GENESDEV/2007/ Supplementary Figure 1 Elkabetz et al.,

Size: px
Start display at page:

Download "GENESDEV/2007/ Supplementary Figure 1 Elkabetz et al.,"

Transcription

1 GENESDEV/2007/ Supplementary Figure 1 Elkabetz et al.,

2 GENESDEV/2007/ Supplementary Figure 2 Elkabetz et al.,

3 GENESDEV/2007/ Supplementary Figure 3 Elkabetz et al.,

4 GENESDEV/2007/ Supplementary Figure 4 Elkabetz et al.,

5 GENESDEV/2007/ Supplementary Figure 5 Elkabetz et al.,

6 GENESDEV/2007/ Supplementary Figure 6 Elkabetz et al.,

7 GENESDEV/2007/ Supplementary Figure 7 Elkabetz et al.,

8 GENESDEV/2007/ Supplementary Figures 8 Elkabetz et al.,

9 GENESDEV/2007/ Supplementary Figure 9 Elkabetz et al.,

10 GENESDEV/2007/ Supplementary Figure 10 Elkabetz et al.,

11 GENESDEV/2007/ Supplementary Figure 11 Elkabetz et al.,

12 SUPPLEMENTARY MATERIALS: SUPPLEMENTARY METHODS: Clonal density assays: Clonal assays were performed using GFP marked hesc derived R-NSCs co-cultured with unmarked stage-matched R-NSCs as feeder cells. This approach was required as single cells in the absence of R-NSC feeders did not survive compatible with the requirement for cell-to-cell contact typical for epithelial cells. RU1-eGFP-derived R-NSCs were sorted for Forse1 + /N- Cadherin high and seeded at clonal density on unsorted stage-matched R-NSCs derived from WA-09-derived. At 8 days after plating cultures were dissociated to single cell density followed by replating and expansion for an additional 8 21 days (P3) prior to assessing the formation of GFP+ rosettes. Efficiency of rosette formation in Forse1+ versus Forse1- cells was determined at a density of 1 RU1-eGFP cell/500 H9 [WA-09] cells. Antibodies used in this study: Monoclonal mouse antibodies: AQP4 (Abcam; 1:500), CD133 (Miltenyi Biotec; 1:50), En1 (DSHB; 1:75), Forse1 (DSHB; 1:75), GFAP (Chemicon; 1:500), HB9 (DSHB; 1:75), Human nuclear antigen (hna) (Chemicon; 1:100), Ki-67 (Dako, 1:100), MAP2 (Sigma; 1:200), Msx1 (DSHB; 1:75), N-cadherin (Sigma; 1:100), Nestin (Neuromics; 1:500), Nkx2.1 (Signet; 1:1), Oligodendrocyte marker 04 (Chemicon; 1:75), (Pax6 (DSHB; 1:75), PLZF (Calbiochem; 1:50), S100B (BD Biosciences, 1:1000), Tuj1 (Covance; 1:500), Vimentin-Cy3 (Sigma; 1:200), 3CB2 (DSHB; 1:75) and ZO-1 (BD Biosciences; 1:100). Monoclonal rat antibodies: anti-brdu (Abcam; 1:40). Polyclonal rabbit antibodies: BF-1 (kindly provided by E. Lai; 1:1000), βiii-tubulin (Covance; 1:1000), Dach1 (ProteinTech; 1:100), Olig1 (Chemicon; 1:200), Phospho Histone H3 (PH3) (Upstate; 1:1000), Sox1 (kindly provided by R. Lovell-Badge; 1:500), Sox2 (Abcam; 1:200), Zic1 (Novus Biological; 1:100) and ZO-1 (Zymed; 1:100). Polyclonal guinea-pig and goat antibodies: HoxA5 (kindly provided by T. Jessell), ChAT (Chemicon 1:200). Gobal gene expression analyses Venn Diagram Venn diagram for the three NSC samples Forse1+ P1 R-NSCs, Forse1- R-NSCs, and NSCs FGF/EGF was established using the R-statistical system and the Bioconductor microarray analysis packages. The raw Affymetrix cell files were normalized and quantitated using the GC- RMA package and the logarithm (base 2) of the expression levels were used in the subsequent analysis. To determine genes that were differentially expressed between each of the 3 differentiated samples versus undifferentiated hescs, a variant of the t-test was used as implemented in the LIMMA package from Bioconductor 1. This improves robustness of variance estimate in small sample sizes. To account for multiple testing, we used the False Discovery Rate method and applied a cutoff of 0.05 to each list. Transcripts expressed at least 5 times 1

13 higher in any of the differentiated samples compared to undifferentiated hescs were included in Venn diagram. Calculation of rosette score ( effective distance ) Maintenance of R-NSC marker profile under various treatment regimes rosette score was estimated by calculating the effective distance of each treatment condition on a vector between P1 R-NSC and NSC FGF/EGF state. To determine the relative distance and position (sign) along a linear axis for each treatment condition, we used the set of genes that were specifically expressed in P1 R-NSCs (298 genes; see Fig. 4b). Using the log (base 2) expression levels of the 298 genes, we computed the vector between Rosette and NSC state; x=nsc-rosette. This vector gives us a direction and distance in this gene expression space. We then took the vectors from P2 and P3 R-NSCs treated with SHH/FGF8, and P3 R-NSCs treated with SHH/Dll/Jag and projected them unto the NSCs FGF/EGF vector to determine the relative position of these states compared with the R-NSC state. Negative distance values indicate loss, positive values indicate and increase in rosette markers. To give a meaningful unit of distance along this vector we divided by the combined standard deviation of the NSC and Rosette replicate samples. In more precise terms we did the following. Let: x abc = (g 1,g 2,...,g 298 ) be the coordinates in the space of gene expression levels (log base 2) for the 298 genes specifically expressed in P1 R-NSCs. So xp1r NSC is the coordinates of the P1 R-NSC state and x FGF / EGF is the coordinates of the NSC FGF/EGF state and similarly for the other states. The NSC vector between two states is then defined as: v = x x FGF / EGF 1 FGF / EGF P1 R NSC, NSC P R NSC NSC Then the normalized distances ( rosette score ) are defined as: D typei v = SD v 1 P1 R NSC, R NSCregimen i FGF / EGF P1 R NSC, NSC 2 v FGF / EGF P1 R NSC, NSC 2 2 where SD = ( σp1r NSC+ σ FGF / EGF ) 2 (σ NSC X is the standard deviation of the X replicates) and the numerator is just the normal dot product between vectors and the denominator is the square of the vector length. 2

