Fingerprinting of Cotton (Gossypium Spp.) Hybrids

Transcription

1 Fingerprinting of Cotton (Gossypium Spp.) Hybrids 7 and their Parental Lines Using Microsatellite Markers and their Utilization in Genetic Purity Assessment Rao P S *1, Aruna P 2, Anuradha G 3, Keshavulu K Institute of Biotechnology, Acharya NG Ranga Agricultural University, Hyderabad India sampalrao@gmail.com Abstract-Microsatellite markers are used for fingerprinting of cotton hybrids in order to assess variation within parental lines. Sixteen microsatellite markers were employed to fingerprint to six hybrids and their parental lines. Five SSR markers were found to be polymorphic across the hybrids and to produce unique fingerprints for each of the six hybrids. These highly informative primers not only differentiated the parent genotypes, but also confirmed the parentage of the true hybrids. The microsatellite marker, BNL 3449 amplified alleles specific to different parental lines of NSPHH 5; likewise, BNL 3255 primer for NDLHH 240 and WGHH 2, JESPR 148 primer for LAHH 4, BNL1317 for CSH 198 and BNL 3090 for CICR 2. Results indicate that SSR procedures are excellent genomic tools for parentage confirmation and hybridity determination, and may also enhance efficiency of breeding programmes. Keywords- Hybrid Cotton; Ssrs; DNA Fingerprinting; Genetic Purity I. INTRODUCTION Cotton is an important commercial crop of India, which plays a key role in the national economy. India ranks second in cotton production (22% of global production) with an average productivity of 526 kgha-1. Varietal identification has great significance from seed production and breeding as well as the perspective embraced by intellectual property rights to ensure quality seed [1]. For the improvement of agronomically and economically important traits, plant breeding generally recombines traits present in different parental lines of cultivated and wild species. Conventional breeding programmes involve the screening of phenotypes of pooled or individual plants for the presence of desirable traits, which is achieved by a process of repeated back crossing, selfing and testing. The use of molecular markers has facilitated these breeding processes, since it can provide a means to detect and resolve complications and accelerate the generation of new varieties, as well as allow the association of phenotypic traits with genomic loci [2]. Moreover, the molecular markers also increase the standards of DUS testing [3]. DNA fingerprinting is an important tool for the characterization of germplasm and the identity determination of varieties/hybrids/parental lines in plant breeding and germplasm management [4]. In order to protect proprietary germplasm, molecular markers have played an important role in securing plant variety rights by virtue of their unique efficiency in distinguishing even closely related germplasm accessions. Several PCR- based markers have been developed in last two decades. SSR markers are potentially powerful for DNA fingerprinting and have widespread applications in plant genome analysis [5]. Microsatellite markers have been used for DNA fingerprinting by several researchers [6]. II. MATERIAL AND METHODS The studies pertaining to DNA fingerprinting for the identification of cotton hybrids using SSR marker system were conducted at the Institute of Biotechnology, ANGRAU, Hyderabad. The plant material for this study comprised of six hybrids and their female and male parents: CSH 198 (CSH 19 CSH 8), CICR 2 (DS 5 LD 327) obtained from CICR, Nagpur; NSPHH 5 (NA 1325 L604) and LAHH 4 (AB 6 M 2) obtained from Lam, Guntur; NDLHH 240 (NA 1325 MCU 5) obtained from RARS, Nandyal; and WGHH 2 (NA1678 NA 40845) obtained from RARS, Warangal. Fresh young leaves from all plants were collected for DNA extraction

