New Technique for Differentiation Monitoring using Supernatant. Dojindo EU GmbH Takatoshi EZOE
|
|
|
- Gwenda Holland
- 5 years ago
- Views:
Transcription
1 New Technique for Differentiation Monitoring using Supernatant Dojindo EU GmbH Takatoshi EZOE Jun/26/2013 1
2 Culturing Process from ES/iPS to Organs ES / ips Cells Activin Endoderm Intestine Pancreas Liver Transplantation (in vivo) To aim for establishing gastrointestinal organs, ES/iPS cells need to be via Endoderm. Jun/26/2013 2
3 ES/iPS cell Differentiation Generally used Confirmation Methods for Differentiation Monitoring 1) Monitoring of specific RNA PCR (Sox 17, Foxa2) 2) Monitoring of specific Protein Immunostaining (Sox17, Foxa2) 3) Monitoring of Cell Surface specific Antigens FACS(E-Cadherin, CXCR4 ) ES / ips Cells Sox17; Sry-box-containing gene 17 Foxa2; forkhead box protein A2(HNF-3B) E-Cadherin; epithelial cadherin CXCR4;C-X-C chemokine receptor type 4 Jun/26/2013 3
4 Present Situation of Endoderm Differentiation Differentiation efficiency varies (especially in human origin samples) Depends on several factors (Cell line, culture plate, or handling skills) Very expensive inducer is required for differentiation (experiments must not fail) Differentiation takes a lot of time (30 days for liver and pancreas rentiations) Is my Cell Differentiation going well? No! Use cells to check Yes! Make another try quickly (to reduce time and costs) Proceed to the next step If cells are NOT used for differentiation monitoring Merits Differentiation can be done very efficiently. Able to save time and money. Jun/26/2013 4
5 Cerberus1, as a New Maker for Endoderm Differentiation Cerberus1(Cer1) is a secreted protein which belongs to the cysteine knot superfamily and includes TGF(transforming growth factor) βs and BMPs (bone morphogenetic proteins). Murine Cer1 is one of the genes that was up-regulated greater than 5-fold in both E-Cadherin+/CXCR4+ DE (definitive endoderm). Jun/26/2013 5
6 Cerberus1 ELISA -Dojindo New Technology- Conventional methods Cells are required to monitor differentiation Cerberus 1 ELISA Only supernatant is required to monitor differentiation Cells Supernatant (Cerberus 1 comes out in supernatant) 2D Cell-Culture Comparison of Monitoring way for Differentiation Sample Sustained cell culture Time for assay RT-PCR Cells Impossible > 7 hours Immunostaining Cells Impossible 1-2day(s) FACS Cells Impossible > 4 hours Cerberus1(ELISA) Supernatants Possible 3 hours Endoderm differentiation monitoring can be performed by measuring the amount of secreted protein, Cerberus1 without using cells. Jun/26/2013 6
7 Comparison -Conventional vs. New Technology- Conventional Methods Cells are harvested from only one well. Cells in other five wells are used in the next steps. Are differentiated stats same in all wells? RNA/Protein analysis Actually, not. we have different endoderm differentiation situation in each well. Also, experimenter and cell line might be a factor of variations. Supernatant in each well can be used for ELISA assay Cerberus 1 Use supernatant as a sample. Differentiation status can be monitored in each well. Cells are able to culture continuously. NO damages to the cells Jun/26/2013 7
8 D1 D2 D3 D4 D5 D6 D7 D8 ES Endoderm (+Act&bFGF) Mesoderm (+BMP7) Ectoderm (+SB431542) Relative Gene Expression Could Cerberus1 be a new marker for differentiation? (RT-PCR) Sample: Murine ES cells 4 3 Cerberus Cer 1 Sox 17 Foxa2 Flk 1 Zic 1 b -actin Sox17 D0 (ES) Day of Differentiation Analysis of PCR Jun/26/2013 8
9 Could Cerberus1 be a new marker for differentiation? (Immunocytochemical analysis ) Sample: Murine ES cells D7 Sox17 Merged D7 mcer1 Merged DAPI/Cer1 Jun/26/2013 9