14 LEGENDS SUPPLEMENTARY IMAGES Supplementary Figure 1 Neuroepithelial and rosette features in hesc progeny using the SFEB induction protocol. Representative phase contrast images are presented. day2: Undifferentiated hescs grown as floating aggregates for 8 days and plated on Po/Lam-coated dishes for 2 days exhibit epithelial character similar to those of ES cells; day5: At 5 days after plating neuroepithelial feature emerge with cells exhibiting columnar cell shape. day 7: Cells show increased cell polarity and become radially arranged forming neural rosettes. day 40: Following FGF2/EGF mediated expansion and passaging in vitro, cells lose rosette structure and epithelial organization. Scale bar corresponds to 50 μm. Supplementary Figure 2 Forse1 marks an epitope on RA-treated NT2/D1 embryonal carcinoma cell line. The undifferentiated hesc marker SSEA-4 is presented on the surface of undifferentiated NT2/D1 cell line, but greatly reduced after RA-mediated neural differentiation (20 days of 10μM RA). In contrast, Forse1 marks a surface epitope expressed upon RAmediated neural induction of NT2/D1 cells but absent in the undifferentiated stage. Scale bar corresponds to 50 μm. Supplementary Figure 3 The induction of Forse1 expression during neural rosettes formation in hesc progeny. The Forse1 antigen is not presented on the surface of hescs at least until day 7 of neural induction (upper left panel). Forse1 expression subsequently increases gradually and by day 21 covers a large proportion of all hesc derived neural colonies (upper right and lower left panels). Scale bar corresponds to 100 μm in middle panel and 333 μm in left and right panels. Supplementary Figure 4 Forse1 co-localizes with neuroepithelial, radial glial and anterior CNS expression markers. Immunocytochemical analysis of P2 R-NSCs shows that cells expressing Forse1 also express neuroepithelial markers such as N-cadherin, radial glial markers such as vimentin and 3CB2, and anterior neural markers such as Otx2. Scale bar corresponds to 50 μm. Supplementary Figure 5 Isolation of R-NSCs by Forse1. P1 R-NSCs were dissociated and labeled for Forse1 and N-cadherin followed by FACS mediated isolation of Forse1+/Ncadherin high and Forse1-/N-cadherin high populations. (a) FACS plot for Forse1 expression. (b) FACS plot for co-expression of Forse1 and N-cadherin. (c) Forse1 expression represents approximately 30% of P1 R-NSCs. (d) Analysis of cell morphology and Forse1-FITC expression of Forse1+ and Forse1- cell populations immediately following sort. (e) Immunocytochemical analysis confirms that the vast majority of P1 R-NSCs comprised by Forse1+ and Forse1- sorted populations express the neural precursor markers nestin and musashi-1. Scale bar corresponds to 33 μm in lower right images and 100 μm in lower left images. Supplementary Figure 6 Efficiency of rosette re-formation from purified Forse1+ and Forse1- rosette stage cells. To compare the efficiency of rosette formation between Forse1 + 3

15 and Forse1 - cells, we plated Forse1 + /N-cad high and Forse1 - /N-cad high cells at a ratio of 1:500 onto stage-matched WA-09 rosette progeny sorted for the same markers (a). These data showed that Forse1 + cells efficiently form rosettes independent of the Forse1 status of the WA- 09 rosette feeder cells. Forse1 - cells were capable of rosette formation albeit at a reduced efficiency, particularly when plated on Forse1 + WA-09 rosettes (b,c). Statistical analysis: Mean ± S.E.M.; *** p < 0.001, ** p < 0.01 (comparison between Forse1 + and Forse1 - cells cocultured on Forse1+ or Forse1- cells; ANOVA) Supplementary Figure 7 Loss of Forse1 and BF1 expression in response to RA-induced caudalization. (a) Analysis of Forse1 expression and rosette morphology (phase contrast) under control conditions or upon exposure to RA. (b) Immunocytochemistry for BF1 and HoxB4 shows concomitant loss of BF1 expression and induction of HoxB4 upon RA treatment. Scale bar in (b) corresponds to 25 μm in (a) and 50 μm in (b). Supplementary Figure 8 Immunocytochemical analysis of neural crest markers in Forse1 - and NSC FGF2/EGF progeny four weeks after transplantation into the adult rat striatum (Inset shows matched in vivo immunohistochemistry for unsorted P1 rosette progeny). Scale bar corresponds to 100 μm for all panels. Supplementary Figure 9 PLZF expression in R-NSCs. Immunocytochemical analysis for PLZF in undifferentiated hescs, in P2 R-NSCs after FACS mediated separation of Forse1+ and Forse1- progeny at P1, and in NSC FGF/EGF. Scale bar corresponds to 100 μm. Supplementary Figure 10 qrt-pcr analysis of top R-NSC markers. Selected list of R-NSC specific markers from Fig. 4c was subjected to qrt-pcr analysis. These data confirmed specific enrichment in Forse1+ and Forse1- R-NSCs versus undifferentiated hescs NSCs FGF/EGF. Supplementary Figure 11 Immunohistochemical analysis of R-NSC and NSC FGF2/EGF progeny four weeks after transplantation into the adult rat striatum. Expression of R-NSC markers was largely restricted to grafts of R-NSCs and not observed in grafts derived from NSCs FGF/EGF. Right panels: PH3/Ki67 analysis revealed evidence for interkinetic nuclear migration in grafts derived from R-NSCs but not in those derived from NSCs FGF/EGF. Scale bar in corresponds to 25 μm for right and left panels and to 50 μm for middle panels. REFERENCES: 1. Smyth,G.K. Linear models and empirical bayes methods for assessing differential expression in microarray experiments. Stat. Appl. Genet. Mol. Biol. 3, Article 3 (2004). 4

Supplementary figures (Zhang)

Supplementary figures (Zhang) Supplementary figures (Zhang) Supplementary figure 1. Characterization of hesc-derived astroglia. (a) Treatment of astroglia with LIF and CNTF increases the proportion of GFAP+ cells, whereas the percentage

More information

Nature Biotechnology: doi: /nbt Supplementary Figure 1. Generation of NSCs from hpscs in SDC medium.

Nature Biotechnology: doi: /nbt Supplementary Figure 1. Generation of NSCs from hpscs in SDC medium. Supplementary Figure 1 Generation of NSCs from hpscs in SDC medium. (a) Q-PCR of pluripotent markers (OCT4, NANOG), neural markers (SOX1, PAX6, N-Cadherin), markers for the other germ layers (T, EOMES,

More information

Supplementary Figure 1: Derivation and characterization of RN ips cell lines. (a) RN ips cells maintain expression of pluripotency markers OCT4 and

Supplementary Figure 1: Derivation and characterization of RN ips cell lines. (a) RN ips cells maintain expression of pluripotency markers OCT4 and Supplementary Figure 1: Derivation and characterization of RN ips cell lines. (a) RN ips cells maintain expression of pluripotency markers OCT4 and SSEA4 after 10 passages in mtesr 1 medium. (b) Schematic

More information

Supplementary Table 1. Primary antibodies used in this study.