2 A. Plant Material B. SSR Analysis S. No. Hybrid Parentage Source Remarks Female Male 1. CSHH 198 CSH 19 CSH 8 CICR, Nagpur Intraspecific hybrid - Intra-hirsutum 2. CICR 2 DS 5 LD 327 CICR, Nagpur Intraspecific hybrid - Intra-hirsutum 3. NSPHH 5 NA 1325 L 604 Lam, Guntur Intra-hirsutum 4. LAHH 4 AB 6 M 2 Lam, Guntur Intra-hirsutum 5. NDLHH 240 NA 1325 MCU 5 RARS, Nandyal Intra-hirsutum 6. WGHH 2 NA1678 NA RARS, Warangal Intra-hirsutum DNA was isolated according to the procedure adopted by Sharma, et al., [7]. DNA from the bulk of leaf samples of ten individual plants was used for fingerprinting. Quantification of DNA was accomplished by analyzing the DNA on 0.8% agarose gel using diluted uncut lambda DNA as a standard. A total of 16 SSR markers were used to identify polymorphic markers among the parents. From the 16 markers that were found to be polymorphic, five markers were selected to test the hybridity of cotton (Table 1), since they produced clear, scorable and unambiguous polymorphic bands among the parents. PCR analysis was performed using 16 SSR primers. SSR amplification was conducted in 27μl reaction volumes containing 10x PCR buffer, 2.5 mm dntps, 1.5μl random primer and 0.2 unit of Taq DNA polymerase (Bangalore Genie Pvt. Ltd., Bangalore, India). PCR amplification was conducted in a thermal cycler. and the reaction was set as the initial denaturation of the template DNA at 94 C for 5 minutes, while the final denaturation was conducted at 94 c for 1 minute, primer annealing was conducted at C for 1 minute and elongation was conducted at 72 C for 45 seconds and final elongation was conducted at 72 C for 10 minutes. PCR products were separated on 3% Metaphor TM agarose gel using 0.5 TBE buffer. The sizes of the amplified fragments were determined by using size standards (50 bp DNA ladder). DNA fragments were visualized under UV light and photographed using the Bio-Rad photographic gel documentation system. TABLE 1 DESCRIPTION OF POLYMORPHIC SSR MARKERS SSR name Repeat motif Forward primer sequence (5-3 ) Reverse primer sequence (5-3 ) BNL1317 (AG )14 AAAAATCAGCCAAATTGGGA CGTCAACAATTGTCCCAAGA BNL3255 (GC)6AT(AC)14 GACAGTCAAACAGAACAGATATGC TTACACGACTTGTTCCCACG BNL3090 (AG)31 GAAATCATTGGAAGAACATATACTACA TTGCTCCGTATTTTCCAGCT BNL3449 (CA)12, (CT)6TA(CA)12 AAGCTGTGGCTATGATGCCT AGAGCAAAAAACAATTACAAAAGC JESPR148 (CTT)11 GCTTCTCTTGCTTAGATCTGG GTCGCTTTGTAAGTGAATGA III. RESULTS AND DISCUSSION The six cotton hybrids and their parental lines were analyzed for microsatellite polymorphisms. The parental polymorphism survey identified five informative markers (BNL 3449, BNL 3255, JESPR 148, BNL 1317 and BNL 3090), which were used to fingerprint the hybrids. The five markers collectively amplified a unique fingerprint for all hybrids and therefore, were effective in distinguishing them from one another (Fig. 1). Fig. 2 depicts gel pictures demonstrating amplifications in the parents and hybrids. The parents and the hybrid plants were carefully observed on the basis of morphology to determine if they were true hybrids. The polymorphisms observed between the parents aware used as markers for hybrid identification. Comparing the SSR banding pattern of parents with respective hybrids, genuine hybrids were confirmed (Fig. 2, a-f). The BNL 3449 primer demonstrated an amplified allele of size 120 bp in the male parent (L 604) and the hybrid (NSPHH 5). Alternatively, the female parent (NA 1325) had an amplicon of 130 bp. However, hybrid (NSPHH 5) exhibited the alleles of both parents, confirming the heterozygosity of the hybrid with the presence of two bands at 120 and 130 bp. (Fig. 2a). Among the six hybrids studied, two hybrids (NDLHH 240 and WGHH 2) could develop different allele sizes with a single SSR primer, BNL3255 (Figs. 2b and 2c). This primer amplified a specific allele size (120 bp) in the female, NA 1325, and 140 bp allele size in the male (MCU 5; as well as the presence of both alleles in the hybrid, NDLHH 240, whereas in hybrid (WGHH 2) it amplified both the alleles of the 127 bp female specific allele (NA 1678) and 145 bp male specific allele (NA 4084)