10 FCM (%): Cxcr4+ / ECD+ Could Cerberus1 be a new marker for differentiation? (Flow cytometry analysis ) Sample: Murine ES cells Media exchange : Act 10 (ng/ml) bfgf 5 (ng/ml) D Analysis (D7) D7 E-Cadherin CXCR Cont A10/b Secreted Cerberus 1 (ng/ml) Jun/26/
11 Could Cerberus1 be a new marker for differentiation? Cell line: Human ips cell (253G1) Media Exchange : D D1 D2 D3 D4 D5 0 D1 D2 D3 D4 D5 Jun/26/
12 Summary Cerberus1 can be a new maker for monitoring endoderm differentiation. Cerberus1 ELISA assay allow us to perform quicker assay for quantification of ES/iPS cell differentiation without dissociation of the cells. Cerberus1 ELISA assay could also be a good system to optimize the conditions of endoderm differentiation. H. Iwashita and N. Shiraki et al., PLoS ONE 8(5): e64291, 2013 Secreted Cerbuerus1 as a marker for quantification of definitive endoderm differentiation of the pluripotent stem cells Jun/26/
13 Ich danke Ihnen sehr für Ihre Aufmerksamkeit! URL Tel +49 (0) Jun/26/
Supplementary Figure 1. Soft fibrin gels promote growth and organized mesodermal differentiation. Representative images of single OGTR1 ESCs cultured
Supplementary Figure 1. Soft fibrin gels promote growth and organized mesodermal differentiation. Representative images of single OGTR1 ESCs cultured in 90-Pa 3D fibrin gels for 5 days in the presence
Guided differentiation of ES cell into mesenchymal stem cell
Guided differentiation of ES cell into mesenchymal stem cell Takumi Era Division of Molecular Neurobiology Institute of Molecular Embryology and Genetics, Kumamoto University Differentiation pathways of
Supplementary Data. Supplementary Methods Three-step protocol for spontaneous differentiation of mouse induced pluripotent stem (embryonic stem) cells
Supplementary Data Supplementary Methods Three-step protocol for spontaneous differentiation of mouse induced pluripotent stem (embryonic stem) cells Mouse induced pluripotent stem cells (ipscs) were cultured
Sundari Chetty, Felicia Walton Pagliuca, Christian Honore, Anastasie Kweudjeu, Alireza Rezania, and Douglas A. Melton
A simple tool to improve pluripotent stem cell differentiation Sundari Chetty, Felicia Walton Pagliuca, Christian Honore, Anastasie Kweudjeu, Alireza Rezania, and Douglas A. Melton Supplementary Information
Disease Clinical features Genotype
Disease Clinical features Genotype Alpha 1 Antitrypsin deficiency (A1ATD) Patient 1 65 year old caucasian male, liver transplant recipient, explant biopsy confirmed A1ATD induced liver cirrhosis Patient
Xeno-Free Systems for hesc & hipsc. Facilitating the shift from Stem Cell Research to Clinical Applications
Xeno-Free Systems for hesc & hipsc Facilitating the shift from Stem Cell Research to Clinical Applications NutriStem Defined, xeno-free (XF), serum-free media (SFM) specially formulated for growth and
T-iPSC. Gra-iPSC. B-iPSC. TTF-iPSC. Supplementary Figure 1. Nature Biotechnology: doi: /nbt.1667
a T-iPSC Gra-iPSC B-iPSC TTF-iPSC Ectoderm Endoderm Mesoderm b Nature Biotechnology: doi:.38/nbt.667 Supplementary Figure Klf4 transgene expression Oct4 transgene expression.7 Fold GAPDH.6.5.4.3 Fold GAPDH
produced in this study characterized using 3-8 % gradient SDS-PAGE under reducing
Supplementary Figure 1 Characterisation of newly produced laminins. Human recombinant LN-521 produced in this study characterized using 3-8 % gradient SDS-PAGE under reducing 1 and non-reducing conditions.
Directed differentiation of human embryonic stem cells
Directed differentiation of human embryonic stem cells TECAN Symposium 2008 Biologics - From Benchtop to Production Wednesday 17 September 2008 Andrew Elefanty Embryonic Stem Cell Differentiation Laboratory,
Supplementary Figure 1.
