication at: https://www.researchgate.net/publication/316994523 Combining PSSM and physicochemical feature for protein structure prediction with
Simple jury predicts protein secondary structure best
Simple jury predicts protein secondary structure best Burkhard Rost 1,*, Pierre Baldi 2, Geoff Barton 3, James Cuff 4, Volker Eyrich 5,1, David Jones 6, Kevin Karplus 7, Ross King 8, Gianluca Pollastri
What s New in Discovery Studio 2.5.5
What s New in Discovery Studio 2.5.5 Discovery Studio takes modeling and simulations to the next level. It brings together the power of validated science on a customizable platform for drug discovery research.
Getting to know RNA Polymerase: A Tutorial For Exploring Proteins in VMD By Sharlene Denos (UIUC)
Getting to know RNA Polymerase: A Tutorial For Exploring Proteins in VMD By Sharlene Denos (UIUC) 1. You will need to answer some questions and write down some observations during this activity, so please
Applied Bioinformatics
Applied Bioinformatics Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Course overview What is bioinformatics Data driven science: the creation and advancement
Reference genomes and common file formats
Reference genomes and common file formats Overview Reference genomes and GRC Fasta and FastQ (unaligned sequences) SAM/BAM (aligned sequences) Summarized genomic features BED (genomic intervals) GFF/GTF
RNA secondary structure
Sequence Analysis '17 -- Lecture 17 RNA secondary structure Functions Representations Predictions Many slides courtesy of M. Zuker, RP Math When RNA secondary structure matters mrna --> protein protein
Translating Biological Data Sets Into Linked Data
Translating Biological Data Sets Into Linked Data Mark Tomko Simmons College, Boston MA The Broad Institute of MIT and Harvard, Cambridge MA September 28, 2011 Overview Why study biological data? UniProt
Collect, analyze and synthesize. Annotation. Annotation for D. virilis. Evidence Based Annotation. GEP goals: Evidence for Gene Models 08/22/2017
Annotation Annotation for D. virilis Chris Shaffer July 2012 l Big Picture of annotation and then one practical example l This technique may not be the best with other projects (e.g. corn, bacteria) l
Introduction to DNA-Sequencing
informatics.sydney.edu.au sih.info@sydney.edu.au The Sydney Informatics Hub provides support, training, and advice on research data, analyses and computing. Talk to us about your computing infrastructure,
Introduction to Sequencher. Tom Randall Center for Bioinformatics
Introduction to Sequencher Tom Randall Center for Bioinformatics tarandal@email.unc.edu Introduction Importing, viewing and manipulating chromatographs Trimming chromatographs Assembly into contigs Editing
Textbook Reading Guidelines
Understanding Bioinformatics by Marketa Zvelebil and Jeremy Baum Last updated: January 16, 2013 Textbook Reading Guidelines Preface: Read the whole preface, and especially: For the students with Life Science
COMPUTER RESOURCES II:
COMPUTER RESOURCES II: Using the computer to analyze data, using the internet, and accessing online databases Bio 210, Fall 2006 Linda S. Huang, Ph.D. University of Massachusetts Boston In the first computer
Computational analysis of non-coding RNA. Andrew Uzilov BME110 Tue, Nov 16, 2010
Computational analysis of non-coding RNA Andrew Uzilov auzilov@ucsc.edu BME110 Tue, Nov 16, 2010 1 Corrected/updated talk slides are here: http://tinyurl.com/uzilovrna redirects to: http://users.soe.ucsc.edu/~auzilov/bme110/fall2010/
G4120: Introduction to Computational Biology
ICB Fall 2004 G4120: Computational Biology Oliver Jovanovic, Ph.D. Columbia University Department of Microbiology Copyright 2004 Oliver Jovanovic, All Rights Reserved. Analysis of Protein Sequences Coding
Download the Lectin sequence output from
Computer Analysis of DNA and Protein Sequences Over the Internet Part I. IN CLASS Download the Lectin sequence output from http://stan.cropsci.uiuc.edu/courses/cpsc265/ Open these in BioEdit (free software).
