Supplemental Information. Direct Reprogramming of Fibroblasts. via a Chemically Induced XEN-like State

Size: px
Start display at page:

Download "Supplemental Information. Direct Reprogramming of Fibroblasts. via a Chemically Induced XEN-like State"

Transcription

1 Cell Stem Cell, Volume 21 Supplemental Information Direct Reprogramming of Fibroblasts via a Chemically Induced XEN-like State Xiang Li, Defang Liu, Yantao Ma, Xiaomin Du, Junzhan Jing, Lipeng Wang, Bingqing Xie, Da Sun, Shaoqiang Sun, Xueqin Jin, Xu Zhang, Ting Zhao, Jingyang Guan, Zexuan Yi, Weifeng Lai, Ping Zheng, Zhuo Huang, Yanzhong Chang, Zhen Chai, Jun Xu, and Hongkui Deng

2 SUPPLEMENTAL FIGURES Figure S1

3 Figure S1: Expressional and Functional Analysis for Chemical Reprogramming, Related to Figure 1 (A) Numbers of TauEGFP-positive and -negative colonies induced from XEN-like colonies. (B) Phase contrast and fluorescent images of chemically induced neurons after co-culturing with astrocytes. (C) qrt-pcr analysis of neural genes, fibroblast genes and XEN master genes regulated by components in Stage2 neural induction medium included N2, B27, BDNF, GDNF, bfgf, FSK, CHIR, Compound C (abbreviated as CC, also named as: Dorsomorpin). n = 2. (D) Number of genes that are activated or suppressed during the XEN-to-neuron conversion process. upregulated represents genes whose expression level was upregulated by more than 2-fold compared to fibroblasts, while downregulated represents genes whose expression level was downregulated by more than 2-fold compared to fibroblasts. (E) GO analysis for genes that were most robustly upregulated or downregulated by chemical induction (>10-fold differentially expressed). (F) Electrophysiological functional properties of the induced TauEGFP-positive cells without co-culturing with astrocytes. n = 3. (G) Generation and characterization of XEN-like cells-derived neurons from mouse newborn fibroblasts (NBFs). (H) Generation and characterization of XEN-like cells-derived neurons from mouse adult fibroblasts (MAFs). The data are presented as the mean +/ SEM. The scale bars are 100 μm.

4 Figure S2

5 Figure S2. Lineage Tracing Confirms the Fibroblast-Origin of the Induced Neuronal Cells, Related to Figure 2 (A) Scheme of lineage tracing system. (B) Representation of a TauEGFP and tdtomato-double positive colony (top) and TauEGFP-positive and TdTomato-negative colony (bottom). (C) Quantification of TauEGFP-positive colonies induced from TdTomato-positive and -negative cells. (D) The induced TdTomato-positive cells induced from XEN-like cells expressed pan-neuronal markers TUJ1, NF-H and SYN. (E) Patch-clamp recordings on TdTomato-positive cells induced from XEN-like cells after co-culturing with astrocytes. (F) Whole-cell voltage-clamp recording of TdTomato-positive cells induced from XEN-like cells and inward and outward currents were recorded. n = 4. (G) qrt-pcr analysis for hallmark neural-progenitor genes (Sox1 and Olig2) through the chemical induction process. n = 3. The data are presented as the mean +/ SEM. The scale bars are 100 μm.

6 Figure S3

7 Figure S3. Embryo-derived XEN Cells Resemble the Chemically-induced XEN-like Cells for Neuronal Induction, Related to Figure 4 (A) Diagram of CeXEN cell line establishment and induction of the CeXEN cells into neuronal cells. (B) Representative images of CeXEN cells (at P0 and P11) and the CeXEN cells were TauEGFP-negative. (C) CeXEN cells co-expressed XEN master genes Sall4, Gata4, Gata6 and Sox17. (D) Representative image of TauEGFP-positive cells induced from CeXEN cells. (E) Induced TauEGFP-positive cells induced from CeXEN cells co-expressed pan-neural markers (TUJ1 and NF-H). The scale bars: (D), 50 μm; (B), (C), (E), 100 μm.

8 Figure S4

9 Figure S4. Hepatocyte-like Cells Were Generated from the XEN-like Cells, Related to Figure 3 and Figure 4 (A) Gene expression heat map of fibroblast genes from eight single XEN-like colonies analyzed by RNA-seq. (B) Gene expression heat map of neural-ectoderm genes, mesoderm genes and endoderm genes from eight single XEN-like colonies analyzed by RNA-seq. (C) (D) Diagram of XEN-like state based hepatic lineage reprogramming. Representative phase contrast images of hepatocyte-like cells induced from XEN-like cells (> passage 20). (E) qrt-pcr analysis of hepatic hallmark genes in fibroblasts, XEN-like cells, induced hepatocyte-like cells from XEN-like cells (from two batches of experiments) and primary hepatocytes (isolated from 2-day postnatal mouse). n = 3. (F) Co-immunostaining of typical hepatocyte markers AFP and ALB for hepatocyte-like cells induced from XEN-like cells (> passage 20). (G) Hierarchical clustering analysis for XEN-derived hepatocytes, primary hepatocytes, hepatic tissues, XEN-like cells (P3 and P17) and fibroblasts. (H) Number of genes that are upregulated or downregulated during the XEN-to-hepatocytes conversion process. upregulated represents genes whose expression level was upregulated by more than 2-fold compared to fibroblasts, while downregulated represents genes whose expression level was downregulated by more than 2-fold compared to fibroblasts. (I) Quantitative analysis of ALBUMIN and Urea secretion among XEN-like cells, iheps from XEN-like cells (> passage 20) and primary hepatocytes by ELISA. n = 3. Scale bars: 100 μm. The data are presented as the mean +/ SEM. *P<0.05; **P<0.01; ***P<0.001 (Student s t-test).

10 SUPPLEMENTAL TABLES Table S1. Small molecules used in this study, related to Figure 1 and STAR Methods. FULL NAME ABBREVIATION DOSE SOURCE MOLECULAR WEIGHT VPA V 500 (μm) Sigma, cat. no.p CHIR99021 C Synthesized by WUXI APPTEC Synthesized by WUXI APPTEC Tranylcypromine T 5-10 Enzo, cat. no.bml-ei Forskolin F Enzo, cat. no.bml-cn AM580 A 0.05 Tocris, cat. no EPZ E 5 Selleckchem, cat. no.s TD114-2 TD Synthesized by WUXI APPTEC 529 Dorsomorpin D 1-2 Tocris, cat. no LDN L 0.1 Selleckchem, cat. no.s SB S 2-10 Tocris, cat. no

11 Ch Tocris, cat. no L-Ascorbic acid 2-phosphate Vc 50 (μg/ml) Sigma, cat. no.a Table S2. Electrophysiological properties of chemically-induced neurons, related to Figure 2, Figure S1 and Figure 4 Table S2. (A) Electrophysiological properties of chemically-induced neurons from embryonic fibroblasts (MEFs), related to Figure 2 and Figure S1. Induction Rm(MO) Cm(pF) RMP(mV) Threshold(mV) APamp(mV) Ina-max(pA) N ± ± ± ± ± ± /13 1* / / / / / / / /13