Supplementary Figure 1. Quantification of western blot analysis of fibroblasts (related to Figure 1) (A-F) Quantification of western blot analysis for control and IR-Mut fibroblasts. Data are expressed
Gene name forward primer 5->3 reverse primer 5->3 product GCCCATA. Nfatc1 AGGTGCAGCCCAAGTCTCAC GTGGCCATCTGGAGCCTTC CTGT GATGC GCT ACCAA
Supplementary able 1 is presenting the PCR primer list used. ene name forward primer 5->3 reverse primer 5->3 product size cdna VE-Cadherin AACCCAAAAA CACCCCAAAAC 260bp CCA CCCAA PECAM-1 CACCACAA CCCCCACC
Supplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1. Functional assays of hepatocyte-like cells induced from H1 hescs (a) P450 and AAT staining, PAS staining, LDL uptake assay, and ICG uptake and release assay
Contribution and Mobilization of Mesenchymal Stem Cells in a mouse model of carbon tetrachloride-induced liver fibrosis
Contribution and Mobilization of Mesenchymal Stem Cells in a mouse model of carbon tetrachloride-induced liver fibrosis Yan Liu 1,*, Zhipeng Han 1,*, Yingying Jing 1,*, Xue Yang 1, Shanshan Zhang 1, Chen
A cost-effective system for differentiation of intestinal epithelium from human induced pluripotent stem cells
A cost-effective system for differentiation of intestinal epithelium from human induced pluripotent stem cells Soichiro Ogaki 1, 2, 3, 4, 5, *, ayu orooka 1,*, Kaito Otera 1, 1, 3 and Shoen Kume Supplementary
Neural Development. How does a single cell make a brain??? How are different brain regions specified??? Neural Development
Neural Development How does a single cell make a brain??? How are different brain regions specified??? 1 Neural Development How do cells become neurons? Environmental factors Positional cues Genetic factors
HUMAN EMBRYONIC STEM CELL (hesc) ASSESSMENT BY REAL-TIME POLYMERASE CHAIN REACTION (PCR)
HUMAN EMBRYONIC STEM CELL (hesc) ASSESSMENT BY REAL-TIME POLYMERASE CHAIN REACTION (PCR) OBJECTIVE: is performed to analyze gene expression of human Embryonic Stem Cells (hescs) in culture. Real-Time PCR
First xeno-free serum replacement for pluripotent stem cells
Stem Cell Research First xeno-free serum replacement for pluripotent stem cells KnockOut SR XenoFree Stem Cell Research New, xeno-free growth and expansion of hescs and human ipscs KnockOut SR XenoFree
Scaffolding for human pluripotent stem cell lineage specification
University of Arkansas, Fayetteville ScholarWorks@UARK Biological and Agricultural Engineering Undergraduate Honors Theses Biological and Agricultural Engineering 5-2013 Scaffolding for human pluripotent
Supplementary Data. Supplementary Table S1.
Supplementary Data Supplementary Table S1. Primer Sequences for Real-Time Reverse Transcription-Polymerase Chain Reaction Gene Forward 5?3 Reverse 3?5 Housekeeping gene 36B4 TCCAGGCTTTGGGCATCA CTTTATCAGCTGCACATCACTCAGA
(51) Int Cl.: C12N 5/07 ( )
(19) TEPZZ _Z49 B_T (11) EP 2 3 492 B1 (12) EUROPEAN PATENT SPECIFICATION (4) Date of publication and mention of the grant of the patent: 22.07.1 Bulletin 1/ (21) Application number: 09774297.7 (22) Date
A Novel Platform to Enable the High-Throughput Derivation and Characterization of Feeder-Free Human ipscs
Supplementary Information A Novel Platform to Enable the High-Throughput Derivation and Characterization of Feeder-Free Human ipscs Bahram Valamehr, Ramzey Abujarour, Megan Robinson, Thuy Le, David Robbins,
Directed Differentiation of Human Induced Pluripotent Stem Cells. into Fallopian Tube Epithelium
Directed Differentiation of Human Induced Pluripotent Stem Cells into Fallopian Tube Epithelium Nur Yucer 1,2, Marie Holzapfel 2, Tilley Jenkins Vogel 2, Lindsay Lenaeus 1, Loren Ornelas 1, Anna Laury
ADVANCED MEDIA TECHNOLOGY
ADVANCED MEDIA TECHNOLOGY For Human ES and ips Cell Research The right medium makes all the difference in ensuring successful ES and ips cell culture. Stemgent offers high-quality, chemically-defined,
ANNOUNCEMENTS. HW2 is due Thursday 2/4 by 12:00 pm. Office hours: Monday 12:50 1:20 (ECCH 134)
ANNOUNCEMENTS HW2 is due Thursday 2/4 by 12:00 pm. Office hours: Monday 12:50 1:20 (ECCH 134) Lectures 6 8 Outline Stem Cell Division - symmetric - asymmetric Stem cell lineage potential - pluripotent
INTESTINAL ORGANOIDS. IntestiCult and STEMdiff Media for Intestinal Organoid Culture. Scientists Helping Scientists
INTESTINAL ORGANOIDS IntestiCult and STEMdiff Media for Intestinal Organoid Culture Scientists Helping Scientists WWW.STEMCELL.COM CULTURING INTESTINAL ORGANOIDS TABLE OF CONTENTS 3 Introduction 4 IntestiCult
hpsc Growth Medium DXF Dr. Lorna Whyte
hpsc Growth Medium DXF Dr. Lorna Whyte 27.06.2014 Training from Heidelberg Overview Background: Stem Cells Introduction: Human Pluripotent Stem Cells (hpsc) vs. Adult Stem Cells Promise of PSC Research
Supplementary Figures
Supplementary Figures Supplementary Figure 1. Effect of timing of DE dissociation and RA concentration on lung field specification in hpscs. (a) Effect of duration of endoderm induction on expression of
In vivo tumorigenicity testing for pluripotent stem cell-derived products
Cell and Gene Therapy Catapult and HESI CT-TRACS Workshop @ London 14 February 2018 In vivo tumorigenicity testing for pluripotent stem cell-derived products FIRM-CoNCEPT-MEASURE STEP2 In Vivo Tumorigenicity
Supplementary Figure 1. Reconstitution of human-acquired lymphoid system in
Supplementary Figure 1. Reconstitution of human-acquired lymphoid system in mouse NOD/SCID/Jak3 null mice were transplanted with human CD34 + hematopoietic stem cells. (Top) Four weeks after the transplantation
Microarrays and Stem Cells
Microarray Background Information Microarrays and Stem Cells Stem cells are the building blocks that allow the body to produce new cells and repair tissues. Scientists are actively investigating the potential
ABSTRACT INTRODUCTION Figure 1. METHODS ipsc culture ATCC No. Initial Cell Type Description Reprogramming Method Table 1.