Supplementary Table 1. Primary antibodies used in this study. Supplementary Table 1. Primary antibodies used in this study. Antibodies Mouse monoclonal Antibody(Ab) Working dilution Oct4 1:2 Pax6 1:1 Company Notes 1 Santa Cruz Biotechnology Use only Cy3 2nd antibody

More information

Supplemental Information

Supplemental Information Cell Stem Cell, Volume 12 Supplemental Information Human ipsc-derived Oligodendrocyte Progenitor Cells Can Myelinate and Rescue a Mouse Model of Congenital Hypomyelination Su Wang, Janna Bates, Xiaojie

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. Effect of timing of DE dissociation and RA concentration on lung field specification in hpscs. (a) Effect of duration of endoderm induction on expression of

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature22047 Supplementary discussion Overall developmental timeline and brain regionalization in human whole-brain organoids We first defined the timeline of generation of broadly-defined cell

More information

To isolate single GNS 144 cell clones, cells were plated at a density of 1cell/well

To isolate single GNS 144 cell clones, cells were plated at a density of 1cell/well Supplemental Information: Supplemental Methods: Cell culture To isolate single GNS 144 cell clones, cells were plated at a density of 1cell/well in 96 well Primaria plates in GNS media and incubated at

More information

SUPPLEMENTARY FIGURES AND VIDEOS

SUPPLEMENTARY FIGURES AND VIDEOS SUPPLEMENTARY FIGURES AND VIDEOS Supplementary Figure 1. Generation of Human Intestinal Organoids (HIOs). (a) Method for generating HIOs through directed differentiation of human pluripotent stem cells.

More information

A population of Nestin expressing progenitors in the cerebellum exhibits increased tumorigenicity

A population of Nestin expressing progenitors in the cerebellum exhibits increased tumorigenicity A population of Nestin expressing progenitors in the cerebellum exhibits increased tumorigenicity Peng Li 1,2, Fang Du 1, Larra W. Yuelling 1, Tiffany Lin 3, Renata E. Muradimova 1, Rossella Tricarico

More information

Supplementary Figure 1. Soft fibrin gels promote growth and organized mesodermal differentiation. Representative images of single OGTR1 ESCs cultured

Supplementary Figure 1. Soft fibrin gels promote growth and organized mesodermal differentiation. Representative images of single OGTR1 ESCs cultured Supplementary Figure 1. Soft fibrin gels promote growth and organized mesodermal differentiation. Representative images of single OGTR1 ESCs cultured in 90-Pa 3D fibrin gels for 5 days in the presence

More information

Supplementary Figure 1.

Supplementary Figure 1. Supplementary Figure 1. (A) UCSC Genome Browser view of region immediately downstream of the NEUROG3 start codon. All candidate grna target sites which meet the G(N 19 )NGG constraint are aligned to illustrate

More information

Supplementary Data. Supplementary Methods Three-step protocol for spontaneous differentiation of mouse induced pluripotent stem (embryonic stem) cells

Supplementary Data. Supplementary Methods Three-step protocol for spontaneous differentiation of mouse induced pluripotent stem (embryonic stem) cells Supplementary Data Supplementary Methods Three-step protocol for spontaneous differentiation of mouse induced pluripotent stem (embryonic stem) cells Mouse induced pluripotent stem cells (ipscs) were cultured

More information

Supplementary Figure 1. Western analysis of p-smad1/5/8 of differentiated hescs.

Supplementary Figure 1. Western analysis of p-smad1/5/8 of differentiated hescs. kda 65 45 45 35 Supplementary Figure 1. Western analysis of p-smad1/5/8 of differentiated hescs. H9 hescs were differentiated with or without BMP4+BMP8A and cell lysates were collected for Western analysis

More information

Supplementary Figure S1. Alterations in Fzr1( / );Nestin-Cre brains. (a) P10 Cdh1-deficient brains display low levels of Myelin basic protein (MBP)

Supplementary Figure S1. Alterations in Fzr1( / );Nestin-Cre brains. (a) P10 Cdh1-deficient brains display low levels of Myelin basic protein (MBP) Supplementary Figure S1. Alterations in Fzr1( / );Nestin-Cre brains. (a) P10 Cdh1-deficient brains display low levels of Myelin basic protein (MBP) in the cortex (area 1 as defined in Fig. 2a), and corpus

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Fig. S1. Specificity of perilipin antibody in SAT compared to various organs. (A) Images of SAT at E18.5 stained with perilipin and CD31 antibody. Scale bars: 100 μm. SAT stained

More information

Supplementary Information

Supplementary Information Supplementary Information Supplementary Figures Supplementary Figure 1. qrt-pcr analysis of the expression of candidate factors including SOX2, MITF, PAX3, DLX5, FOXD3, LEF1, MSX1, PAX6, SOX2 and SOX9

More information

Positive selection gates for the collection of LRCs or nonlrcs had to be drawn based on the location and

Positive selection gates for the collection of LRCs or nonlrcs had to be drawn based on the location and Determining positive selection gates for LRCs and nonlrcs Positive selection gates for the collection of LRCs or nonlrcs had to be drawn based on the location and shape of the Gaussian distributions. For

More information

Measurement of peritoneal macrophage apoptosis by Celigo plate imaging cytometer

Measurement of peritoneal macrophage apoptosis by Celigo plate imaging cytometer SUPPLEMENTAL METHODS Measurement of peritoneal macrophage apoptosis by Celigo plate imaging cytometer For Celigo experiments, 0.1 ml containing 5 x 10 4 cells was seeded into 96 well plates for 30 min

More information

Nature Biotechnology: doi: /nbt Supplementary Figure 1

Nature Biotechnology: doi: /nbt Supplementary Figure 1 Supplementary Figure 1 Schematic and results of screening the combinatorial antibody library for Sox2 replacement activity. A single batch of MEFs were plated and transduced with doxycycline inducible

More information

Chromatin immunoprecipitation (ChIP) ES and FACS-sorted GFP+/Flk1+ cells were fixed in 1% formaldehyde and sonicated until fragments of an average

Chromatin immunoprecipitation (ChIP) ES and FACS-sorted GFP+/Flk1+ cells were fixed in 1% formaldehyde and sonicated until fragments of an average Chromatin immunoprecipitation (ChIP) ES and FACS-sorted cells were fixed in % formaldehyde and sonicated until fragments of an average size of 5 bp were obtained. Soluble, sheared chromatin was diluted