Resolution of fine scale ribosomal DNA variation in Saccharomyces yeast
Resolution of fine scale ribosomal DNA variation in Saccharomyces yeast Rob Davey NCYC 2009 Introduction SGRP project Ribosomal DNA and variation Computational methods Preliminary Results Conclusions SGRP
BMB/Bi/Ch 170 Fall 2017 Problem Set 1: Proteins I
BMB/Bi/Ch 170 Fall 2017 Problem Set 1: Proteins I Please use ray-tracing feature for all the images you are submitting. Use either the Ray button on the right side of the command window in PyMOL or variations
Introduction to RNA-Seq in GeneSpring NGS Software
Introduction to RNA-Seq in GeneSpring NGS Software Dipa Roy Choudhury, Ph.D. Strand Scientific Intelligence and Agilent Technologies Learn more at www.genespring.com Introduction to RNA-Seq In a few years,
Massachusetts Institute of Technology Computational Evolutionary Biology, Fall, 2005 Laboratory 3: Detecting selection
Massachusetts Institute of Technology 6.877 Computational Evolutionary Biology, Fall, 2005 Laboratory 3: Detecting selection Handed out: November 28 Due: December 14 Introduction In this laboratory we
ELE4120 Bioinformatics. Tutorial 5
ELE4120 Bioinformatics Tutorial 5 1 1. Database Content GenBank RefSeq TPA UniProt 2. Database Searches 2 Databases A common situation for alignment is to search through a database to retrieve the similar
RESEARCH METHODOLOGY, BIOSTATISTICS AND IPR
MB 401: RESEARCH METHODOLOGY, BIOSTATISTICS AND IPR Objectives: The overall aim of the course is to deepen knowledge regarding basic concepts of Biostatistics, the research process in occupational therapy
Bioinformatics Practical Course. 80 Practical Hours
Bioinformatics Practical Course 80 Practical Hours Course Description: This course presents major ideas and techniques for auxiliary bioinformatics and the advanced applications. Points included incorporate
Homework Project Protein Structure Prediction Contact me if you have any questions/problems with the assignment:
Homework Project Protein Structure Prediction Contact me if you have any questions/problems with the assignment: Roland.Dunbrack@gmail.com For this homework, each of you will be assigned a particular human
Defining protein domains - computational and experimental approaches. Christoph Meier Oxford Protein Production Facility
Defining protein domains - computational and experimental approaches Christoph Meier Oxford Protein Production Facility chrism@strubi.ox.ac.uk Agenda Introduction to the Oxford Protein Production Facility
Exploring genomes - A Treasure Hunt on the Internet
Exploring genomes - A Treasure Hunt on the Internet An activity developed by staff of the European Bioinformatics Institute (EMBL-EBI) and suitable for use with students aged from 16-18 years old. Introduction
Basic Bioinformatics: Homology, Sequence Alignment,
Basic Bioinformatics: Homology, Sequence Alignment, and BLAST William S. Sanders Institute for Genomics, Biocomputing, and Biotechnology (IGBB) High Performance Computing Collaboratory (HPC 2 ) Mississippi
FUNCTIONAL BIOINFORMATICS
Molecular Biology-2018 1 FUNCTIONAL BIOINFORMATICS PREDICTING THE FUNCTION OF AN UNKNOWN PROTEIN Suppose you have found the amino acid sequence of an unknown protein and wish to find its potential function.
NUCLEIC ACIDS. DNA (Deoxyribonucleic Acid) and RNA (Ribonucleic Acid): information storage molecules made up of nucleotides.
NUCLEIC ACIDS DNA (Deoxyribonucleic Acid) and RNA (Ribonucleic Acid): information storage molecules made up of nucleotides. Base Adenine Guanine Cytosine Uracil Thymine Abbreviation A G C U T DNA RNA 2
Introduction to Bioinformatics Problem Set 7: Genome Analysis
Introduction to Bioinformatics Problem Set 7: Genome Analysis 1. You are examining the sequence of a newly sequenced phage and run across the following features. In each case, you're wondering whether
Protein Sequence Analysis. BME 110: CompBio Tools Todd Lowe April 19, 2007 (Slide Presentation: Carol Rohl)
Protein Sequence Analysis BME 110: CompBio Tools Todd Lowe April 19, 2007 (Slide Presentation: Carol Rohl) Linear Sequence Analysis What can you learn from a (single) protein sequence? Calculate it s physical
OncoMD User Manual Version 2.6. OncoMD: Cancer Analytics Platform
OncoMD: Cancer Analytics Platform 1 Table of Contents 1. INTRODUCTION... 3 2. OVERVIEW OF ONCOMD... 3 3. ORGANIZATION OF INFORMATION IN ONCOMD... 3 4. GETTING STARTED... 6 4.1 USER AUTHENTICATION... 6
Bioinformatics for Proteomics. Ann Loraine
Bioinformatics for Proteomics Ann Loraine aloraine@uab.edu What is bioinformatics? The science of collecting, processing, organizing, storing, analyzing, and mining biological information, especially data
Prediction of protein disorder Zsuzsanna Dosztányi
Prediction of protein disorder Zsuzsanna Dosztányi MTA-ELTE Momentum Bioinformatics Group Department of Biochemistry, Eotvos Lorand University, Budapest, Hungary dosztanyi@caeser.elte.hu IDPs Intrinsically
Reference genomes and common file formats
Reference genomes and common file formats Dóra Bihary MRC Cancer Unit, University of Cambridge CRUK Functional Genomics Workshop September 2017 Overview Reference genomes and GRC Fasta and FastQ (unaligned
The Ensembl Database. Dott.ssa Inga Prokopenko. Corso di Genomica
The Ensembl Database Dott.ssa Inga Prokopenko Corso di Genomica 1 www.ensembl.org Lecture 7.1 2 What is Ensembl? Public annotation of mammalian and other genomes Open source software Relational database
Annotation Walkthrough Workshop BIO 173/273 Genomics and Bioinformatics Spring 2013 Developed by Justin R. DiAngelo at Hofstra University
Annotation Walkthrough Workshop NAME: BIO 173/273 Genomics and Bioinformatics Spring 2013 Developed by Justin R. DiAngelo at Hofstra University A Simple Annotation Exercise Adapted from: Alexis Nagengast,
Introduction to EMBL-EBI.