THE ESSENTIALS OF LIFE SCIENCE RESEARCH GLOBALLY DELIVERED DIRECTED DIFFERENTIATION OF GASTROINTESTINAL EPITHELIAL ORGANOIDS USING ATCC CELLMATRIX BASEMENT MEMBRANE FROM MULTIPLE HUMAN ATCC ipsc LINES
Generation of Nkx2.1+ lung endoderm and Nkx2.1+Sox2+ proximal airway progenitors from human embryonic stem cells and ips cells
Generation of Nkx2.1+ lung endoderm and Nkx2.1+Sox2+ proximal airway progenitors from human embryonic stem cells and ips cells Hongmei Mou Rajagopal Lab March 2012 Step I: Protocol to induce definitive
Accelerating skin wound healing by M-CSF through generating SSEA-1 and -3 stem cells. in the injured sites
Accelerating skin wound healing by M-CSF through generating SSEA-1 and -3 stem cells in the injured sites Yunyuan Li, Reza Baradar Jalili, Aziz Ghahary Department of Surgery, University of British Columbia,
Electromagnetic Fields Mediate Efficient Cell Reprogramming Into a Pluripotent State
Electromagnetic Fields Mediate Efficient Cell Reprogramming Into a Pluripotent State Soonbong Baek, 1 Xiaoyuan Quan, 1 Soochan Kim, 2 Christopher Lengner, 3 Jung- Keug Park, 4 and Jongpil Kim 1* 1 Lab
Mesoderm Formation. Fate map of early gastrula. Only two types of mesoderm are induced. Mesoderm induction by the vegetal hemisphere
Fate map of early gastrula Mesoderm Formation Animal hemisphere forms ectoderm (lacks ) Sperm Entry Point dbl dbl brachyury Vegetal hemisphere forms endoderm (requires ) dbl goosecoid Marginal zone forms
Supplemental Information. Direct Reprogramming of Fibroblasts. via a Chemically Induced XEN-like State
Cell Stem Cell, Volume 21 Supplemental Information Direct Reprogramming of Fibroblasts via a Chemically Induced XEN-like State Xiang Li, Defang Liu, Yantao Ma, Xiaomin Du, Junzhan Jing, Lipeng Wang, Bingqing
Application Note. Laminin/Entactin Complex: A Feeder-Free Surface for Culture of Human Embryonic Stem Cells. Introduction
Laminin/Entactin Complex: A Feeder-Free Surface for Culture of Human Embryonic Stem Cells Deepa Saxena, Ph.D. and Susan Qian, Ph.D. Corning Incorporated, Tewksbury, MA, USA Application Note Contents 1
Harvesting pre-polarized macrophages using thermo-responsive substrates
Article Harvesting pre-polarized macrophages using thermo-responsive substrates Vera Malheiro, Yvonne Elbs-Glatz, Magdalena Obarzanek-Fojt, Katharina Maniura-Weber, Arie Bruinink Laboratory for Biointerfaces,
Supplementary information
Supplementary information Inhibition of mitochondrial dysfunction and neuronal cell death in models of Huntington s disease and in HD patients-derived cells Xing Guo 1,#, Marie-Helene Disatnik 3,#, Marie
REPROGRAMMING OF HUMAN STEM CELLS TO HEPATOCYTES FOR CLINICAL AND INDUSTRIAL APPLICATIONS. Eishani Kumar. Faculty Mentor: Dr.