12 / / /13 *without co-culturing with astrocytes. Rm: input resisitance; Cm: membrane capacitance; RMP: resting membrane potential; APthreshold: action potential threshold; APamp: action potential amplitude; Ina-max: maximum amplitude of sodium current. All the data are mean+/ SEM. Table S2. (B) Electrophysiological properties of chemically-induced neurons from postnatal fibroblasts (NBFs), related to Figure S1. Induction Rm(MO) Cm(pF) RMP(mV) Threshold(mV) APamp(mV) Ina-max(pA) N ± ± ± ± ± ± / / / /8

13 / / / / /8 Rm: input resistance RMP: resting membrane potential Cm: membrane capacitance Threshold: action potential threshold APamp: action potential amplitude Ina-max: maximum amplitude of sodium current Table S2. (C) Electrophysiological properties of the chemically-induced neurons from passage 20 XEN-like cells, related to Figure 4. Induction Rm(MO) Cm(pF) RMP(mV) Threshold(mV) APamp(mV) Ina-max(pA) N ± ± ± ± ± ± /13 1* /13 2* / / / /13

14 / / / / / / /13 *without co-culturing with astrocytes. Rm: input resisitance; Cm: membrane capacitance; RMP: resting membrane potential; APthreshold: action potential threshold; APamp: action potential amplitude; Ina-max: maximum amplitude of sodium current. All the data are mean+/ SEM. Table S3. CNVs analyzed by CGH assay, related to Figure 4 (See supplemental excel file).

15 Table S3. (A) Overview of CGH profiling, related to Figure 4. Table S3. (B) Gene mutations found in XEN-like P2, related to Figure 4. Table S3. (C) Gene mutations found in XEN-like P10, related to Figure 4. Table S3. (D) Gene mutations found in XEN-like P13, related to Figure 4. Table S4. Primers used for real-time qpcr, related to Figure 1, Figure 3, Figure S1, Figure S4, and STAR Methods. GENE NAME FORWARD (5' TO 3') REVERSE (5' TO 3') APPLICATION Gapdh CATGTTCCAGTATGACTCCACTC GGCCTCACCCCATTTGATGT real-time qpcr Sox2 CGGGAAGCGTGTACTTATCCTT GCGGAGTGGAAACTTTTGTCC real-time qpcr Oct4 CAGGGCTTTCATGTCCTGG AGTTGGCGTGGAGACTTTGC real-time qpcr Esrrb GTGGCTGAGGGCATCAATG AACCGAATGTCGTCCGAAGAC real-time qpcr Nanog AGTTATGGAGCGGAGCAGCAT AGGCCTGGACCGCTCAGT real-time qpcr Gata6 TGAGGTGGTCGCTTGTGTAG ATGGCGTAGAAATGCTGAGG real-time qpcr Gata4 GAGCTGGCCTGCGATGTCTGAGTG AAACGGAAGCCCAAGAACCTGAAT real-time qpcr

16 Sox17 GTCAACGCCTTCCAAGACTTG GTAAAGGTGAAAGGCGAGGTG real-time qpcr Ascl1 ACTTGAACTCTATGGCGGGTT CCAGTTGGTAAAGTCCAGCAG real-time qpcr Brn2 GACAAGATCGCAGCGCAAGG GGCTTAGGGCATTTGAGGAA real-time qpcr NeuroD1 ACGCAGAAGGCAAGGTGTCC GTTCCTCGTCCTGAGAACTG real-time qpcr Ngn2 TGGCTGGCATCTGCTCTATT TAGGCATTGTGACGAATCTG real-time qpcr Col1a1 CATGTTCAGCTTTGTGGACCT GCAGCTGACTTCAGGGATGT real-time qpcr Fsp1 GTGTCCACCTTCCACAAATACTCA ACTTCATTGTCCCTGTTGCTGTC real-time qpcr Cyp2a5 GCACTTCCTAGATGACAAGGGACA CAGGCTCAACGGGACAAGAA real-time qpcr Hnf4α CATCACCACCATCGTCAA CCTCGTGTCACATCTTCTT real-time qpcr Alb ATGTTACCAAGTGCTGTAGT AATCTGCTTCTCCTTCTCTG real-time qpcr Afp TTCCTGTCTCAGTCATTCTAAG AGTCTCCTAAGGTCTGGTAG real-time qpcr Cyp3a11 TACTGTGATGGAGATGGAATAC GGTGAAGAGCATAAGATGGA real-time qpcr Ttr CTCACCACAGATGAGAAG GGCTGAGTCTCTCAATTC real-time qpcr

17 Hnf6a AAATAAGCGTCCGTCCAAAGAA GACGATGAACTGCCTGAGTTG real-time qpcr Cyp3a13 AGTGCTGGTGAAGGAATG CTGGTGAAGGTTGGAGAC real-time qpcr Cyp2b10 GTCCATCCTCCAGAACTTC TTCCAATACCACTCTCCTTG real-time qpcr Gjb1 CGTGAATCGGCACTCTACAGC TGCACCTTGTGTCTCTTTACCTC real-time qpcr Sult1a1 AACATGGAGCCCTTGCGTAAA ATGAGCACATCATCAGGCCAG real-time qpcr Gstt1 AGGCTCGTGCTCGTGTAGA CAGGGAACATCACCTTATGCC real-time qpcr Actin CGCCACCAGTTCGCCATGGA TACAGCCCGGGGAGCATCGT real-time qpcr

Direct Reprogramming of Fibroblasts via a Chemically Induced XEN-like State

Direct Reprogramming of Fibroblasts via a Chemically Induced XEN-like State Short Article Direct Reprogramming of Fibroblasts via a Chemically Induced XEN-like State Graphical Abstract Authors Xiang Li, Defang Liu, Yantao Ma,..., Zhen Chai, Jun Xu, Hongkui Deng Correspondence

More information

Nature Biotechnology: doi: /nbt Supplementary Figure 1

Nature Biotechnology: doi: /nbt Supplementary Figure 1 Supplementary Figure 1 Schematic and results of screening the combinatorial antibody library for Sox2 replacement activity. A single batch of MEFs were plated and transduced with doxycycline inducible

More information

Supplementary Figure 1 Characterization of OKSM-iNSCs

Supplementary Figure 1 Characterization of OKSM-iNSCs Supplementary Figure 1 Characterization of OKSM-iNSCs (A) Gene expression levels of Sox1 and Sox2 in the indicated cell types by microarray gene expression analysis. (B) Dendrogram cluster analysis of

More information

Supplementary Data. Supplementary Methods Three-step protocol for spontaneous differentiation of mouse induced pluripotent stem (embryonic stem) cells

Supplementary Data. Supplementary Methods Three-step protocol for spontaneous differentiation of mouse induced pluripotent stem (embryonic stem) cells Supplementary Data Supplementary Methods Three-step protocol for spontaneous differentiation of mouse induced pluripotent stem (embryonic stem) cells Mouse induced pluripotent stem cells (ipscs) were cultured

More information

Nature Biotechnology: doi: /nbt Supplementary Figure 1. Generation of NSCs from hpscs in SDC medium.