Introduction to EMBL-EBI www.ebi.ac.uk What is EMBL-EBI? Part of EMBL Austria, Belgium, Croatia, Denmark, Finland, France, Germany, Greece, Iceland, Ireland, Israel, Italy, Luxembourg, the Netherlands,
Functional Annotation Scenario: The Structure-Function Linkage Database (SFLD) and Chimera
Functional Annotation Scenario: The Structure-Function Linkage Database (SFLD) and Chimera Demo for NIH site visit November 2011 Updated August 2014 (example results session mca-5models.py created February
TERTIARY MOTIF INTERACTIONS ON RNA STRUCTURE
1 TERTIARY MOTIF INTERACTIONS ON RNA STRUCTURE Bioinformatics Senior Project Wasay Hussain Spring 2009 Overview of RNA 2 The central Dogma of Molecular biology is DNA RNA Proteins The RNA (Ribonucleic
ENGR 213 Bioengineering Fundamentals April 25, A very coarse introduction to bioinformatics
A very coarse introduction to bioinformatics In this exercise, you will get a quick primer on how DNA is used to manufacture proteins. You will learn a little bit about how the building blocks of these
Introduction. CS482/682 Computational Techniques in Biological Sequence Analysis
Introduction CS482/682 Computational Techniques in Biological Sequence Analysis Outline Course logistics A few example problems Course staff Instructor: Bin Ma (DC 3345, http://www.cs.uwaterloo.ca/~binma)
Why learn sequence database searching? Searching Molecular Databases with BLAST
Why learn sequence database searching? Searching Molecular Databases with BLAST What have I cloned? Is this really!my gene"? Basic Local Alignment Search Tool How BLAST works Interpreting search results
Browser Exercises - I. Alignments and Comparative genomics
Browser Exercises - I Alignments and Comparative genomics 1. Navigating to the Genome Browser (GBrowse) Note: For this exercise use http://www.tritrypdb.org a. Navigate to the Genome Browser (GBrowse)
WHITE PAPER.
WHITE PAPER www.seavusprojectviewer.com White Paper Product Overview Seavus Project Viewer is a complete viewer for Microsoft Project files that facilitates excellent cooperation in projects where the
DNAFSMiner: A Web-Based Software Toolbox to Recognize Two Types of Functional Sites in DNA Sequences
DNAFSMiner: A Web-Based Software Toolbox to Recognize Two Types of Functional Sites in DNA Sequences Huiqing Liu Hao Han Jinyan Li Limsoon Wong Institute for Infocomm Research, 21 Heng Mui Keng Terrace,
Designing TaqMan MGB Probe and Primer Sets for Gene Expression Using Primer Express Software Version 2.0
Designing TaqMan MGB Probe and Primer Sets for Gene Expression Using Primer Express Software Version 2.0 Overview This tutorial details how a TaqMan MGB Probe can be designed over a specific region of
Using the Genome Browser: A Practical Guide. Travis Saari
Using the Genome Browser: A Practical Guide Travis Saari What is it for? Problem: Bioinformatics programs produce an overwhelming amount of data Difficult to understand anything from the raw data Data
BIOINFORMATICS Introduction
BIOINFORMATICS Introduction Mark Gerstein, Yale University bioinfo.mbb.yale.edu/mbb452a 1 (c) Mark Gerstein, 1999, Yale, bioinfo.mbb.yale.edu What is Bioinformatics? (Molecular) Bio -informatics One idea
Overview of the next two hours...