Kumar 1 REPROGRAMMING OF HUMAN STEM CELLS TO HEPATOCYTES FOR CLINICAL AND INDUSTRIAL APPLICATIONS BY Eishani Kumar Faculty Mentor: Dr. Wei-Shou Hu Graduate Mentor: David Chau Department of Chemical Engineering
Supplementary Figure 1.
Supplementary Figure 1. (A) UCSC Genome Browser view of region immediately downstream of the NEUROG3 start codon. All candidate grna target sites which meet the G(N 19 )NGG constraint are aligned to illustrate
Chemically defined conditions for human ipsc derivation and culture
Nature Methods Chemically defined conditions for human ipsc derivation and culture Guokai Chen, Daniel R Gulbranson, Zhonggang Hou, Jennifer M Bolin, Victor Ruotti, Mitchell D Probasco, Kimberly Smuga-Otto,
GENESDEV/2007/ Supplementary Figure 1 Elkabetz et al.,
GENESDEV/2007/089581 Supplementary Figure 1 Elkabetz et al., GENESDEV/2007/089581 Supplementary Figure 2 Elkabetz et al., GENESDEV/2007/089581 Supplementary Figure 3 Elkabetz et al., GENESDEV/2007/089581
Supplementary Figure 1, related to Figure 1. GAS5 is highly expressed in the cytoplasm of hescs, and positively correlates with pluripotency.
Supplementary Figure 1, related to Figure 1. GAS5 is highly expressed in the cytoplasm of hescs, and positively correlates with pluripotency. (a) Transfection of different concentration of GAS5-overexpressing
SUPPLEMENTARY INFORMATION
doi:.8/nature85 Supplementary Methods Plasmid construction Murine RIG-I, HMGB and Rab5 cdnas were obtained by polymerase chain reaction with reverse transcription (RT-PCR) on total RNA from, and then cloned
SUPPLEMENTARY INFORMATION
a before amputation regeneration regenerated limb DERMIS SKELETON MUSCLE SCHWANN CELLS EPIDERMIS DERMIS SKELETON MUSCLE SCHWANN CELLS EPIDERMIS developmental origin: lateral plate mesoderm presomitic mesoderm
Neural Induction. Chapter One
Neural Induction Chapter One Fertilization Development of the Nervous System Cleavage (Blastula, Gastrula) Neuronal Induction- Neuroblast Formation Cell Migration Mesodermal Induction Lateral Inhibition
Human embryonic stem cells for in-vitro developmental toxicity testing
Human embryonic stem cells for in-vitro developmental toxicity testing HESI workshop on alternatives assays for developmental toxicity Raimund Strehl Cellartis The company Founded in early 2001, University
Flow cytometry Stained cells were analyzed and sorted by SORP FACS Aria (BD Biosciences).
Mice C57BL/6-Ly5.1 or -Ly5.2 congenic mice were used for LSK transduction and competitive repopulation assays. Animal care was in accordance with the guidelines of Keio University for animal and recombinant
hipscs were derived from human skin fibroblasts (CRL-2097) by ectopic
Generation and characterization of hipscs hipscs were derived from human skin fibroblasts (CRL-2097) by ectopic expression of OCT4, SOX2, KLF4, and C-MYC as previously described 1. hipscs showed typical
Day AP2a FOXG1 PAX6 SOX10 OCT4 OCT4 SIX6 PAX7 NES NES NES CD146 CD146 CD93 CD146 CD31 CD31. Flk1 CD34 CD34 CD34 CD34 CD34 CD43 CD43 DES
Endoderm Mesoderm Ectoderm OCT4 T CXCR4 FOXA2 SOX17 OCT4 CD34 CXCR4 FOXA2 AP2a SOX10 NES CD93 Flk1 CD34 CD43 DES TAL1 HNF4α C/EBPα FOXA2 AAT NES CD146 CD31 CD34 DES HNF4α C/EBPα LGR5 CK19 Fib AAT C/EBPα
Mouse ES and ips cells can form similar definitive endoderm despite differences in imprinted genes
Mouse ES and ips cells can form similar definitive endoderm despite differences in imprinted genes Constantina Christodoulou,, Gustavo Mostoslavsky, Darrell N. Kotton J Clin Invest. 2011;121(6):2313-2325.