Nature Biotechnology: doi: /nbt Supplementary Figure 1. Generation of NSCs from hpscs in SDC medium. Supplementary Figure 1 Generation of NSCs from hpscs in SDC medium. (a) Q-PCR of pluripotent markers (OCT4, NANOG), neural markers (SOX1, PAX6, N-Cadherin), markers for the other germ layers (T, EOMES,

More information

A Novel Platform to Enable the High-Throughput Derivation and Characterization of Feeder-Free Human ipscs

A Novel Platform to Enable the High-Throughput Derivation and Characterization of Feeder-Free Human ipscs Supplementary Information A Novel Platform to Enable the High-Throughput Derivation and Characterization of Feeder-Free Human ipscs Bahram Valamehr, Ramzey Abujarour, Megan Robinson, Thuy Le, David Robbins,

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Supplementary Figure 1. Functional assays of hepatocyte-like cells induced from H1 hescs (a) P450 and AAT staining, PAS staining, LDL uptake assay, and ICG uptake and release assay

More information

Biology Open (2015): doi: /bio : Supplementary information

Biology Open (2015): doi: /bio : Supplementary information Fig. S1. Verification of optimal conditions for the generation of LIF-dependent inscs Representative images (from five repeat experiments) of human primary fibroblasts undergoing reprogramming for 21 days

More information

Sundari Chetty, Felicia Walton Pagliuca, Christian Honore, Anastasie Kweudjeu, Alireza Rezania, and Douglas A. Melton

Sundari Chetty, Felicia Walton Pagliuca, Christian Honore, Anastasie Kweudjeu, Alireza Rezania, and Douglas A. Melton A simple tool to improve pluripotent stem cell differentiation Sundari Chetty, Felicia Walton Pagliuca, Christian Honore, Anastasie Kweudjeu, Alireza Rezania, and Douglas A. Melton Supplementary Information

More information

Electromagnetic Fields Mediate Efficient Cell Reprogramming Into a Pluripotent State

Electromagnetic Fields Mediate Efficient Cell Reprogramming Into a Pluripotent State Electromagnetic Fields Mediate Efficient Cell Reprogramming Into a Pluripotent State Soonbong Baek, 1 Xiaoyuan Quan, 1 Soochan Kim, 2 Christopher Lengner, 3 Jung- Keug Park, 4 and Jongpil Kim 1* 1 Lab

More information

Supplemental Information

Supplemental Information Cell Stem Cell, Volume 15 Supplemental Information Generation of Naive Induced Pluripotent Stem Cells from Rhesus Monkey Fibroblasts Riguo Fang, Kang Liu, Yang Zhao, Haibo Li, Dicong Zhu, Yuanyuan Du,

More information

Table S1. Components for knockout serum replacer medium (KSR medium) (500 ml) Component Supplier Catalogue number

Table S1. Components for knockout serum replacer medium (KSR medium) (500 ml) Component Supplier Catalogue number Table S1. Components for knockout serum replacer medium (KSR medium) (500 ml) Component Supplier Catalogue number Stock Concentration Final concentration Volume used Advanced DMEM/F12 Invitrogen 12634010-78%

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature10202 Supplementary Figure 1: Rapid generation of neurons from human ES cells. a, Phase contrast image of feeder-free culture of human ES cells infected with Brn2, Ascl1, Myt1l (BAM)

More information

Supplementary Fig. 1. A, Upper panel shows schematic molecular representation of mutation- and SNP-replacement with FANCA-c-HDAdV in FANCA-corrected

Supplementary Fig. 1. A, Upper panel shows schematic molecular representation of mutation- and SNP-replacement with FANCA-c-HDAdV in FANCA-corrected Supplementary Fig. 1. A, Upper panel shows schematic molecular representation of mutation- and SNP-replacement with FANCA-c-HDAdV in FANCA-corrected FA-iPSC line (C-FA-iPSCs). Lower panels show the sequencing

More information

Rapid differentiation of human pluripotent stem cells into functional motor neurons by

Rapid differentiation of human pluripotent stem cells into functional motor neurons by Supplementary Information Rapid differentiation of human pluripotent stem cells into functional motor neurons by mrnas encoding transcription factors Sravan Kumar Goparaju, Kazuhisa Kohda, Keiji Ibata,

More information

NIA Aging Cell Repository

NIA Aging Cell Repository Certificate of Analysis NIA Aging Cell Repository Human induced Pluripotent Stem Cell (ipsc) Line: AG25370*B Diagnosis Alzheimer Disease, Familial, Type 4 Mutation Reprogramming method Publication(s) describing

More information

Supplementary Figure 1. Soft fibrin gels promote growth and organized mesodermal differentiation. Representative images of single OGTR1 ESCs cultured

Supplementary Figure 1. Soft fibrin gels promote growth and organized mesodermal differentiation. Representative images of single OGTR1 ESCs cultured Supplementary Figure 1. Soft fibrin gels promote growth and organized mesodermal differentiation. Representative images of single OGTR1 ESCs cultured in 90-Pa 3D fibrin gels for 5 days in the presence

More information

Generation of a bile salt export pump deficiency model using patient-specific induced pluripotent stem cell-derived hepatocyte-like cells

Generation of a bile salt export pump deficiency model using patient-specific induced pluripotent stem cell-derived hepatocyte-like cells Supplementary Information Generation of a bile salt export pump deficiency model using patient-specific induced pluripotent stem cell-derived hepatocyte-like cells Authors Kazuo Imagawa 1,2,3,, Kazuo Takayama

More information

Human induced Pluripotent Stem Cell (ipsc) Line: GM23225*B

Human induced Pluripotent Stem Cell (ipsc) Line: GM23225*B Certificate of Analysis NIGMS Human tic Cell Repository Human induced Pluripotent Stem Cell (ipsc) Line: GM23225*B Diagnosis Mutation Reprogramming method Publication(s) describing ipsc line establishment

More information

Assuring Pluripotency of ESC and ipsc Lines

Assuring Pluripotency of ESC and ipsc Lines Assuring Pluripotency of ESC and ipsc Lines Introduction Compared to other cell types, stem cells have the unique ability to self-renew their populations by dividing into identical daughter stem cells

More information

T-iPSC. Gra-iPSC. B-iPSC. TTF-iPSC. Supplementary Figure 1. Nature Biotechnology: doi: /nbt.1667