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Supplementary Figure 1. Functional assays of hepatocyte-like cells induced from H1 hescs (a) P450 and AAT staining, PAS staining, LDL uptake assay, and ICG uptake and release assay

More information

The Ultimate Low Cell Binding Surface

The Ultimate Low Cell Binding Surface The Ultimate Low Cell Binding Surface Thermo Scientific Nunc HydroCell Surface SINGLE CELL CULTURES Grow cells that are sensitive to activation and differentiation signals arising from cell adhesion CELL

More information

Culture and differentiation of embryonic stem cells. Hong-Lin Su Department of Life Sciences, National Chung-Hsing University

Culture and differentiation of embryonic stem cells. Hong-Lin Su Department of Life Sciences, National Chung-Hsing University Culture and differentiation of embryonic stem cells Hong-Lin Su Department of Life Sciences, National Chung-Hsing University Topics-ES cell maintenance Establishment Culture condition, including the serum,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION DOI: 1.138/NMAT3777 Biophysical regulation of epigenetic state and cell reprogramming Authors: Timothy L. Downing 1,2, Jennifer Soto 1,2, Constant Morez 2,3,, Timothee Houssin

More information

Supplementary Figure Legends

Supplementary Figure Legends Supplementary Figure Legends Supplementary Fig. 1. The third PDZ domain of PAR-3 and the C-terminal PDZ domain binding motif of VE-cadherin mediate the recruitment of PAR-3 to cell-cell contacts in cells.

More information

Isolation and Analysis of Pluripotent, Neural, and Hematopoietic Stem Cells

Isolation and Analysis of Pluripotent, Neural, and Hematopoietic Stem Cells Isolation and Analysis of Pluripotent, Neural, and Hematopoietic Stem Cells Christian Carson BD Biosciences R&D Scientist Stem Cell 23-10679-00 Overview Introduction Challenges in stem cell research Antibody

More information

Supplementary Fig. S1. Schematic representation of mouse lines Pax6 fl/fl and mrx-cre used in this study. (A) To generate Pax6 fl/ fl

Supplementary Fig. S1. Schematic representation of mouse lines Pax6 fl/fl and mrx-cre used in this study. (A) To generate Pax6 fl/ fl Supplementary Fig. S1. Schematic representation of mouse lines Pax6 fl/fl and mrx-cre used in this study. (A) To generate Pax6 fl/ fl, loxp sites flanking exons 3-6 (red arrowheads) were introduced into

More information

Components Neural induction basal medium (Cat. # ) 100 ml x 5 Neural induction medium supplement 50x (Cat. # ) 2 ml x 5

Components Neural induction basal medium (Cat. # ) 100 ml x 5 Neural induction medium supplement 50x (Cat. # ) 2 ml x 5 HPSC Neural Induction Medium (PSCNIM) Catalog #5931 Introduction Human embryonic stem cells (hesc) and induced pluripotent stem cells (hipsc) possess the capability of differentiating into all derivatives

More information

Figure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion

Figure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion Stem Cell Reports, Volume 1 Supplemental Information Robust Self-Renewal of Rat Embryonic Stem Cells Requires Fine-Tuning of Glycogen Synthase Kinase-3 Inhibition Yaoyao Chen, Kathryn Blair, and Austin

More information

Isolation of human ips cells using EOS lentiviral vectors to select for pluripotency

Isolation of human ips cells using EOS lentiviral vectors to select for pluripotency nature methods Isolation of human ips cells using EOS lentiviral vectors to select for pluripotency Akitsu Hotta, Aaron Y L Cheung, Natalie Farra, Kausalia Vijayaragavan, Cheryle A Séguin, Jonathan S Draper,

More information

Development 142: doi: /dev : Supplementary Material

Development 142: doi: /dev : Supplementary Material Development 142: doi:1.42/dev.11687: Supplementary Material Figure S1 - Relative expression of lineage markers in single ES cell and cardiomyocyte by real-time quantitative PCR analysis. Single ES cell

More information

SUPPLEMENTARY FIG. S9. Morphology and DNA staining of cipsc-differentiated trophoblast cell-like cell. Scale bar: 100 mm. SUPPLEMENTARY FIG. S10.

SUPPLEMENTARY FIG. S9. Morphology and DNA staining of cipsc-differentiated trophoblast cell-like cell. Scale bar: 100 mm. SUPPLEMENTARY FIG. S10. Supplementary Data SUPPLEMENTARY FIG. S1. Lentivirus-infected canine fibroblasts show YFP expression. (A, B) Uninfected canine skin fibroblasts (CSFs); (C, D) infected CSFs; (E, F) uninfected CTFs; (G,

More information

Rapid differentiation of human pluripotent stem cells into functional motor neurons by

Rapid differentiation of human pluripotent stem cells into functional motor neurons by Supplementary Information Rapid differentiation of human pluripotent stem cells into functional motor neurons by mrnas encoding transcription factors Sravan Kumar Goparaju, Kazuhisa Kohda, Keiji Ibata,

More information

Supplementary Fig. 1. (A) Working model. The pluripotency transcription factor OCT4

Supplementary Fig. 1. (A) Working model. The pluripotency transcription factor OCT4 SUPPLEMENTARY FIGURE LEGENDS Supplementary Fig. 1. (A) Working model. The pluripotency transcription factor OCT4 directly up-regulates the expression of NIPP1 and CCNF that together inhibit protein phosphatase

More information

Supplementary Figure 1. Characterization of hipscs derived from primary human fibroblasts. a,b. Morphology of hipscs. hipscs exhibit hesc-like

Supplementary Figure 1. Characterization of hipscs derived from primary human fibroblasts. a,b. Morphology of hipscs. hipscs exhibit hesc-like Supplementary Figure 1. Characterization of hipscs derived from primary human fibroblasts. a,b. Morphology of hipscs. hipscs exhibit hesc-like morphology in co-culture with mouse embryonic feeder fibroblasts

More information

Remyelination after cell transplantation is a potential

Remyelination after cell transplantation is a potential STEM CELLS AND DEVELOPMENT Volume 25, Number 9, 2016 Ó Mary Ann Liebert, Inc. DOI: 10.1089/scd.2015.0244 Enrichment of Oligodendrocyte Progenitors from Differentiated Neural Precursors by Clonal Sphere

More information

0.9 5 H M L E R -C tr l in T w is t1 C M

0.9 5 H M L E R -C tr l in T w is t1 C M a. b. c. d. e. f. g. h. 2.5 C elltiter-g lo A ssay 1.1 5 M T S a s s a y Lum inescence (A.U.) 2.0 1.5 1.0 0.5 n s H M L E R -C tr l in C tr l C M H M L E R -C tr l in S n a il1 C M A bsorbance (@ 490nm

More information

Figure S1. Phenotypic characterization of AND-1_WASKO cell lines. AND- 1_WASKO_C1.1 (WASKO_C1.1) and AND-1_WASKO_C1.2 (WASKO_C1.