Int. J. Mol. Sci. 2016, 17, 1259; doi: /ijms
S1 of S5 Supplementary Materials: Fibroblast-Derived Extracellular Matrix Induces Chondrogenic Differentiation in Human Adipose-Derived Mesenchymal Stromal/Stem Cells in Vitro Kevin Dzobo, Taegyn Turnley,
Supplementary Table-1: List of genes that were identically matched between the ST2 and
Supplementary data Supplementary Table-1: List of genes that were identically matched between the ST2 and ST3. Supplementary Table-2: List of genes that were differentially expressed in GD2 + cells compared
Application Note AN001
Testing hybridoma supernatants with the Spots On Dots Antibody Screening Kit Application Note AN1 Table of Contents Overview... 2 Figure 1. Screening of hybridomas raised against peptide antigens... 3
Human induced Pluripotent Stem Cell (ipsc) Line: GM23225*B
Certificate of Analysis NIGMS Human tic Cell Repository Human induced Pluripotent Stem Cell (ipsc) Line: GM23225*B Diagnosis Mutation Reprogramming method Publication(s) describing ipsc line establishment
Generation of a bile salt export pump deficiency model using patient-specific induced pluripotent stem cell-derived hepatocyte-like cells
Supplementary Information Generation of a bile salt export pump deficiency model using patient-specific induced pluripotent stem cell-derived hepatocyte-like cells Authors Kazuo Imagawa 1,2,3,, Kazuo Takayama
Derivation of UCSFB lines from biopsied blastomeres of cleavage-stage human. Spare embryos were obtained through the UCSF IVF Tissue Bank from donors
Supplementary Materials and Methods Derivation of UCSFB lines from biopsied blastomeres of cleavage-stage human embryos Spare embryos were obtained through the UCSF IVF Tissue Bank from donors undergoing
Fig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.
Fig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.SCUBE2, E-cadherin.Myc, or HA.p120-catenin was transfected in a combination
NIA Aging Cell Repository
Certificate of Analysis NIA Aging Cell Repository Human induced Pluripotent Stem Cell (ipsc) Line: AG25370*B Diagnosis Alzheimer Disease, Familial, Type 4 Mutation Reprogramming method Publication(s) describing
Stem Cel s Key Words:
Stem Cells Key Words: Embryonic stem cells, Adult stem cells, ips cells, self-renewal, differentiation, pluripotent, multipotent, Inner cell mass, Nuclear transfer (Therapeutic cloning), Feeder cells,
PrimePCR Assay Validation Report
Gene Information Gene Name growth differentiation factor 6 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID GDF6 Human This gene encodes a member of the bone
Mechanisms of embryonic stem cell division and differentiation
Mechanisms of embryonic stem cell division and differentiation Josephine Wbite.'.... Department of Molecular Biosciences (Biochemistry) The University of Adelaide Adelaide, South Australia Submitted for
White Paper Authentic Recombinant Activin A and BMP- 4 Production Using HumanZyme s Proprietary Human Cell Line Expression Technology
White Paper Authentic Recombinant Activin A and BMP- 4 Production Using HumanZyme s Proprietary Human Cell Line Expression Technology Mark Azam, Ph.D. VP - R&D and Manufacturing Patricia Ahrweiler, Ph.D.
Assuring Pluripotency of ESC and ipsc Lines
Assuring Pluripotency of ESC and ipsc Lines Introduction Compared to other cell types, stem cells have the unique ability to self-renew their populations by dividing into identical daughter stem cells
Mesenchymal Stem Cell Characterization. Peiman Hematti, M.D. Department of Medicine
Mesenchymal Stem Cell Characterization Peiman Hematti, M.D. Department of Medicine Terminology has evolved over the years: Colony forming units-fibroblasts (CFU-E) Fibroblast colony forming cells (FCFC)
Nature Biotechnology: doi: /nbt Supplementary Figure 1
Supplementary Figure 1 Schematic and results of screening the combinatorial antibody library for Sox2 replacement activity. A single batch of MEFs were plated and transduced with doxycycline inducible
Supplementary Data. In Vivo Bone Formation by impcs Materials and methods. Results. Conclusions
Supplementary Data In Vivo Bone Formation by impcs Materials and methods Induced pluripotent stem cell (ipsc)-derived mesenchymal stem cell (MSC)-like progenitor cells (impcs) (1 10 6 M-iMPC-GMs in 10
Xenopus gastrulation. Dorsal-Ventral Patterning - The Spemann Organizer. Two mesoderm inducing signals
Dorsal- atterning - The Spemann Organizer Two mesoderm inducing signals late-blastula early-gastrula nimal Blood Mesothelium Not Vegetal NC Endoderm Hans Spemann (1869-1941) Hilde Mangold (1898-1924) Dr
We are walking and standing with parts of our bodies which could have been used for thinking had they developed in another part of the embryo.
