From Poisson Approximations to the Blueprint of Life
|
|
- Solomon Miller
- 5 years ago
- Views:
Transcription
1 From Poisson Approximations to the Blueprint of Life Ming-Ying Leung Division of Mathematics and Statistics University of Texas at San Antonio San Antonio, TX Outline: DNA sequence Analysis Scan Statistics Poisson Type Approximations Herpes Genomes
2 In 1940, Avery announced his finding that a macromolecule DNA inside the chromosome is responsible for transmitting heredity material from parents to offspring.
3 In 1953, Watson and Crick confirmed the double helical structure of a DNA molecule.
4 The AGE of Molecular genetics begins With the rapid accumulation of genetics sequence data, mathematical, statistical, and computational methods play an increasingly important role in molecular biology. This leads to the birth of a new interdisciplinary field of study called Bioinformatics.
5 Challenges in Bioinformatics Sequence Assembly Database Technology Gene Finding Structure Prediction Molecular Evolution Locating extragenic functional sites
6 The four different nucleotide bases of DNA: Adenine (A) Thymine (T) Cytosine (C) Guanine (G)
7 NETFETCH of: query May 5, :57 from server: 1 Sequences Requested 1 Sequences Returned LOCUS BHV1CGEN bp DNA VRL 07-APR-2000 DEFINITION Bovine herpesvirus type 1.1 complete genome. ACCESSION AJ VERSION AJ GI: KEYWORDS complete genome. SOURCE Bovine herpesvirus type 1.1. ORGANISM Bovine herpesvirus type 1.1 Viruses; dsdna viruses, no RNA stage; Herpesviridae; Alphaherpesvirinae; Varicellovirus. References FEATURES sequence ggcccagcccccgcgcggggggcgcggagaaaaaaaaaattttttccgcgcggcgcgtgc attgcggcgggcgggggcggggtgggggatgggcgcggagcgcgagggtagggttggcac actgccaagatcaccaagcatgtgcgcggccatcttgcttccaaactcattagcataccc cgcccattattccattctcatttgcatacccaccgttgcacatgccgccatattgctcct cctccctcgctcctcctccctcgctcctcctccctcgctcctcctccctcgctcctcctc cctcgctcctcctccctcgctcctcctccctcgctcctcctccctcgctcctcctccctc gctcctcctccctcgctcctcctccctcgctcctcctccctcgctcctcctccctcgctc ctcctccctcgctcctcttcaaaacactaccgcgggcgtccgctctcactagcttcggcg ccgtcatgggtgcccgcgcctccgcgcctgctgccggcccgcccccagcccacgctgttc tactagatgcgctctccgggggcacgattgacctgcctggcggcgacgaggccgtctttg tgtcctgcccgacgacgcgccccgtgtaccaccacatgcgccgcggccgcacggcccaca ctacacccgtgcacttcgttggccgcgcctatgccatcttgccctgccgcaagtttatgc tgtatctgatgcgcggtggtgccgtttacggctacgagcccaccactggcctgcaccgcc tcgccgattcactgcacgactttcttactactgccggactacagcagcgagacctacact gcctcgatgtcacggtgcttgacgcgcagatggacccggtgacgttcaccacccccgaga tcctcatcgagctcgaggcggacccggccttcccaccgccgccctcggcccgcgcgcgcc gctccacgctgcgccgggcgtctatgcgccggcccgcacgcaccttctgcccccaccagc tgctagcagagggctccattctggacctctgctcgccagagcaagcggcggcgccgggct gttcgctgctccccgcctgtgactctggagacgccgcgtgcccctgcgacgctggcgaga
8 Arrows indicate the direction of the elongation of new strands (shaded) from 5' to 3' end.
9 Palindrome: A stretch of DNA that reads the same in both the direct and the complementary strands. E.g., 5.. GCAATATTGC CGTTATAACG..5 Short palindromes occur frequently by chance. To screen out the random noise, focus only on palindromes of length 10. Significant clusters of palindromes are found around origins of replication and regulatory regions in viral genomes (Masse et al. 1992, Leung and Yamashita 1999). Modeling the occurrence of palindromes on the DNA sequence as points on the unit interval, the scan statistic can be used to detect the presence of nonrandom palindrome clusters.