Figure S1. Phenotypic characterization of AND-1_WASKO cell lines. AND- 1_WASKO_C1.1 (WASKO_C1.1) and AND-1_WASKO_C1.2 (WASKO_C1. LEGENDS TO SUPPLEMENTARY FIGURES Figure S1. Phenotypic characterization of AND-1_WASKO cell lines. AND- 1_WASKO_C1.1 (WASKO_C1.1) and AND-1_WASKO_C1.2 (WASKO_C1.2) were stained with the antibodies oct3/4

More information

Notch1 (forward: 5 -TGCCTGTGCACACCATTCTGC-3, reverse: Notch2 (forward: 5 -ATGCACCATGACATCGTTCG-3, reverse:

Notch1 (forward: 5 -TGCCTGTGCACACCATTCTGC-3, reverse: Notch2 (forward: 5 -ATGCACCATGACATCGTTCG-3, reverse: Supplementary Information Supplementary Methods. RT-PCR. For mouse ES cells, the primers used were: Notch1 (forward: 5 -TGCCTGTGCACACCATTCTGC-3, reverse: 5 -CAATCAGAGATGTTGGAATGC-3 ) 1, Notch2 (forward:

More information

Mutagenesis and generation of expression vectors Gene expression profiling Lentiviral production and infection of TF1 cells

Mutagenesis and generation of expression vectors Gene expression profiling Lentiviral production and infection of TF1 cells Mutagenesis and generation of expression vectors Human c-kit wild-type cdna encoding the short c-kit isoform was excised from vector pbshkitwt (kind gift from Dr. L Gros, France) by Sal I-Acc65 I digestion.

More information

Sundari Chetty, Felicia Walton Pagliuca, Christian Honore, Anastasie Kweudjeu, Alireza Rezania, and Douglas A. Melton

Sundari Chetty, Felicia Walton Pagliuca, Christian Honore, Anastasie Kweudjeu, Alireza Rezania, and Douglas A. Melton A simple tool to improve pluripotent stem cell differentiation Sundari Chetty, Felicia Walton Pagliuca, Christian Honore, Anastasie Kweudjeu, Alireza Rezania, and Douglas A. Melton Supplementary Information

More information

Neural Stem Cells (ipsc from Blood Cells; Male)

Neural Stem Cells (ipsc from Blood Cells; Male) Applied StemCell, Inc. (866) 497-4180 www.appliedstemcell.com Datasheet Neural Stem Cells (ipsc from Blood Cells; Male) Product Information Catalog Number ASE-9234 (Male) Description Applied StemCell's

More information

Contribution and Mobilization of Mesenchymal Stem Cells in a mouse model of carbon tetrachloride-induced liver fibrosis

Contribution and Mobilization of Mesenchymal Stem Cells in a mouse model of carbon tetrachloride-induced liver fibrosis Contribution and Mobilization of Mesenchymal Stem Cells in a mouse model of carbon tetrachloride-induced liver fibrosis Yan Liu 1,*, Zhipeng Han 1,*, Yingying Jing 1,*, Xue Yang 1, Shanshan Zhang 1, Chen

More information

Differentiation of Human Embryonic Stem Cell (hesc) Derived Pyramidal Neurons

Differentiation of Human Embryonic Stem Cell (hesc) Derived Pyramidal Neurons University of Connecticut DigitalCommons@UConn Honors Scholar Theses Honors Scholar Program Spring 5-10-2009 Differentiation of Human Embryonic Stem Cell (hesc) Derived Pyramidal Neurons Eagan Jacqueline

More information

Xeno-Free Systems for hesc & hipsc. Facilitating the shift from Stem Cell Research to Clinical Applications

Xeno-Free Systems for hesc & hipsc. Facilitating the shift from Stem Cell Research to Clinical Applications Xeno-Free Systems for hesc & hipsc Facilitating the shift from Stem Cell Research to Clinical Applications NutriStem Defined, xeno-free (XF), serum-free media (SFM) specially formulated for growth and

More information

A Novel Platform to Enable the High-Throughput Derivation and Characterization of Feeder-Free Human ipscs

A Novel Platform to Enable the High-Throughput Derivation and Characterization of Feeder-Free Human ipscs Supplementary Information A Novel Platform to Enable the High-Throughput Derivation and Characterization of Feeder-Free Human ipscs Bahram Valamehr, Ramzey Abujarour, Megan Robinson, Thuy Le, David Robbins,

More information

Supplementary Figure 1.

Supplementary Figure 1. Supplementary Figure 1. Quantification of western blot analysis of fibroblasts (related to Figure 1) (A-F) Quantification of western blot analysis for control and IR-Mut fibroblasts. Data are expressed

More information

Mouse/Rat Neural Stem Cell Functional Identification Kit

Mouse/Rat Neural Stem Cell Functional Identification Kit Mouse/Rat Neural Stem Cell Functional Identification Kit Catalog Number SC013 Reagents for the identification of mouse/rat Neural Stem Cells (NSCs) by in vitro functional differentiation. This package

More information

produced in this study characterized using 3-8 % gradient SDS-PAGE under reducing

produced in this study characterized using 3-8 % gradient SDS-PAGE under reducing Supplementary Figure 1 Characterisation of newly produced laminins. Human recombinant LN-521 produced in this study characterized using 3-8 % gradient SDS-PAGE under reducing 1 and non-reducing conditions.

More information

Supplementary information. Modulated DISP3/PTCHD2 expression influences neural stem cell fate decisions

Supplementary information. Modulated DISP3/PTCHD2 expression influences neural stem cell fate decisions Modulated DISP3/PTCHD2 expression influences neural stem cell fate decisions Jana Konířová, Jana Oltová, Alicia Corlett, Justyna Kopycińska, Michal Kolář, Petr Bartůněk* and Martina Zíková* Institute of

More information

Supplemental material

Supplemental material Supplemental material THE JOURNAL OF CELL BIOLOGY Taylor et al., http://www.jcb.org/cgi/content/full/jcb.201403021/dc1 Figure S1. Representative images of Cav 1a -YFP mutants with and without LMB treatment.