T-iPSC. Gra-iPSC. B-iPSC. TTF-iPSC. Supplementary Figure 1. Nature Biotechnology: doi: /nbt.1667 a T-iPSC Gra-iPSC B-iPSC TTF-iPSC Ectoderm Endoderm Mesoderm b Nature Biotechnology: doi:.38/nbt.667 Supplementary Figure Klf4 transgene expression Oct4 transgene expression.7 Fold GAPDH.6.5.4.3 Fold GAPDH

More information

Xeno-Free Systems for hesc & hipsc. Facilitating the shift from Stem Cell Research to Clinical Applications

Xeno-Free Systems for hesc & hipsc. Facilitating the shift from Stem Cell Research to Clinical Applications Xeno-Free Systems for hesc & hipsc Facilitating the shift from Stem Cell Research to Clinical Applications NutriStem Defined, xeno-free (XF), serum-free media (SFM) specially formulated for growth and

More information

Supplementary Figure 1: Derivation and characterization of RN ips cell lines. (a) RN ips cells maintain expression of pluripotency markers OCT4 and

Supplementary Figure 1: Derivation and characterization of RN ips cell lines. (a) RN ips cells maintain expression of pluripotency markers OCT4 and Supplementary Figure 1: Derivation and characterization of RN ips cell lines. (a) RN ips cells maintain expression of pluripotency markers OCT4 and SSEA4 after 10 passages in mtesr 1 medium. (b) Schematic

More information

Supplementary Figure 1.

Supplementary Figure 1. Supplementary Figure 1. Quantification of western blot analysis of fibroblasts (related to Figure 1) (A-F) Quantification of western blot analysis for control and IR-Mut fibroblasts. Data are expressed

More information

Supplemental Information. Pioneer Factor NeuroD1 Rearranges. Transcriptional and Epigenetic Profiles. to Execute Microglia-Neuron Conversion

Supplemental Information. Pioneer Factor NeuroD1 Rearranges. Transcriptional and Epigenetic Profiles. to Execute Microglia-Neuron Conversion Neuron, Volume 101 Supplemental Information Pioneer Factor NeuroD1 Rearranges Transcriptional and Epigenetic Profiles to Execute Microglia-Neuron Conversion Taito Matsuda, Takashi Irie, Shutaro Katsurabayashi,

More information

Supplementary Figure 1, related to Figure 1. GAS5 is highly expressed in the cytoplasm of hescs, and positively correlates with pluripotency.

Supplementary Figure 1, related to Figure 1. GAS5 is highly expressed in the cytoplasm of hescs, and positively correlates with pluripotency. Supplementary Figure 1, related to Figure 1. GAS5 is highly expressed in the cytoplasm of hescs, and positively correlates with pluripotency. (a) Transfection of different concentration of GAS5-overexpressing

More information

Supplementary Information to Accompany. Precision Modulation of Neurodegenerative Disease-Related Gene Expression in Human ipsc-derived Neurons

Supplementary Information to Accompany. Precision Modulation of Neurodegenerative Disease-Related Gene Expression in Human ipsc-derived Neurons Supplementary Information to Accompany Precision Modulation of Neurodegenerative Disease-Related Gene Expression in Human ipsc-derived Neurons Sabrina Mahalia Heman-Ackah 1,2,3,*, Andrew Roger Bassett

More information

Chemically defined conditions for human ipsc derivation and culture

Chemically defined conditions for human ipsc derivation and culture Nature Methods Chemically defined conditions for human ipsc derivation and culture Guokai Chen, Daniel R Gulbranson, Zhonggang Hou, Jennifer M Bolin, Victor Ruotti, Mitchell D Probasco, Kimberly Smuga-Otto,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2239 Hepatocytes (Endoderm) Foreskin fibroblasts (Mesoderm) Melanocytes (Ectoderm) +Dox rtta TetO CMV O,S,M,K & N H1 hes H7 hes H9 hes H1 hes-derived EBs H7 hes-derived EBs H9 hes-derived

More information

mrna for Integration- free Cell Fate Manipulation BRAD HAMILTON ISSCR 2012 YOKOHAMA, JAPAN JUNE 13 TH, 2012

mrna for Integration- free Cell Fate Manipulation BRAD HAMILTON ISSCR 2012 YOKOHAMA, JAPAN JUNE 13 TH, 2012 mrna for Integration- free Cell Fate Manipulation BRAD HAMILTON ISSCR 2012 YOKOHAMA, JAPAN JUNE 13 TH, 2012 Presentation Outline mrna Reprogramming System mirna Enhanced mrna Reprogramming mrna for Differentiation

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION In the format provided by the authors and unedited. Electromagnetized gold nanoparticles mediate direct lineage reprogramming into induced dopamine neurons in vivo for Parkinson s disease therapy Junsang

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION DOI: 1.138/NMAT3777 Biophysical regulation of epigenetic state and cell reprogramming Authors: Timothy L. Downing 1,2, Jennifer Soto 1,2, Constant Morez 2,3,, Timothee Houssin

More information

hipsc-derived cardiomyocytes from Brugada Syndrome patients without identified mutations do not exhibit clear cellular electrophysiological

hipsc-derived cardiomyocytes from Brugada Syndrome patients without identified mutations do not exhibit clear cellular electrophysiological hipsc-derived cardiomyocytes from Brugada Syndrome patients without identified mutations do not exhibit clear cellular electrophysiological abnormalities Authors: Christiaan C. Veerman, MD # 1 ; Isabella

More information

Day AP2a FOXG1 PAX6 SOX10 OCT4 OCT4 SIX6 PAX7 NES NES NES CD146 CD146 CD93 CD146 CD31 CD31. Flk1 CD34 CD34 CD34 CD34 CD34 CD43 CD43 DES

Day AP2a FOXG1 PAX6 SOX10 OCT4 OCT4 SIX6 PAX7 NES NES NES CD146 CD146 CD93 CD146 CD31 CD31. Flk1 CD34 CD34 CD34 CD34 CD34 CD43 CD43 DES Endoderm Mesoderm Ectoderm OCT4 T CXCR4 FOXA2 SOX17 OCT4 CD34 CXCR4 FOXA2 AP2a SOX10 NES CD93 Flk1 CD34 CD43 DES TAL1 HNF4α C/EBPα FOXA2 AAT NES CD146 CD31 CD34 DES HNF4α C/EBPα LGR5 CK19 Fib AAT C/EBPα

More information

HUMAN EMBRYONIC STEM CELL (hesc) ASSESSMENT BY REAL-TIME POLYMERASE CHAIN REACTION (PCR)

HUMAN EMBRYONIC STEM CELL (hesc) ASSESSMENT BY REAL-TIME POLYMERASE CHAIN REACTION (PCR) HUMAN EMBRYONIC STEM CELL (hesc) ASSESSMENT BY REAL-TIME POLYMERASE CHAIN REACTION (PCR) OBJECTIVE: is performed to analyze gene expression of human Embryonic Stem Cells (hescs) in culture. Real-Time PCR

More information

Disease Clinical features Genotype

Disease Clinical features Genotype Disease Clinical features Genotype Alpha 1 Antitrypsin deficiency (A1ATD) Patient 1 65 year old caucasian male, liver transplant recipient, explant biopsy confirmed A1ATD induced liver cirrhosis Patient

More information

A cost-effective system for differentiation of intestinal epithelium from human induced pluripotent stem cells

A cost-effective system for differentiation of intestinal epithelium from human induced pluripotent stem cells A cost-effective system for differentiation of intestinal epithelium from human induced pluripotent stem cells Soichiro Ogaki 1, 2, 3, 4, 5, *, ayu orooka 1,*, Kaito Otera 1, 1, 3 and Shoen Kume Supplementary

More information

REPROGRAMMING OF HUMAN STEM CELLS TO HEPATOCYTES FOR CLINICAL AND INDUSTRIAL APPLICATIONS. Eishani Kumar. Faculty Mentor: Dr.