10 Sliding Window Plot Figure 1: A sliding window plot is generated by choosing a window of fixed length and sliding it along the genome, beginning at the first base and continuing until the window reaches the last base of the genome. The window moves forward in steps of a pre-specified size. At each position of the window, the number of palindromes contained in it is counted and plotted against the window position. This is the sliding window plot for the human cytomegalovirus genome with a 1000 base window and step size of 500 bases. The peaks observed at window positions and suggest that there may be nonrandom palindrome clusters at these locations.
11 The Scan Statistic Notation U 1, U 2,, U n i.i.d. Uniform (0,1) U (1), U (2),, U (n) their order statistics S i = U (i+1) - U (i) = ith spacing N w (i) = no. of points contained in [U (i), U (i) + w] A r (i) = S i + + S i+r-1 = sum of r adjoining spacing
12 The w- and r-scan Statistics w-scan Statistic N w = max i N w ( i) r-scan Statistic A r = min i A r ( i) Duality Relationship { N ( i) r + 1} = { A ( i) w} w r If N w is too big, or equivalently, A r is too small, an unusual cluster is present. The probability distribution of either N w or A r will help determine which clusters are unlikely to occur by chance.
13 Poisson Approximation Dembo and Karlin (1992) derive the limiting distribution lim n P A r > n x 1+ 1/ r = e x r / r! This follows from a Poisson limiting distribution for the counts C r of those A r (i)'s not exceeding x / n 1+1/r. If the above limiting distribution is used as an approximation for large n, one can easily obtain a critical value r!ln(1 α) c = r+ 1 n for A r below which a significant cluster is considered present.
14 Better approximate probabilities for A r can be derived from better approximate distributions of C r : Finite Poisson approximation (Dembo & Karlin 1992). Local declumping approximation (Glaz 1994) based on a declumping idea put forth by Arratia et al. (1990). Compound Poisson approximation (Glaz 1994) based on a coupling method proposed by Roos (1993). Recursive algorithm for computing scan statistic probabilities to any desired degree of accuracy developed by Huffer and Lin (1998).
15 Herpesvirus Genomes Genome Palindromes Genome Length HCMV ,354 EBV ,282 HSE ,223 HSI ,226 HSS ,930 HSV ,260 VZV ,885
16 Significant Palindrome Clusters on r Positions of significant (α = 0.05 ) clusters 1 None 2 None 3 None
17 Regions of the herpes genomes with statistically significant clusters Genome Cluster Location Biological Feature HCMV Origin of replication (orilyt) Transcriptional regulator HSV Transcriptional regulator Origin of replication (ori S ) EBV Origin of replication (OriLyt) HSE HSS VZV 1542
18 The Q-Q plot Figure 2: Q-Q plot for the palindrome positions of the human cytomegalovirus against quantiles of the uniform distribution. Here, we focus only on those palindromes with length 10 bases in order to screen out the random noise generated by frequent fortuitous occurrences of very short palindromes (see Leung et al for a full explanation). The overall straight line appearance of the Q-Q plot suggests that it would be reasonable to model the occurrences of palindromes above a prescribed length along the genome sequence as i.i.d. points uniformly distributed over (0,1) and evaluate the significance of palindrome clusters with the scan statistic distribution.
Application of the Scan Statistic in DNA Sequence Analysis
Application of the Scan Statistic in DNA Sequence Analysis Ming-Ying Leung Division of Mathematics and Statistics University of Texas at San Antonio San Antonio, TX 78249 Traci E. Yamashita Johns Hopkins
More informationSliding Window Plot Figure 1
Introduction Many important control signals of replication and gene expression are found in regions of the molecule with a high concentration of palindromes (e.g., see Masse et al. 1992). Statistical methods
More informationImproving the Algorithm to Predict RNA Structures for Frameshifting in the Expression of Overlapping Viral Genes
Improving the Algorithm to Predict RNA Structures for Frameshifting in the Expression of Overlapping Viral Genes Outline: Ming-Ying Leung Department of Mathematical Sciences University of Texas at El Paso
More informationII. DNA Deoxyribonucleic Acid Located in the nucleus of the cell Codes for your genes Frank Griffith- discovered DNA in 1928
HEREDITY = passing on of characteristics from parents to offspring I. DNA, Chromosomes, Chromatin, and Genes DNA = blueprint of life (has the instructions for making an organism) Chromatin= uncoiled DNA
More informationMolecular Biology. IMBB 2017 RAB, Kigali - Rwanda May 02 13, Francesca Stomeo
Molecular Biology IMBB 2017 RAB, Kigali - Rwanda May 02 13, 2017 Francesca Stomeo Molecular biology is the study of biology at a molecular level, especially DNA and RNA - replication, transcription, translation,
More informationSections 12.3, 13.1, 13.2
Sections 12.3, 13.1, 13.2 Background: Watson & Crick recognized that base pairing in the double helix allows DNA to be copied, or replicated Each strand in the double helix has all the information to remake
More informationChapter 10. DNA: The Molecule of Heredity. Lectures by Gregory Ahearn. University of North Florida. Copyright 2009 Pearson Education, Inc.