More information

Supporting Figure 1: Meis2 and Pax6 transcripts in the adult murine brain detected by in situ

Supporting Figure 1: Meis2 and Pax6 transcripts in the adult murine brain detected by in situ DEVELOP2013097295_supplementary figures Supporting Figure 1: Meis2 and Pax6 transcripts in the adult murine brain detected by in situ hybridization on vibratome sections. (A) Meis2-specific transcripts

More information

Supplementary Figure 1. Reconstitution of human-acquired lymphoid system in

Supplementary Figure 1. Reconstitution of human-acquired lymphoid system in Supplementary Figure 1. Reconstitution of human-acquired lymphoid system in mouse NOD/SCID/Jak3 null mice were transplanted with human CD34 + hematopoietic stem cells. (Top) Four weeks after the transplantation

More information

Flow cytometry Stained cells were analyzed and sorted by SORP FACS Aria (BD Biosciences).

Flow cytometry Stained cells were analyzed and sorted by SORP FACS Aria (BD Biosciences). Mice C57BL/6-Ly5.1 or -Ly5.2 congenic mice were used for LSK transduction and competitive repopulation assays. Animal care was in accordance with the guidelines of Keio University for animal and recombinant

More information

Formation of Embryonic Bodies to Produce Neural Stem Cells from ipscs Using the Corning Spheroid Microplate

Formation of Embryonic Bodies to Produce Neural Stem Cells from ipscs Using the Corning Spheroid Microplate Formation of Embryonic Bodies to Produce Neural Stem Cells from ipscs Using the Corning Spheroid Microplate Application Note Wesley Hung and Joanne Hsu Corning Research Center Taiwan, Science & Technology

More information

Supplemental Information Inventory

Supplemental Information Inventory Cell Stem Cell, Volume 6 Supplemental Information Distinct Hematopoietic Stem Cell Subtypes Are Differentially Regulated by TGF-β1 Grant A. Challen, Nathan C. Boles, Stuart M. Chambers, and Margaret A.

More information

Cancer cells that survive radiation therapy acquire HIF-1 activity and translocate toward tumor blood vessels Supplementary Information

Cancer cells that survive radiation therapy acquire HIF-1 activity and translocate toward tumor blood vessels Supplementary Information Cancer cells that survive radiation therapy acquire HIF-1 activity and translocate toward tumor blood vessels Supplementary Information 1. Supplementary Figure S1-S10: Pages 2-11 2. Supplementary References:

More information

Protocol Using the Reprogramming Ecotropic Retrovirus Set: Mouse OSKM to Reprogram MEFs into ips Cells

Protocol Using the Reprogramming Ecotropic Retrovirus Set: Mouse OSKM to Reprogram MEFs into ips Cells STEMGENT Page 1 OVERVIEW The following protocol describes the reprogramming of one well of mouse embryonic fibroblast (MEF) cells into induced pluripotent stem (ips) cells in a 6-well format. Transduction

More information

Supplementary Figure 1. Phenotype, morphology and distribution of embryonic GFP +

Supplementary Figure 1. Phenotype, morphology and distribution of embryonic GFP + Supplementary Figure 1 Supplementary Figure 1. Phenotype, morphology and distribution of embryonic GFP + haematopoietic cells in the intestine. GFP + cells from E15.5 intestines were obtained after collagenase

More information

Supplementary Figure 1: Analysis of monocyte subsets and lineage relationships. (a) Gating strategy for definition of MDP and cmop populations in BM

Supplementary Figure 1: Analysis of monocyte subsets and lineage relationships. (a) Gating strategy for definition of MDP and cmop populations in BM Supplementary Figure 1: Analysis of monocyte subsets and lineage relationships. (a) Gating strategy for definition of MDP and cmop populations in BM of Cx3cr1 GFP/+ mice related to Fig. 1a. MDP was defined

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION a before amputation regeneration regenerated limb DERMIS SKELETON MUSCLE SCHWANN CELLS EPIDERMIS DERMIS SKELETON MUSCLE SCHWANN CELLS EPIDERMIS developmental origin: lateral plate mesoderm presomitic mesoderm

More information

Artificial niche microarrays for probing single-stem-cell fate in high throughput

Artificial niche microarrays for probing single-stem-cell fate in high throughput Nature Methods Artificial niche microarrays for probing single-stem-cell fate in high throughput Samy Gobaa, Sylke Hoehnel, Marta Roccio, Andrea Negro, Stefan Kobel & Matthias P Lutolf Supplementary Figure

More information

Derivation of UCSFB lines from biopsied blastomeres of cleavage-stage human. Spare embryos were obtained through the UCSF IVF Tissue Bank from donors

Derivation of UCSFB lines from biopsied blastomeres of cleavage-stage human. Spare embryos were obtained through the UCSF IVF Tissue Bank from donors Supplementary Materials and Methods Derivation of UCSFB lines from biopsied blastomeres of cleavage-stage human embryos Spare embryos were obtained through the UCSF IVF Tissue Bank from donors undergoing

More information

Supporting Online Material. Methods

Supporting Online Material. Methods Supporting Online Material Methods Cell culture Cells were prepared from muscle tissue by enzymatic dissociation as previously described. Cells were plated on gelatin coated dishes in a 1:1mixture (v/v)

More information

IKK is a therapeutic target in KRAS-induced lung cancer with disrupted p53 activity

IKK is a therapeutic target in KRAS-induced lung cancer with disrupted p53 activity IKK is a therapeutic target in KRAS-induced lung cancer with disrupted p5 activity H6 5 5 H58 A59 H6 H58 A59 anti-ikkα anti-ikkβ anti-panras anti-gapdh anti-ikkα anti-ikkβ anti-panras anti-gapdh anti-ikkα

More information

ANNOUNCEMENTS. HW2 is due Thursday 2/4 by 12:00 pm. Office hours: Monday 12:50 1:20 (ECCH 134)

ANNOUNCEMENTS. HW2 is due Thursday 2/4 by 12:00 pm. Office hours: Monday 12:50 1:20 (ECCH 134) ANNOUNCEMENTS HW2 is due Thursday 2/4 by 12:00 pm. Office hours: Monday 12:50 1:20 (ECCH 134) Lectures 6 8 Outline Stem Cell Division - symmetric - asymmetric Stem cell lineage potential - pluripotent

More information

Selective Generation of Dopaminergic Precursors from Mouse Fibroblasts by Direct

Selective Generation of Dopaminergic Precursors from Mouse Fibroblasts by Direct SUPPLEMENARY INFORMATION Selective Generation of Dopaminergic Precursors from Mouse Fibroblasts by Direct Lineage Conversion Changhai Tian 1,2,5,#,ξ, Yuju Li 2,5,#,Yunlong Huang 1,2,5,#, Yongxiang Wang