We are walking and standing with parts of our bodies which could have been used for thinking had they developed in another part of the embryo. Hans Spemann, 1943 Reading from Chapter 3 - types of cell
hescs (H1 and H9) and ipscs (3U1) were maintained and directed into definitive endoderm
Supplementary information, Data S1 Materials and Methods Culture and differentiation of hpscs hescs (H1 and H9) and ipscs (3U1) were maintained and directed into definitive endoderm cells as described
Figure S1. Phenotypic characterization of AND-1_WASKO cell lines. AND- 1_WASKO_C1.1 (WASKO_C1.1) and AND-1_WASKO_C1.2 (WASKO_C1.
LEGENDS TO SUPPLEMENTARY FIGURES Figure S1. Phenotypic characterization of AND-1_WASKO cell lines. AND- 1_WASKO_C1.1 (WASKO_C1.1) and AND-1_WASKO_C1.2 (WASKO_C1.2) were stained with the antibodies oct3/4
Stem Cells in Kidney Disease: Where Are We Now?
Stem Cells in Kidney Disease: Where Are We Now? Berliner Dialyseseminar 5. Dezember 2015 Albert Q. Lam, MD Associate Physician Brigham and Women s Hospital Harvard Medical School None Disclosures Cell
Supplementary Figure 1. Differentiation of human ESC into definitive endoderm.
87.5 Supplementary Figure. Differentiation of human ESC into definitive endoderm. a-c. Human ESC treated with Activin A and WNT3a for 4 days and seeded onto collagen Type IV matrix generated stable and
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11809 Supplementary Figure 1. Antibiotic treatment reduces intestinal bacterial load and allows access of non-pathogenic bacteria to the MLN, inducing intestinal
Regulation of Hematopoietic Stem Cells and their Bone Marrow Niches by the Coagulation System*.
Regulation of Hematopoietic Stem Cells and their Bone Marrow Niches by the Coagulation System*. * Via PAR-1 & CXCR4 upregulation, SDF-1 secretion and EPCR shedding. By Tsvee Lapidot, Ph.D. Weizmann Institute
Supplementary Figure 1. Characterization of hipscs derived from primary human fibroblasts. a,b. Morphology of hipscs. hipscs exhibit hesc-like
Supplementary Figure 1. Characterization of hipscs derived from primary human fibroblasts. a,b. Morphology of hipscs. hipscs exhibit hesc-like morphology in co-culture with mouse embryonic feeder fibroblasts
Nature Biotechnology: doi: /nbt Supplementary Figure 1. Generation of NSCs from hpscs in SDC medium.
Supplementary Figure 1 Generation of NSCs from hpscs in SDC medium. (a) Q-PCR of pluripotent markers (OCT4, NANOG), neural markers (SOX1, PAX6, N-Cadherin), markers for the other germ layers (T, EOMES,
Supplementary Fig S1: Bone marrow macrophages and liver Kupffer cells increase IL-1 in response to adenosine signaling. (a) Murine bone marrow
Supplementary Fig S1: Bone marrow macrophages and liver Kupffer cells increase IL-1 in response to adenosine signaling. (a) Murine bone marrow derived macrophages (BMDM) were primed with LPS for 16 hrs,
Isolation, culture, and transfection of primary mammary epithelial organoids
Supplementary Experimental Procedures Isolation, culture, and transfection of primary mammary epithelial organoids Primary mammary epithelial organoids were prepared from 8-week-old CD1 mice (Charles River)
Supplementary Information. Conversion of vascular endothelial cells into multipotent stem-like cells
Supplementary Information Conversion of vascular endothelial cells into multipotent stem-like cells Damian Medici 1, Eileen M. Shore 2,3,4, Vitali Y. Lounev 2,4, Frederick S. Kaplan 2,4,5, Raghu Kalluri
Nature Medicine: doi: /nm.4169
Supplementary Fig.1. EC-specific deletion of Ccm3 by Cdh5-CreERT2. a. mt/mg reporter mice were bred with Cdh5CreERT2 deleter mice followed by tamoxifen feeding from P1 to P3. mg expression was specifically
Bioassays are required for a
B I O P R O C E S S TECHNICAL Bioassay Survey 006 007 Cell-Based Bioassays in the Biopharmaceutical Industry C. Jane Robinson, Laureen E. Little, and Hans-Joachim Wallny Bioassays are required for a variety
Induction of Hair Growth by Fibroblast-Secreted WNTs. Gail Naughton and Frank Zeigler Histogen, Inc.