Overview of the next two hours... Before tea Session 1, Browser: Introduction Ensembl Plants and plant variation data Hands-on Variation in the Ensembl browser Displaying your data in Ensembl After tea
Ab Initio SERVER PROTOTYPE FOR PREDICTION OF PHOSPHORYLATION SITES IN PROTEINS*
COMPUTATIONAL METHODS IN SCIENCE AND TECHNOLOGY 9(1-2) 93-100 (2003/2004) Ab Initio SERVER PROTOTYPE FOR PREDICTION OF PHOSPHORYLATION SITES IN PROTEINS* DARIUSZ PLEWCZYNSKI AND LESZEK RYCHLEWSKI BiolnfoBank
Big picture and history
Big picture and history (and Computational Biology) CS-5700 / BIO-5323 Outline 1 2 3 4 Outline 1 2 3 4 First to be databased were proteins The development of protein- s (Sanger and Tuppy 1951) led to the
PRESENTING SEQUENCES 5 GAATGCGGCTTAGACTGGTACGATGGAAC 3 3 CTTACGCCGAATCTGACCATGCTACCTTG 5
Molecular Biology-2017 1 PRESENTING SEQUENCES As you know, sequences may either be double stranded or single stranded and have a polarity described as 5 and 3. The 5 end always contains a free phosphate
BIO4342 Lab Exercise: Detecting and Interpreting Genetic Homology
BIO4342 Lab Exercise: Detecting and Interpreting Genetic Homology Jeremy Buhler March 15, 2004 In this lab, we ll annotate an interesting piece of the D. melanogaster genome. Along the way, you ll get
Outline. Evolution. Adaptive convergence. Common similarity problems. Chapter 7: Similarity searches on sequence databases
Chapter 7: Similarity searches on sequence databases All science is either physics or stamp collection. Ernest Rutherford Outline Why is similarity important BLAST Protein and DNA Interpreting BLAST Individualizing
BIOINFORMATICS IN BIOCHEMISTRY
BIOINFORMATICS IN BIOCHEMISTRY Bioinformatics a field at the interface of molecular biology, computer science, and mathematics Bioinformatics focuses on the analysis of molecular sequences (DNA, RNA, and
DNA and the Production of Proteins Course Notes. Cell Biology. Sub-Topic 1.3 DNA and the Production of Proteins
Cell Biology Sub-Topic 1.3 DNA and the Production of Proteins On completion of this subtopic I will be able to state that: Chromosomes contain genetic information that gives rise to an organism s characteristics.
TASKE Reports TASKE Call Center Management Tools Version 7.0. Table of Contents TASKE REPORTS... 2 THE TASKE REPORTS INTERFACE...
Table of Contents TASKE REPORTS... 2 THE TASKE REPORTS INTERFACE... 5 Overview of the Reports Window...5 Main Control panel... 6 Report Templates panel... 6 Publication Viewer panel... 7 REPORT TEMPLATE
The University of California, Santa Cruz (UCSC) Genome Browser
The University of California, Santa Cruz (UCSC) Genome Browser There are hundreds of available userselected tracks in categories such as mapping and sequencing, phenotype and disease associations, genes,
Why Use BLAST? David Form - August 15,
Wolbachia Workshop 2017 Bioinformatics BLAST Basic Local Alignment Search Tool Finding Model Organisms for Study of Disease Can yeast be used as a model organism to study cystic fibrosis? BLAST Why Use
Bionano Access Software User Guide
Bionano Access Software User Guide Document Number: 30142 Document Revision: C For Research Use Only. Not for use in diagnostic procedures. Copyright 2018 Bionano Genomics, Inc. All Rights Reserved. Table
Finding Regularity in Protein Secondary Structures using a Cluster-based Genetic Algorithm
Finding Regularity in Protein Secondary Structures using a Cluster-based Genetic Algorithm Yen-Wei Chu 1,3, Chuen-Tsai Sun 3, Chung-Yuan Huang 2,3 1) Department of Information Management 2) Department
Sanger vs Next-Gen Sequencing
Tools and Algorithms in Bioinformatics GCBA815/MCGB815/BMI815, Fall 2017 Week-8: Next-Gen Sequencing RNA-seq Data Analysis Babu Guda, Ph.D. Professor, Genetics, Cell Biology & Anatomy Director, Bioinformatics
CMPS 6630: Introduction to Computational Biology and Bioinformatics. Secondary Structure Prediction
CMPS 6630: Introduction to Computational Biology and Bioinformatics Secondary Structure Prediction Secondary Structure Annotation Given a macromolecular structure Identify the regions of secondary structure
Browsing Genes and Genomes with Ensembl
Browsing Genes and Genomes with Ensembl Emily Perry Ensembl Outreach Project Leader EMBL-EBI Objectives What is Ensembl? What type of data can you get in Ensembl? How to navigate the Ensembl browser website.