REPROGRAMMING OF HUMAN STEM CELLS TO HEPATOCYTES FOR CLINICAL AND INDUSTRIAL APPLICATIONS. Eishani Kumar. Faculty Mentor: Dr. Kumar 1 REPROGRAMMING OF HUMAN STEM CELLS TO HEPATOCYTES FOR CLINICAL AND INDUSTRIAL APPLICATIONS BY Eishani Kumar Faculty Mentor: Dr. Wei-Shou Hu Graduate Mentor: David Chau Department of Chemical Engineering

More information

Supplementary Information

Supplementary Information Electronic Supplementary Material (ESI) for Analyst. This journal is The Royal Society of Chemistry 2017 Seidel et al. 2016 Page 1 of 13 In vitro field potential monitoring on multi-micro electrode array

More information

Gene name forward primer 5->3 reverse primer 5->3 product GCCCATA. Nfatc1 AGGTGCAGCCCAAGTCTCAC GTGGCCATCTGGAGCCTTC CTGT GATGC GCT ACCAA

Gene name forward primer 5->3 reverse primer 5->3 product GCCCATA. Nfatc1 AGGTGCAGCCCAAGTCTCAC GTGGCCATCTGGAGCCTTC CTGT GATGC GCT ACCAA Supplementary able 1 is presenting the PCR primer list used. ene name forward primer 5->3 reverse primer 5->3 product size cdna VE-Cadherin AACCCAAAAA CACCCCAAAAC 260bp CCA CCCAA PECAM-1 CACCACAA CCCCCACC

More information

Int. J. Mol. Sci. 2016, 17, 1259; doi: /ijms

Int. J. Mol. Sci. 2016, 17, 1259; doi: /ijms S1 of S5 Supplementary Materials: Fibroblast-Derived Extracellular Matrix Induces Chondrogenic Differentiation in Human Adipose-Derived Mesenchymal Stromal/Stem Cells in Vitro Kevin Dzobo, Taegyn Turnley,

More information

hipscs were derived from human skin fibroblasts (CRL-2097) by ectopic

hipscs were derived from human skin fibroblasts (CRL-2097) by ectopic Generation and characterization of hipscs hipscs were derived from human skin fibroblasts (CRL-2097) by ectopic expression of OCT4, SOX2, KLF4, and C-MYC as previously described 1. hipscs showed typical

More information

Combinatorial microenvironmental regulation of liver progenitor differentiation by Notch ligands, TGFβ, and extracellular matrix

Combinatorial microenvironmental regulation of liver progenitor differentiation by Notch ligands, TGFβ, and extracellular matrix Combinatorial microenvironmental regulation of liver progenitor differentiation by Notch ligands, TGFβ, and extracellular matrix Authors Kerim B. Kaylan, 1,2 Viktoriya Ermilova, 1,2 Ravi Chandra Yada,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature11435 Supplementary Figures Figure S1. The scheme of androgenetic haploid embryonic stem (ahes) cells derivation. WWW.NATURE.COM/NATURE 1 RESEARCH SUPPLEMENTARY INFORMATION Figure S2.

More information

Supplemental Information. A Mesenchymal-to-Epithelial Transition. Initiates and Is Required for the Nuclear. Reprogramming of Mouse Fibroblasts

Supplemental Information. A Mesenchymal-to-Epithelial Transition. Initiates and Is Required for the Nuclear. Reprogramming of Mouse Fibroblasts Cell Stem Cell, Volume 7 Supplemental Information A Mesenchymal-to-Epithelial Transition Initiates and Is Required for the Nuclear Reprogramming of Mouse Fibroblasts Ronghui Li, Jialiang Liang, Su Ni,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:.38/nature08267 Figure S: Karyotype analysis of ips cell line One hundred individual chromosomal spreads were counted for each of the ips samples. Shown here is an spread at passage 5, predominantly

More information

Supplemental Information. Tissue Mechanics Orchestrate Wnt-Dependent. Human Embryonic Stem Cell Differentiation

Supplemental Information. Tissue Mechanics Orchestrate Wnt-Dependent. Human Embryonic Stem Cell Differentiation Cell Stem Cell, Volume 19 Supplemental Information Tissue Mechanics Orchestrate Wnt-Dependent Human Embryonic Stem Cell Differentiation Laralynne Przybyla, Johnathon N. Lakins, and Valerie M. Weaver Supplemental

More information

Supplementary Fig. 1. Isolation and in vitro expansion of EpCAM + cholangiocytes. For collagenase perfusion, enzyme solution was injected from the

Supplementary Fig. 1. Isolation and in vitro expansion of EpCAM + cholangiocytes. For collagenase perfusion, enzyme solution was injected from the Supplementary Fig. 1. Isolation and in vitro expansion of EpCAM + cholangiocytes. For collagenase perfusion, enzyme solution was injected from the portal vein for digesting adult livers, whereas it was

More information

Cell culture and drug treatment. Lineage - Sca-1+ CD31+ EPCs were cultured on

Cell culture and drug treatment. Lineage - Sca-1+ CD31+ EPCs were cultured on Supplemental Material Detailed Methods Cell culture and drug treatment. Lineage - Sca-1+ CD31+ EPCs were cultured on 5µg/mL human fibronectin coated plates in DMEM supplemented with 10% FBS and penicillin/streptomycin

More information

Supplementary Material for Yang et al., Generation of oligodendroglial cells by direct lineage conversion

Supplementary Material for Yang et al., Generation of oligodendroglial cells by direct lineage conversion Supplementary Material for Yang et al., Generation of oligodendroglial cells by direct lineage conversion Supplementary Figure 1. The presence of Plp::EGFP + /O4 + cells 21 days after transgene induction.