Chapter 10 DNA: The Molecule of Heredity Lectures by Gregory Ahearn University of North Florida Copyright 2009 Pearson Education, Inc. 10.1 What Is The Structure Of DNA? Deoxyribonucleic acid (DNA) is
More informationMolecular Basis of Inheritance
Molecular Basis of Inheritance Question 1: Group the following as nitrogenous bases and nucleosides: Adenine, Cytidine, Thymine, Guanosine, Uracil and Cytosine. Answer Nitrogenous bases present in the
More informationWhat is Genetics? Genetics The study of how heredity information is passed from parents to offspring. The Modern Theory of Evolution =
What is Genetics? Genetics The study of how heredity information is passed from parents to offspring The Modern Theory of Evolution = Genetics + Darwin s Theory of Natural Selection Gregor Mendel Father
More informationClass XII Chapter 6 Molecular Basis of Inheritance Biology
Question 1: Group the following as nitrogenous bases and nucleosides: Adenine, Cytidine, Thymine, Guanosine, Uracil and Cytosine. Nitrogenous bases present in the list are adenine, thymine, uracil, and
More informationChapter 9: DNA: The Molecule of Heredity
Chapter 9: DNA: The Molecule of Heredity What is DNA? Answer: Molecule that carries the blueprint of life General Features: DNA is packages in chromosomes (DNA + Proteins) Gene = Functional segment of
More informationChapter 12 Reading Questions
Chapter 12 Reading Questions Name Section 11 In Frederick Griffith s experiment, what four substances were given to laboratory mice, and what was the result of each? 4. Which result was surprising, and
More informationDNA vs. RNA B-4.1. Compare DNA and RNA in terms of structure, nucleotides and base pairs.
DNA vs. RNA B-4.1 Compare DNA and RNA in terms of structure, nucleotides and base pairs. Key Concepts l Nucleic Acids: l deoxyribonucleic acid (DNA) l ribonucleic acid (RNA) l Nucleotides: l nitrogen base,
More informationUnit 5 DNA, RNA, and Protein Synthesis
1 Biology Unit 5 DNA, RNA, and Protein Synthesis 5:1 History of DNA Discovery Fredrick Griffith-conducted one of the first experiment s in 1928 to suggest that bacteria are capable of transferring genetic
More informationDNA RNA PROTEIN. Professor Andrea Garrison Biology 11 Illustrations 2010 Pearson Education, Inc. unless otherwise noted
DNA RNA PROTEIN Professor Andrea Garrison Biology 11 Illustrations 2010 Pearson Education, Inc. unless otherwise noted DNA Molecule of heredity Contains all the genetic info our cells inherit Determines
More informationResources. How to Use This Presentation. Chapter 10. Objectives. Table of Contents. Griffith s Discovery of Transformation. Griffith s Experiments
How to Use This Presentation To View the presentation as a slideshow with effects select View on the menu bar and click on Slide Show. To advance through the presentation, click the right-arrow key or
More informationDNA DNA. 1 of 9. Copyright 2007, Exemplars, Inc. All rights reserved.
Think about what you have learned about the structure of. Using the section of given, draw in a complete strand of and label the nitrogen base, phosphate molecule and sugar molecule. Circle one nucleotide.
More information13.1 RNA Lesson Objectives Contrast RNA and DNA. Explain the process of transcription.
13.1 RNA Lesson Objectives Contrast RNA and DNA. Explain the process of transcription. The Role of RNA 1. Complete the table to contrast the structures of DNA and RNA. DNA Sugar Number of Strands Bases
More informationDNA: The Genetic Material. Chapter 14. Genetic Material
DNA: The Genetic Material Chapter 14 Genetic Material Frederick Griffith, 1928 Streptococcus pneumoniae, a pathogenic bacterium causing pneumonia 2 strains of Streptococcus: - S strain virulent - R strain
More informationDNA & Genetics. Chapter Introduction DNA 6/12/2012. How are traits passed from parents to offspring?