Induction of Hair Growth by Fibroblast-Secreted WNTs Gail Naughton and Frank Zeigler Histogen, Inc. Fibroblast Secreted Factors Formed during tissue-engineering manufacturing process by primary human foreskin
Supplementary Fig. 5
Supplementary Fig. 5 Supplemental Figures legends Supplementary Figure 1 (A) Additional dot plots from CyTOF analysis from untreated group. (B) Gating strategy for assessment of CD11c + NK cells frequency
Neural Induction. Steven McLoon Department of Neuroscience University of Minnesota
Neural Induction Steven McLoon Department of Neuroscience University of Minnesota 1 Course News Coffee Hour (with Dr. Nakagawa) Friday, Sept 22 8:30-9:30am Surdyks Café in Northrop Auditorium Stop by for
MicroRNAs Modulate Hematopoietic Lineage Differentiation
Chen et al., page 1 MicroRNAs Modulate Hematopoietic Lineage Differentiation Chang-Zheng Chen, Ling Li, Harvey F. Lodish, David. Bartel Supplemental Online Material Methods Cell isolation Murine bone marrow
Strategies for Assessment of Immunotoxicology in Preclinical Drug Development
Strategies for Assessment of Immunotoxicology in Preclinical Drug Development Rebecca Brunette, PhD Scientist, Analytical Biology SNBL USA Preclinical Immunotoxicology The study of evaluating adverse effects
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2239 Hepatocytes (Endoderm) Foreskin fibroblasts (Mesoderm) Melanocytes (Ectoderm) +Dox rtta TetO CMV O,S,M,K & N H1 hes H7 hes H9 hes H1 hes-derived EBs H7 hes-derived EBs H9 hes-derived
Nature Methods: doi: /nmeth Supplementary Figure 1
Supplementary Figure 1 Workflow for multimodal analysis using sc-gem on a programmable microfluidic device (Fluidigm). 1) Cells are captured and lysed, 2) RNA from lysed single cell is reverse-transcribed
THE THERAPEUTIC REALITIES OF STEM CELLS
Ferghana Partners Group is a Life Sciences investment banking house with offices in London and New York. We specialise in creating and executing effective strategic transactions for pharmaceutical, chemical,
SUPPLEMENTARY FIG. S9. Morphology and DNA staining of cipsc-differentiated trophoblast cell-like cell. Scale bar: 100 mm. SUPPLEMENTARY FIG. S10.
Supplementary Data SUPPLEMENTARY FIG. S1. Lentivirus-infected canine fibroblasts show YFP expression. (A, B) Uninfected canine skin fibroblasts (CSFs); (C, D) infected CSFs; (E, F) uninfected CTFs; (G,
CD1a-autoreactive T cells are a normal component of the human αβ T cell repertoire
CDa-autoreactive T cells are a normal component of the human αβ T cell repertoire Annemieke de Jong, Victor Peña-Cruz, Tan-Yun Cheng, Rachael A. Clark, Ildiko Van Rhijn,, D. Branch Moody Division of Rheumatology,
LAMPIRE Hybridoma Project Initiation Form
1. General Information Company / Institution: Investigator Name: Contact Name: Phone: Fax: 2. Billing / Shipping Information Accounts Payable contact: Company: Dept./Bldg./Room#: Address: Project Name
ExoCap TM Streptavidin Kit
CODE No. MEX-SA For Research Use Only. Not for use in diagnostic procedures. Printed July 5, 2017 Version 2.0 ExoCap TM Streptavidin Kit Exosome Isolation and Enrichment Kit PRODUCT DESCRIPTION ExoCap
Stem Cells and Cell Culture Developments Within ThermoFisher Scientific
The world leader in serving science Stem Cells and Cell Culture Developments Within ThermoFisher Scientific Katrina Kidd European Application Scientist Cellomics ThermoFisher Scientific A Typical Life
Title from induced pluripotent stem cells. Kakizuka, Akira; Sehara-Fujisawa, A.
Title In vitro modeling of paraxial mesod from induced pluripotent stem cells Sakurai, Hidetoshi; Sakaguchi, Yasu Author(s) Tokiko; Maki, Izumi; Sakai, Hiroshi Kakizuka, Akira; Sehara-Fujisawa, A Citation
Solution Key Problem Set
Solution Key- 7.013 Problem Set 5-2013 Question 1 During a summer hike you suddenly spot a huge grizzly bear. This emergency situation triggers a fight or flight response through a signaling pathway as
Mutagenesis and Expression of Mammalian Clotting Factor IX. Mark McCleland The Children s Hospital of Philadelphia and Lycoming College
Mutagenesis and Expression of Mammalian Clotting Factor IX Mark McCleland The Children s Hospital of Philadelphia and Lycoming College Hemophilia B X-linked blood clotting disorder characterized by a deficiency
PI3K/mTORC2 regulates TGFβ/Activin signalling by modulating Smad2/3
Supplementary Information PI3K/mTORC2 regulates TGFβ/Activin signalling by modulating Smad2/3 activity via linker phosphorylation Jason S.L. Yu, 1 Thamil Selvee Ramasamy, 1,2 Nick Murphy, 1 Marie Holt,