More information

Formation of Embryonic Bodies to Produce Neural Stem Cells from ipscs Using the Corning Spheroid Microplate

Formation of Embryonic Bodies to Produce Neural Stem Cells from ipscs Using the Corning Spheroid Microplate Formation of Embryonic Bodies to Produce Neural Stem Cells from ipscs Using the Corning Spheroid Microplate Application Note Wesley Hung and Joanne Hsu Corning Research Center Taiwan, Science & Technology

More information

New Technique for Differentiation Monitoring using Supernatant. Dojindo EU GmbH Takatoshi EZOE

New Technique for Differentiation Monitoring using Supernatant. Dojindo EU GmbH Takatoshi EZOE New Technique for Differentiation Monitoring using Supernatant Dojindo EU GmbH Takatoshi EZOE Jun/26/2013 1 Culturing Process from ES/iPS to Organs ES / ips Cells Activin Endoderm Intestine Pancreas Liver

More information

Table of Contents. 2.1 NeuroCult NCFC Assay Kit (Rat) Components Additional Required Reagents Required Equipment...

Table of Contents. 2.1 NeuroCult NCFC Assay Kit (Rat) Components Additional Required Reagents Required Equipment... i Table of Contents 1.0 Overview of the NeuroCult NCFC Assay 2.0 Materials 2.1 NeuroCult NCFC Assay Kit (Rat) Components... 4 2.2 Additional Required Reagents... 4 2.3 Required Equipment... 4 3.0 Preparation

More information

Supporting Information

Supporting Information Supporting Information Soft Conducting Polymer Hydrogels Cross-Linked and Doped by Tannic Acid for Spinal Cord Injury Repair Lei Zhou, 1, 2, # Lei Fan, 1, 2, 3, # Xin Yi, 1,2 Zhengnan Zhou, 4 Can liu,

More information

Figure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion

Figure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion Stem Cell Reports, Volume 1 Supplemental Information Robust Self-Renewal of Rat Embryonic Stem Cells Requires Fine-Tuning of Glycogen Synthase Kinase-3 Inhibition Yaoyao Chen, Kathryn Blair, and Austin

More information

Supplementary Figure 1. Characterization of hipscs derived from primary human fibroblasts. a,b. Morphology of hipscs. hipscs exhibit hesc-like

Supplementary Figure 1. Characterization of hipscs derived from primary human fibroblasts. a,b. Morphology of hipscs. hipscs exhibit hesc-like Supplementary Figure 1. Characterization of hipscs derived from primary human fibroblasts. a,b. Morphology of hipscs. hipscs exhibit hesc-like morphology in co-culture with mouse embryonic feeder fibroblasts

More information

Khaled_Fig. S MITF TYROSINASE R²= MITF PDE4D R²= Variance from mean mrna expression

Khaled_Fig. S MITF TYROSINASE R²= MITF PDE4D R²= Variance from mean mrna expression Khaled_Fig. S Variance from mean mrna expression.8 2 MITF.6 TYROSINASE.4 R²=.73.2.8.6.4.2.8.6.4.2.8.6.4.2 MALME3M SKMEL28 UACC257 MITF PDE4D R²=.63 4.5 5 MITF 3.5 4 PDE4B 2.5 3 R²=.2.5 2.5.8.6.4.2.8.6.4.2

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Figure S1 Colony-forming efficiencies using transposition of inducible mouse factors. (a) Morphologically distinct growth foci appeared from rtta-mefs 6-8 days following PB-TET-mFx cocktail

More information

Effects of neuroactive agents on axonal growth and pathfinding of. retinal ganglion cells generated from human stem cells

Effects of neuroactive agents on axonal growth and pathfinding of. retinal ganglion cells generated from human stem cells Effects of neuroactive agents on axonal growth and pathfinding of retinal ganglion cells generated from human stem cells Tadashi Yokoi 1, M.D., Ph.D.; Taku Tanaka 1, Ph.D.; Emiko Matsuzaka 1, Ph.D.; Fuminobu

More information

Neural induction - Dual SMAD inhibition

Neural induction - Dual SMAD inhibition Neural induction - Dual SMAD inhibition Mark J. Tomishima, SKI Stem Cell Research Facility http://stemcells.mskcc.org, tomishim@mskcc.org This protocol is based on Chambers et al. 2009. [Plating pluripotent

More information

ADVANCED MEDIA TECHNOLOGY

ADVANCED MEDIA TECHNOLOGY ADVANCED MEDIA TECHNOLOGY For Human ES and ips Cell Research The right medium makes all the difference in ensuring successful ES and ips cell culture. Stemgent offers high-quality, chemically-defined,

More information

Supplemental Information

Supplemental Information Supplemental Information Induction of site-specific chromosome translocations in embryonic stem cells by CRISPR/Cas9 Authors Junfeng Jiang*, 1, 2, Li Zhang*, 2, 3, Xingliang Zhou*, 2, Xi Chen 2, Guanyi

More information

Supplementary information for: Ten-Eleven Translocation-2 (Tet2) Is Involved in Myogenic Differentiation of Skeletal Myoblast Cells in

Supplementary information for: Ten-Eleven Translocation-2 (Tet2) Is Involved in Myogenic Differentiation of Skeletal Myoblast Cells in Supplementary information for: Ten-Eleven Translocation-2 (Tet2) Is Involved in Myogenic Differentiation of Skeletal Myoblast Cells in Vitro Xia Zhong*, Qian-Qian Wang*, Jian-Wei Li, Yu-Mei Zhang, Xiao-Rong

More information

- Supplementary Information -

- Supplementary Information - TRIM32 dependent transcription in adult neural progenitor cells regulates neuronal differentiation. - Supplementary Information - Anna-Lena Hillje 1, 2#, Maria Angeliki S. Pavlou 1, 2#, Elisabeth Beckmann

More information

Guided differentiation of ES cell into mesenchymal stem cell

Guided differentiation of ES cell into mesenchymal stem cell Guided differentiation of ES cell into mesenchymal stem cell Takumi Era Division of Molecular Neurobiology Institute of Molecular Embryology and Genetics, Kumamoto University Differentiation pathways of

More information

Components Neural induction basal medium (Cat. # ) 100 ml x 5 Neural induction medium supplement 50x (Cat. # ) 2 ml x 5

Components Neural induction basal medium (Cat. # ) 100 ml x 5 Neural induction medium supplement 50x (Cat. # ) 2 ml x 5 HPSC Neural Induction Medium (PSCNIM) Catalog #5931 Introduction Human embryonic stem cells (hesc) and induced pluripotent stem cells (hipsc) possess the capability of differentiating into all derivatives

More information

SUPPLEMENTARY FIG. S9. Morphology and DNA staining of cipsc-differentiated trophoblast cell-like cell. Scale bar: 100 mm. SUPPLEMENTARY FIG. S10.