3 Hybrid H 1 H 2 H 3 H 4 H 5 H 6 PRIMER NDLHH 240 LAHH 4 CICR 2 NSPHH 5 WGHH 2 CSH 198 BNL 3255 JESPR148 BNL 3090 BNL 3449 BNL 1317 F M F M F M F M F M F M Fig. 1 Schematic representation of microsatellite DNA profiling for hybrids and their parents. Each column (H) corresponds to a hybrid (above) and consists of two sub-columns, F and M lines. Each row shows the allelic pattern of each SSR marker in six hybrids. The shaded blocks correspond to the presence of different alleles in the respective marker. H1: NA 1325/ MCU5 H2: AB 6/ M 2 H3: NA1325/ L 604 H4: NA 1678/ NA bp 120 bp (a) 140 bp 120 bp (b) 145 bp 127 bp (c) 250 bp 247 bp 235 bp (d) 210 bp 200 bp 185 bp (e)

4 140 bp 110 bp (f) Fig. 2 SSR amplifications of the NSPHH 5 (NA 1325 L604), NDLHH 240 (NA 1325 MCU 5) WGHH 2 (NA1678 NA ), LAHH 4 (AB 6 M 2), CSH 198 (CSH 19 CSH 8), CICR 2(DS 5 LD 327 by the BNL (a) BNL 3255; (b) BNL 3255; (c) JESPR 148; (2d) BNL 1317 and (2e) and BNL 3090 (2f). The sequence of lanes is female, hybrid and male in four replications Similarly, hybrid LAHH 4 was identified and distinguished by the JESPR 148 SSR marker, as shown in Fig. 2(d). The hybrid demonstrated the complementary banding pattern of both parents. The marker had an amplicon of 235 bp in its female parent (AB 6); the same marker had a different amplicon of size 247 bp in male parent (M 2); the hybrid showed both the amplicons at 235 and 247 bp. Thus, it confirmed the genuine nature of the hybrid. The primer BNL 1317 amplified a specific allele size of 210 bp in the hybrid (CSH 198) and male parent (CSH 8), but not in its female parent (CSH 19). However, the BNL 1317 amplified a different allele of size 185 bp in the female parent. The same allele size of 185 bp was expressed in the hybrid, but not in its male parent (CSH 8). Thus, results confirmed that the allele of size 210 bp was very specific to the male parent of CSH 198 and, therefore, the presence of both female and male parent alleles indicated the result of crossing between two parents (hybrid). The observed banding pattern, as shown in Fig. 2(e), was highly specific to hybrid CSH 198 and was not observed in any other hybrids included in this study. The primer BNL 3090 amplified an allele of size 110 bp in thsfemale parent (DS 5). Alternatively, the male parent (LD 327) demonstrated an amplicon at 140 bp. However, hybrid (CICR 2) exhibited the alleles of both parents, confirming the heterozygosity of the hybrid by possessing two bands at 110 and 140 bp, as shown in Fig. 2(f). This SSR primer can safely be employed for testing hybrid seed purity of CICR 2. The SSR markers have the advantage of co-dominance inheritance, easy scoring of alleles, reproducibility and accessibility to laboratories [4]. These polymorphic markers produce unique banding patterns, due to the presence of female and male specific alleles in the hybrids results incurred during purity determination [9, 10] in rice and [11, 12] in cotton. The successful identification of a true hybrid can be established using a morphological basis at maturity. It is necessary to select true hybrids in order to establish a breeding program, but it is difficult to determine before flowering and the formation of the. By using the SSR technique, it is easier to identify true hybrids at early stages. This technique can be adopted for the large scale screening of hybrids in cotton. A set of five markers (BNL 1317, BNL 3090, BNL 3255, BNL 3449 and JESPR 148) differentiated all hybrids from one another, which can be used as referral markers for unambiguous identification and protection of these hybrids. Assessment of seed purity is one of the most important quality control components in hybrid seed production. Traditionally, GOT has been employed to assess the purity of hybrid seeds using morphological traits. Traits such as petal colour, petal spot, anther colour, boll shape, and leaf colour were studied to distinguish among hybrids. Although GOT is used to determine the genetic purity of cotton hybrids, it is tedious, space-demanding and time-consuming, and often does not allow the unequivocal identification of genotypes. Hence, a recent development in molecular markers has been suggested for genetic purity testing, since they are used to precisely assess the genotype, and not the phenotype [13]. Among different types of molecular markers, SSR markers have been reported as useful for testing