More information

Neural Stem Cell Characterization Kit

Neural Stem Cell Characterization Kit Neural Stem Cell Characterization Kit Catalog No. SCR019 FOR RESEARCH USE ONLY Not for use in diagnostic procedures USA & Canada Phone: +1(800) 437-7500 Fax: +1 (951) 676-9209 Europe +44 (0) 23 8026 2233

More information

Supplemental Tables Supplemental Table 1. Phenotypic profile of different HSC lines. Marker d0 mhsc d7 mhsc 8B LX2 CD11b 3.61% 2.21% 2.16% 3.77% F4/80 4.54% 2.05% 0.127% 1.44% Elastin 3.90% 2.95% 4.23%

More information

SOX2 antibody - Embryonic Stem Cell Marker (ab15830) datasheet

SOX2 antibody - Embryonic Stem Cell Marker (ab15830) datasheet -Embryonic Stem Cell Marker (ab15830) 1/8 ページ d Products: Stem Cells >> Germline Stem Cells >> Embryonic Germ Cells SOX2 antibody - Embryonic Stem Cell Marker (ab15830) datasheet Product Name Product type

More information

Supplemental Figures Supplemental Figure 1

Supplemental Figures Supplemental Figure 1 Supplemental Figures Supplemental Figure 1 The de novo and salvage purine synthesis pathways are shown converging on GMP synthesis (A). Enzymes and intermediates not involved in MPA action and/or guanosine

More information

Table of Contents. 2.1 NeuroCult NCFC Assay Kit (Rat) Components Additional Required Reagents Required Equipment...

Table of Contents. 2.1 NeuroCult NCFC Assay Kit (Rat) Components Additional Required Reagents Required Equipment... i Table of Contents 1.0 Overview of the NeuroCult NCFC Assay 2.0 Materials 2.1 NeuroCult NCFC Assay Kit (Rat) Components... 4 2.2 Additional Required Reagents... 4 2.3 Required Equipment... 4 3.0 Preparation

More information

Supplementary Figure 1 Characterization of OKSM-iNSCs

Supplementary Figure 1 Characterization of OKSM-iNSCs Supplementary Figure 1 Characterization of OKSM-iNSCs (A) Gene expression levels of Sox1 and Sox2 in the indicated cell types by microarray gene expression analysis. (B) Dendrogram cluster analysis of

More information

Gene name forward primer 5->3 reverse primer 5->3 product GCCCATA. Nfatc1 AGGTGCAGCCCAAGTCTCAC GTGGCCATCTGGAGCCTTC CTGT GATGC GCT ACCAA

Gene name forward primer 5->3 reverse primer 5->3 product GCCCATA. Nfatc1 AGGTGCAGCCCAAGTCTCAC GTGGCCATCTGGAGCCTTC CTGT GATGC GCT ACCAA Supplementary able 1 is presenting the PCR primer list used. ene name forward primer 5->3 reverse primer 5->3 product size cdna VE-Cadherin AACCCAAAAA CACCCCAAAAC 260bp CCA CCCAA PECAM-1 CACCACAA CCCCCACC

More information

Electromagnetic Fields Mediate Efficient Cell Reprogramming Into a Pluripotent State

Electromagnetic Fields Mediate Efficient Cell Reprogramming Into a Pluripotent State Electromagnetic Fields Mediate Efficient Cell Reprogramming Into a Pluripotent State Soonbong Baek, 1 Xiaoyuan Quan, 1 Soochan Kim, 2 Christopher Lengner, 3 Jung- Keug Park, 4 and Jongpil Kim 1* 1 Lab

More information

Protocol Reprogramming MEFs using the Dox Inducible Reprogramming Lentivirus Set: Mouse OKSM

Protocol Reprogramming MEFs using the Dox Inducible Reprogramming Lentivirus Set: Mouse OKSM STEMGENT Page 1 OVERVIEW The following protocol describes the reprogramming of one well of mouse embryonic fibroblasts (MEFs) into induced pluripotent stem (ips) cells in a 6-well format. Transduction

More information

Directed differentiation of human embryonic stem cells

Directed differentiation of human embryonic stem cells Directed differentiation of human embryonic stem cells TECAN Symposium 2008 Biologics - From Benchtop to Production Wednesday 17 September 2008 Andrew Elefanty Embryonic Stem Cell Differentiation Laboratory,

More information

Multiple layers of B cell memory with different effector functions. Ismail Dogan, Barbara Bertocci, Valérie Vilmont, Frédéric Delbos,

Multiple layers of B cell memory with different effector functions. Ismail Dogan, Barbara Bertocci, Valérie Vilmont, Frédéric Delbos, Multiple layers of B cell memory with different effector functions Ismail Dogan, Barbara Bertocci, Valérie Vilmont, Frédéric Delbos, Jérome Mégret, Sébastien Storck, Claude-Agnès Reynaud & Jean-Claude

More information

supplementary information

supplementary information DOI: 10.1038/ncb2015 Figure S1 Confirmation of Sca-1 CD34 stain specificity using isotypematched control antibodies. Skeletal muscle preparations were stained and gated as described in the text (Hoechst

More information

Inventory of Supplemental Information for Melkman-Zehavi et al.

Inventory of Supplemental Information for Melkman-Zehavi et al. Inventory of Supplemental Information for Melkman-Zehavi et al. Supplementary methods for Melkman et al. Supplementary Figures Figure S1, related to Figure 2 Islet size and total beta cell mass of mutant

More information

Supplementary Protocol. sirna transfection methodology and performance

Supplementary Protocol. sirna transfection methodology and performance Supplementary Protocol sirna transfection methodology and performance sirna oligonucleotides, DNA construct and cell line. Chemically synthesized 21 nt RNA duplexes were obtained from Ambion Europe, Ltd.