SUPPLEMENTARY FIG. S9. Morphology and DNA staining of cipsc-differentiated trophoblast cell-like cell. Scale bar: 100 mm. SUPPLEMENTARY FIG. S10. Supplementary Data SUPPLEMENTARY FIG. S1. Lentivirus-infected canine fibroblasts show YFP expression. (A, B) Uninfected canine skin fibroblasts (CSFs); (C, D) infected CSFs; (E, F) uninfected CTFs; (G,

More information

TITLE: Identification of different mechanisms leading to PAX6 down-regulation, as potential

TITLE: Identification of different mechanisms leading to PAX6 down-regulation, as potential TITLE: Identification of different mechanisms leading to PAX6 down-regulation, as potential events contributing to the onset of Hirschsprung disease AUTHOR: María Valle Enguix-Riego 1,2,#, Ana Torroglosa

More information

Supplemental Figure 1 (Figure S1), related to Figure 1 Figure S1 provides evidence to demonstrate Nfatc1Cre is a mouse line that directed gene

Supplemental Figure 1 (Figure S1), related to Figure 1 Figure S1 provides evidence to demonstrate Nfatc1Cre is a mouse line that directed gene Developmental Cell, Volume 25 Supplemental Information Brg1 Governs a Positive Feedback Circuit in the Hair Follicle for Tissue Regeneration and Repair Yiqin Xiong, Wei Li, Ching Shang, Richard M. Chen,

More information

Enteroendocrine cells switch hormone expression along the crypt-to-villus BMP signalling gradient

Enteroendocrine cells switch hormone expression along the crypt-to-villus BMP signalling gradient SUPPLEMENTARY INFORMATION Letters https://doi.org/10.1038/s41556-018-0143-y In the format provided by the authors and unedited. Enteroendocrine cells switch hormone expression along the crypt-to-villus

More information

Supplementary Data. Flvcr1a TCTAAGGCCCAGTAGGACCC GGCCTCAACTGCCTGGGAGC AGAGGGCAACCTCGGTGTCC

Supplementary Data. Flvcr1a TCTAAGGCCCAGTAGGACCC GGCCTCAACTGCCTGGGAGC AGAGGGCAACCTCGGTGTCC Supplementary Data Supplementary Materials and Methods Measurement of reactive oxygen species accumulation in fresh intestinal rings Accumulation of reactive oxygen species in fresh intestinal rings was

More information

Human embryonic stem cells for in-vitro developmental toxicity testing

Human embryonic stem cells for in-vitro developmental toxicity testing Human embryonic stem cells for in-vitro developmental toxicity testing HESI workshop on alternatives assays for developmental toxicity Raimund Strehl Cellartis The company Founded in early 2001, University

More information

Scaffolding for human pluripotent stem cell lineage specification

Scaffolding for human pluripotent stem cell lineage specification University of Arkansas, Fayetteville ScholarWorks@UARK Biological and Agricultural Engineering Undergraduate Honors Theses Biological and Agricultural Engineering 5-2013 Scaffolding for human pluripotent

More information

SUPPLEMENTAL MATERIAL. Carvajal et al. Supplemental Table 1. List of quantitative PCR primers used for cdna analyses and

SUPPLEMENTAL MATERIAL. Carvajal et al. Supplemental Table 1. List of quantitative PCR primers used for cdna analyses and UPPLEMEAL MATERIAL Carvajal et al. upplemental Table 1. List of quantitative PCR primers used for cdna analyses and chromatin immunoprecipitation assays. Figure 1. DNA damage-induced transcriptional repression

More information

Apocynin suppression of NADPH oxidase reverses the aging process in mesenchymal stem cells. to promote osteogenesis and increase bone mass

Apocynin suppression of NADPH oxidase reverses the aging process in mesenchymal stem cells. to promote osteogenesis and increase bone mass Apocynin suppression of NADPH oxidase reverses the aging process in mesenchymal stem cells to promote osteogenesis and increase bone mass Jinlong Sun 1,2,4,a, Leiguo Ming 2,3,5,a, Fengqing Shang 2, Lijuan

More information

Supplementary Figure 1.

Supplementary Figure 1. Supplementary Figure 1. (A) UCSC Genome Browser view of region immediately downstream of the NEUROG3 start codon. All candidate grna target sites which meet the G(N 19 )NGG constraint are aligned to illustrate

More information

hescs (H1 and H9) and ipscs (3U1) were maintained and directed into definitive endoderm

hescs (H1 and H9) and ipscs (3U1) were maintained and directed into definitive endoderm Supplementary information, Data S1 Materials and Methods Culture and differentiation of hpscs hescs (H1 and H9) and ipscs (3U1) were maintained and directed into definitive endoderm cells as described

More information

Supplementary Figure S1: (A) Schematic representation of the Jarid2 Flox/Flox

Supplementary Figure S1: (A) Schematic representation of the Jarid2 Flox/Flox Supplementary Figure S1: (A) Schematic representation of the Flox/Flox locus and the strategy used to visualize the wt and the Flox/Flox mrna by PCR from cdna. An example of the genotyping strategy is

More information

PI3K/mTORC2 regulates TGFβ/Activin signalling by modulating Smad2/3

PI3K/mTORC2 regulates TGFβ/Activin signalling by modulating Smad2/3 Supplementary Information PI3K/mTORC2 regulates TGFβ/Activin signalling by modulating Smad2/3 activity via linker phosphorylation Jason S.L. Yu, 1 Thamil Selvee Ramasamy, 1,2 Nick Murphy, 1 Marie Holt,

More information

Supplementary Figure 1. Expressions of stem cell markers decreased in TRCs on 2D plastic. TRCs were cultured on plastic for 1, 3, 5, or 7 days,

Supplementary Figure 1. Expressions of stem cell markers decreased in TRCs on 2D plastic. TRCs were cultured on plastic for 1, 3, 5, or 7 days, Supplementary Figure 1. Expressions of stem cell markers decreased in TRCs on 2D plastic. TRCs were cultured on plastic for 1, 3, 5, or 7 days, respectively, and their mrnas were quantified by real time

More information

Protocol Reprogramming Human Fibroblasts into ips Cells using the Stemgent Reprogramming Lentivirus Set: Human OKSM

Protocol Reprogramming Human Fibroblasts into ips Cells using the Stemgent Reprogramming Lentivirus Set: Human OKSM STEMGENT Page 1 Reprogramming Lentivirus Set: Human OKSM OVERVIEW The following procedure describes the reprogramming of BJ Human Fibroblasts (BJ cells) to induced pluripotent stem (ips) cells using the

More information

Supplementary Information

Supplementary Information Supplementary Information Identification of small molecules for human hepatocyte expansion and ips differentiation Jing Shan 1, Robert E. Schwartz 1,3, Nathan T. Ross 4, David J. Logan 5, David Thomas

More information

Stem Cell Services. Driving Innovation for Stem Cell Researchers

Stem Cell Services. Driving Innovation for Stem Cell Researchers Driving Innovation for Stem Cell Researchers Stem Cell Services Partner with us and have access to the most advanced and comprehensive stem cell services available today. 675 W. Kendall St. Cambridge,

More information

SUPPORTING ONLINE MATERIAL

SUPPORTING ONLINE MATERIAL SUPPORTING ONLINE MATERIAL SUPPLEMENTAL EXPERIMENTAL PROCEDURES Primers for qpcr and semiquantitative PCR and conditions for semiquantitative PCR G6Pase 5 -ttgtggcagaagcatttgag-3, 5 -atatccttgcactggcaacc-3.