genetic purity, since they are co-dominant. Additionally, using SSR, the heterozygous state can be easily discerned from the homozygous state. IV. CONCLUSIONS It is concluded from this study that it is possible to differentiate cotton hybrids more accurately and efficiently from their parental lines using molecular markers. These molecular markers are more efficient than GOT, since DNA markers are more accurate for determining hybrid seed purity. Furthermore, marker analysis will also result in considerable savings for the seed industry, as this technique may avoid the cost of storage for an entire season and the cost of acquiring land and cultivation. ACKNOWLEDGEMENTS Authors would like to thank ANGRAU for providing grants, Agricultural Research Stations of ANGRAU, Andhra Pradesh and Central Institute for Cotton Research, Nagpur, India for providing seed material

5 REFERENCES [1] P.S. Rao, M. Bharathi, K. Bayyapu Reddy, K. Keshavulu, L.V. Subbarao, and C.N. Neeraja, Varietal identification in rice through chemical tests and gel electrophoresis of soluble seed proteins, Indian Journal of Agricultural Sciences, vol. 82(4), pp , [2] C. Sunny Jiang, Maria Matte, Glavur Matte, Anwar Huq, and Rita r. Colwell, Genetic Diversity of Clinical and Environmental Isolates of Vibrio cholerae Determined by Amplified Fragment Length Polymorphism Fingerprinting, Applied And Environmental Microbiology, vol. 66 (1), pp , [3] S.K. Shukla, D.C. Joshi, R.K. Srivastava, M.I. Qureshi, and U.S. Singh, Suitability of RAPD and ISSR to complement agromorphological DUS descriptors for establishing distinctiveness in indigenous local strains of Kalanamak rice (Oryza sativa), Indian Journal of Agricultural Sciences, vol. 81 (11), pp , [4] N.W. Vijay, S.R. Sutar, P.B. Thakre, D.R. Sapkal, R.V. Salame, A.M. Badole, and B.R. Patil, Comparative assessment of microsatellite and RAPD markers and their efficiency in DNA fingerprinting of upland cotton (Gossypium hirsutum), Indian Journal of Agricultural Sciences, vol. 81 (12), pp , [5] M. Morgante, and A.M. Olivieri, PCR-amplified microsatellite as markers in plant genetics, Plant J., vol. 3, pp , [6] A. Belaj, Z. Satovic, G. Cipriani, L. Baldoni, R. Testolin, L. Rallo, and I. Trujillo, Comparative study of the discriminating capacity of RAPD, AFLP and SSR markers and of their effectiveness in establishing genetic relationships in olive, Theoretical and Applied Genetics, vol. 107(4), pp , [7] A.D. Sharma, P.K. Gill, and P. Singh DNA isolation from dry and fresh samples of polysaccharide rich plants, Plant Molecular Biology Reporter, vol. 20, pp. 415, [8] N. Paniego, M. Echaide, M. Munoz, L. Fernandez, S. Torales, P. Faccio, I. Fuxan, M. Carrera, R. Zandomeni, E.Y. Suarez, and H. Esteban Hopp, Microsatellite isolation and characterization in sunflower (Helianthus annuus L.), Genome, vol. 45, pp , [9] N. Nandakumar, A.K. Singh, R.K. Sharma, T. Mohapatra, K.V. Prabhu, and F.U. Zaman, (2004), Molecular fingerprinting of hybrids and assessment of genetic purity of hybrid seeds in rice using microsatellite markers, Euphytica, vol. 136, pp , [10] T.P. Kumar, R. Jerlin, N. Senthil, K.N. Ganesan, R.J. Jeevan, and M. Raveendran, Fingerprinting of rice hybrids and their parental lines using microsatellite markers and their utilization in genetic purity assessment of hybrid rice, Research Journal of Seed Science, vol. 2, pp , [11] J.F. Zhang, Y. Lu, R.G. Cantrell, and E. Hughs, Molecular marker diversity and field performance in commercial cotton cultivars evaluated in the southwestern USA, Crop Science, vol. 45 (4), pp , [12] P. Selvakumar, R. Ravikesavan, A. Gopikrishnan, K. Thiyagu, S. Preetha, and Manikanda Boopathi, Genetic purity analysis of cotton (Gossypium spp.) hybrids using SSR makers, Seed Science and Technology, vol. 38, pp , [13] R.M. Sundaram, B. Naveenkumar, S.K. Biradar, S.M. Balachandran, B. Mishra, M. IlyasAhmed, B.C. Viraktamath, M.S. Ramesha, and S.P. Sarma, Identification of informative SSR markers capable of distinguishing hybrid rice parental lines and their utilization in seed purity assessment, Euphytica, vol. 163, pp ,