More information

a, b-immnunostainings of lcmn and SSM tissue for HMB45 (A, left panel) and CD44 (B, left panel) using

a, b-immnunostainings of lcmn and SSM tissue for HMB45 (A, left panel) and CD44 (B, left panel) using Figure S1 a HMB45 HMB45 + cells (% of total cells) 15 1 5 CD44 CD44 + cells (% of total cells) 25 2 15 1 5 In vivo characterization of. a, -Immnunostainings of and tissue for HMB45 (A, left panel) and

More information

Table S1. Components for knockout serum replacer medium (KSR medium) (500 ml) Component Supplier Catalogue number

Table S1. Components for knockout serum replacer medium (KSR medium) (500 ml) Component Supplier Catalogue number Table S1. Components for knockout serum replacer medium (KSR medium) (500 ml) Component Supplier Catalogue number Stock Concentration Final concentration Volume used Advanced DMEM/F12 Invitrogen 12634010-78%

More information

hpsc Growth Medium DXF Dr. Lorna Whyte

hpsc Growth Medium DXF Dr. Lorna Whyte hpsc Growth Medium DXF Dr. Lorna Whyte 27.06.2014 Training from Heidelberg Overview Background: Stem Cells Introduction: Human Pluripotent Stem Cells (hpsc) vs. Adult Stem Cells Promise of PSC Research

More information

Supplemental Data. Self-Organized Formation of Polarized. Cortical Tissues from ESCs and Its Active. Manipulation by Extrinsic Signals

Supplemental Data. Self-Organized Formation of Polarized. Cortical Tissues from ESCs and Its Active. Manipulation by Extrinsic Signals Cell Stem Cell, Volume 3 Supplemental Data Self-Organized Formation of Polarized Cortical Tissues from ESCs and Its Active Manipulation by Extrinsic Signals Mototsugu Eiraku, Kiichi Watanabe, Mami Matsuo-Takasaki,

More information

Rat Cortical Stem Cells

Rat Cortical Stem Cells Rat Cortical Stem Cells Catalog Number NSC001 For cortical stem cell expansion and differentiation into neurons, astrocytes, and oligodendrocytes. This package insert must be read in its entirety before

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature09941 Supplementary Figures and legends Supplementary Fig. 1 Eye-cup formation in vivo and in ESC culture. a, Schematic of in vivo retinal development. b, SFEBq culture for retinal induction.

More information

Supplemental Information Control of apico-basal epithelial polarity by the microtubule minus-end binding protein CAMSAP3 and spectraplakin ACF7

Supplemental Information Control of apico-basal epithelial polarity by the microtubule minus-end binding protein CAMSAP3 and spectraplakin ACF7 Supplemental Information Control of apico-basal epithelial polarity by the microtubule minus-end binding protein CAMSAP3 and spectraplakin ACF7 Ivar Noordstra, Qingyang Liu, Wilco Nijenhuis, Shasha Hua,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTAY INOMATION igure S1 Knockdown of endogenous HI-1α by short-interference NA (sina) reverts EMT and metastatic phenotypes in H1299 cells and in ADU or MC-7 cells undergoing hypoxia. a. Western

More information

A20 Ubiquitin Ligase-Mediated Polyubiquitination of RIP1 Inhibits Caspase-8 Cleavage and TRAIL-Induced Apoptosis in Glioblastoma

A20 Ubiquitin Ligase-Mediated Polyubiquitination of RIP1 Inhibits Caspase-8 Cleavage and TRAIL-Induced Apoptosis in Glioblastoma A20 Ubiquitin Ligase-Mediated Polyubiquitination of RIP1 Inhibits Caspase-8 Cleavage and TRAIL-Induced Apoptosis in Glioblastoma Anita C. Bellail, Jeffrey J. Olson, Xiaolu Yang, Zhijian J. Chen, and Chunhai

More information

Nodal expression was directly inhibited using antisense Morpholino oligonucleotides

Nodal expression was directly inhibited using antisense Morpholino oligonucleotides Supplementary Note Rationale for Morpholino based inhibition of Nodal expression Nodal expression was directly inhibited using antisense Morpholino oligonucleotides (MO Nodal ) fluorescently labeled with

More information

Supplementary Figure 1 (related to Figure 2) Activation of microglia at early stages after light lesion. In the unlesioned retina, resident microglia

Supplementary Figure 1 (related to Figure 2) Activation of microglia at early stages after light lesion. In the unlesioned retina, resident microglia Supplementary Figure 1 (related to Figure 2) Activation of microglia at early stages after light lesion. In the unlesioned retina, resident microglia labeled with the specific marker 4C4 (magenta) are

More information

All quality control test results are reported on a lot specific Certificate of Analysis which is available at or upon request.

All quality control test results are reported on a lot specific Certificate of Analysis which is available at   or upon request. PRIME-XV Neural Basal Medium PRIME-XV Neural Basal Medium is a chemically-defined basal medium optimized for the culture and maintenance of neuronal cells when supplemented with PRIME-XV IS21 Supplement

More information

INTESTINAL ORGANOIDS. IntestiCult and STEMdiff Media for Intestinal Organoid Culture. Scientists Helping Scientists

INTESTINAL ORGANOIDS. IntestiCult and STEMdiff Media for Intestinal Organoid Culture. Scientists Helping Scientists INTESTINAL ORGANOIDS IntestiCult and STEMdiff Media for Intestinal Organoid Culture Scientists Helping Scientists WWW.STEMCELL.COM CULTURING INTESTINAL ORGANOIDS TABLE OF CONTENTS 3 Introduction 4 IntestiCult

More information

MicroRNAs Modulate Hematopoietic Lineage Differentiation

MicroRNAs Modulate Hematopoietic Lineage Differentiation Chen et al., page 1 MicroRNAs Modulate Hematopoietic Lineage Differentiation Chang-Zheng Chen, Ling Li, Harvey F. Lodish, David. Bartel Supplemental Online Material Methods Cell isolation Murine bone marrow

More information

TITLE: Preclinical Studies of Induced Pluripotent Stem Cell-Derived Astrocyte Transplantation in ALS

TITLE: Preclinical Studies of Induced Pluripotent Stem Cell-Derived Astrocyte Transplantation in ALS AD Award Number: W81XWH-10-1-050 TITLE: Preclinical Studies of Induced Pluripotent Stem Cell-Derived Astrocyte Transplantation in ALS PRINCIPAL INVESTIGATOR: Nicholas J. Maragakis, M.D. Hongjun Song, Ph.D.

More information

Supplementary Figure 1. Isolation of GFPHigh cells.

Supplementary Figure 1. Isolation of GFPHigh cells. Supplementary Figure 1. Isolation of GFP High cells. (A) Schematic diagram of cell isolation based on Wnt signaling activity. Colorectal cancer (CRC) cell lines were stably transduced with lentivirus encoding

More information

initial single-cell analysis, with a pragmatic focus on surface markers with the highest potential for

initial single-cell analysis, with a pragmatic focus on surface markers with the highest potential for Supplementary Figure 1: Summary of the exclusionary approach to surface marker selection for initial single-cell analysis, with a pragmatic focus on surface markers with the highest potential for protein

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:.38/nature899 Supplementary Figure Suzuki et al. a c p7 -/- / WT ratio (+)/(-) p7 -/- / WT ratio Log X 3. Fold change by treatment ( (+)/(-)) Log X.5 3-3. -. b Fold change by treatment ( (+)/(-)) 8

More information