More information

gacgacgaggagaccaccgctttg aggcacattgaaggtctcaaacatg

gacgacgaggagaccaccgctttg aggcacattgaaggtctcaaacatg Supplementary information Supplementary table 1: primers for cloning and sequencing cloning for E- Ras ggg aat tcc ctt gag ctg ctg ggg aat ggc ttt gcc ggt cta gag tat aaa gga agc ttt gaa tcc Tpbp Oct3/4

More information

Development 142: doi: /dev : Supplementary Material

Development 142: doi: /dev : Supplementary Material Development 142: doi:1.42/dev.11687: Supplementary Material Figure S1 - Relative expression of lineage markers in single ES cell and cardiomyocyte by real-time quantitative PCR analysis. Single ES cell

More information

a previous report, Lee and colleagues showed that Oct4 and Sox2 bind to DXPas34 and Xite

a previous report, Lee and colleagues showed that Oct4 and Sox2 bind to DXPas34 and Xite SUPPLEMENTARY INFORMATION doi:1.138/nature9496 a 1 Relative RNA levels D12 female ES cells 24h Control sirna 24h sirna Oct4 5 b,4 Oct4 Xist (wt) Xist (mut) Tsix 3' (wt) Tsix 5' (wt) Beads Oct4,2 c,2 Xist

More information

Regulation of Acetylcholine Receptor Clustering by ADF/Cofilin- Directed Vesicular Trafficking

Regulation of Acetylcholine Receptor Clustering by ADF/Cofilin- Directed Vesicular Trafficking Regulation of Acetylcholine Receptor Clustering by ADF/Cofilin- Directed Vesicular Trafficking Chi Wai Lee, Jianzhong Han, James R. Bamburg, Liang Han, Rachel Lynn, and James Q. Zheng Supplementary Figures

More information

Changing fibroblasts into neurons: Direct lineage conversion. Journal Club Uli Herrmann

Changing fibroblasts into neurons: Direct lineage conversion. Journal Club Uli Herrmann Changing fibroblasts into neurons: Direct lineage conversion Journal Club Uli Herrmann 25.6.13 Outline Epigenetic landscape model Reprogramming cells Induced pluripotent stem cells Three papers: Direct

More information

Supplementary Information

Supplementary Information Supplementary Information Supplementary Figures Supplementary Figure 1. qrt-pcr analysis of the expression of candidate factors including SOX2, MITF, PAX3, DLX5, FOXD3, LEF1, MSX1, PAX6, SOX2 and SOX9

More information

Lineage conversion induced by pluripotency factors involves transient passage through an ipsc stage

Lineage conversion induced by pluripotency factors involves transient passage through an ipsc stage Lineage conversion induced by pluripotency factors involves transient passage through an ipsc stage Ori Bar-Nur 1 5, Cassandra Verheul 1 5, Andreia G Sommer,7, Justin Brumbaugh 1 5, Benjamin A Schwarz

More information

hpsc Maintenance Media

hpsc Maintenance Media hpsc Maintenance Media Brigitte Arduini, version 2, 2013-Jun-12 Initially, it was found that pluripotency of human pluripotent stem cells (hpscs) can be maintained when plated in co-culture with mouse

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTRY INFORMTION DOI:.38/ncb Kdmb locus kb Long isoform Short isoform Long isoform Jmj XX PHD F-box LRR Short isoform XX PHD F-box LRR Target Vector 3xFlag Left H Neo Right H TK LoxP LoxP Kdmb Locus

More information

Protocol Using the Reprogramming Ecotropic Retrovirus Set: Mouse OSKM to Reprogram MEFs into ips Cells

Protocol Using the Reprogramming Ecotropic Retrovirus Set: Mouse OSKM to Reprogram MEFs into ips Cells STEMGENT Page 1 OVERVIEW The following protocol describes the reprogramming of one well of mouse embryonic fibroblast (MEF) cells into induced pluripotent stem (ips) cells in a 6-well format. Transduction

More information

Contribution and Mobilization of Mesenchymal Stem Cells in a mouse model of carbon tetrachloride-induced liver fibrosis

Contribution and Mobilization of Mesenchymal Stem Cells in a mouse model of carbon tetrachloride-induced liver fibrosis Contribution and Mobilization of Mesenchymal Stem Cells in a mouse model of carbon tetrachloride-induced liver fibrosis Yan Liu 1,*, Zhipeng Han 1,*, Yingying Jing 1,*, Xue Yang 1, Shanshan Zhang 1, Chen

More information

Human Hepatocytes with Drug Metabolic Function. Induced from Fibroblasts by Lineage Reprogramming

Human Hepatocytes with Drug Metabolic Function. Induced from Fibroblasts by Lineage Reprogramming Cell Stem Cell, Volume 14 Supplemental Information Human Hepatocytes with Drug Metabolic Function Induced from Fibroblasts by Lineage Reprogramming Yuanyuan Du, Jinlin Wang, Jun Jia, Nan Song, Chengang

More information

Supplementary Materials and Methods:

Supplementary Materials and Methods: Supplementary Materials and Methods: Preclinical chemoprevention experimental design Mice were weighed and each mammary tumor was manually palpated and measured with digital calipers once a week from 4

More information

WT Day 90 after injections

WT Day 90 after injections Supplementary Figure 1 a Day 1 after injections Day 9 after injections Klf5 +/- Day 1 after injections Klf5 +/- Day 9 after injections BLM PBS b Day 1 after injections Dermal thickness (μm) 3 1 Day 9 after

More information

ANNOUNCEMENTS. HW2 is due Thursday 2/4 by 12:00 pm. Office hours: Monday 12:50 1:20 (ECCH 134)

ANNOUNCEMENTS. HW2 is due Thursday 2/4 by 12:00 pm. Office hours: Monday 12:50 1:20 (ECCH 134) ANNOUNCEMENTS HW2 is due Thursday 2/4 by 12:00 pm. Office hours: Monday 12:50 1:20 (ECCH 134) Lectures 6 8 Outline Stem Cell Division - symmetric - asymmetric Stem cell lineage potential - pluripotent

More information

Resveratrol inhibits epithelial-mesenchymal transition of retinal. pigment epithelium and development of proliferative vitreoretinopathy

Resveratrol inhibits epithelial-mesenchymal transition of retinal. pigment epithelium and development of proliferative vitreoretinopathy Resveratrol inhibits epithelial-mesenchymal transition of retinal pigment epithelium and development of proliferative vitreoretinopathy Keijiro Ishikawa, 1,2 Shikun He, 2, 3 Hiroto Terasaki, 1 Hossein

More information