Section 5.3 DNA & Genetics Chapter Introduction How are traits passed from parents to offspring? Chromatin- DNA in the nucleus loose strands Chromosome- When DNA gets organized before cell division Gene-
More informationTHE STRUCTURE AND FUNCTION OF DNA
THE STRUCTURE AND FUNCTION OF DNA 1. DNA is our genetic code!!! It is passed from generation to generation. It carries information that controls the functions of our cells. DNA stands for deoxyribonucleic
More informationBiology Celebration of Learning (100 points possible)
Name Date Block Biology Celebration of Learning (100 points possible) Matching (1 point each) 1. Codon a. process of copying DNA and forming mrna 2. Genes b. section of DNA coding for a specific protein
More informationChapter 12 DNA & RNA
Chapter 12 DNA & RNA Experiments with Heredity Material Griffith s Experiments: injected mice with bacteria that cause pneumonia Concluded genetic info is transformed from one bacteria to another Avery
More informationDNA STRUCTURE & REPLICATION
DNA STRUCTURE & REPLICATION A MODEL OF DNA In 1953, two scientists named Watson & Crick built a model of DNA that demonstrates its exact structure and function. They called this model a double helix, which
More informationDNA, RNA and protein synthesis
DNA, RNA and protein synthesis DNA is deoxyribonucleic acid DNA contains all the genetic instructions for making proteins within the cell. Each DNA molecule is made of repeating subunits called nucleotides.
More informationDNA, Genes and Chromosomes. Vocabulary
Vocabulary Big Ideas Heredity and Reproduction Understand and explain that every organism requires a set of instructions that specifies its traits, that this hereditary information (DNA) contains genes
More informationBIOLOGY 101. CHAPTER 16: The Molecular Basis of Inheritance: Life s Operating Instructions
BIOLOGY 101 CHAPTER 16: The Molecular Basis of Inheritance: Life s Operating Instructions Life s Operating Instructions CONCEPTS: 16.1 DNA is the genetic material 16.2 Many proteins work together in DNA
More informationName Class Date. Information and Heredity, Cellular Basis of Life Q: What is the structure of DNA, and how does it function in genetic inheritance?
12 DNA Big idea Information and Heredity, Cellular Basis of Life Q: What is the structure of DNA, and how does it function in genetic inheritance? WHAT I KNOW WHAT I LEARNED 12.1 How did scientists determine
More informationIntroduction to Microarray Data Analysis and Gene Networks. Alvis Brazma European Bioinformatics Institute
Introduction to Microarray Data Analysis and Gene Networks Alvis Brazma European Bioinformatics Institute A brief outline of this course What is gene expression, why it s important Microarrays and how
More informationMolecular Genetics. The flow of genetic information from DNA. DNA Replication. Two kinds of nucleic acids in cells: DNA and RNA.
Molecular Genetics DNA Replication Two kinds of nucleic acids in cells: DNA and RNA. DNA function 1: DNA transmits genetic information from parents to offspring. DNA function 2: DNA controls the functions
More informationWhat Are the Chemical Structures and Functions of Nucleic Acids?
THE NUCLEIC ACIDS What Are the Chemical Structures and Functions of Nucleic Acids? Nucleic acids are polymers specialized for the storage, transmission, and use of genetic information. DNA = deoxyribonucleic
More informationDNA: The Primary Source of Heritable Information. Genetic information is transmitted from one generation to the next through DNA or RNA
DNA and Replication DNA: The Primary Source of Heritable Information Genetic information is transmitted from one generation to the next through DNA or RNA Chromosomes Non-eukaryotic (bacteria) organisms
More informationIntroduction to Cellular Biology and Bioinformatics. Farzaneh Salari
Introduction to Cellular Biology and Bioinformatics Farzaneh Salari Outline Bioinformatics Cellular Biology A Bioinformatics Problem What is bioinformatics? Computer Science Statistics Bioinformatics Mathematics...
More informationOutline. Structure of DNA DNA Functions Transcription Translation Mutation Cytogenetics Mendelian Genetics Quantitative Traits Linkage
Genetics Outline Structure of DNA DNA Functions Transcription Translation Mutation Cytogenetics Mendelian Genetics Quantitative Traits Linkage Chromosomes are composed of chromatin, which is DNA and associated
More informationMolecular Genetics Student Objectives
Molecular Genetics Student Objectives Exam 1: Enduring understanding 3.A: Heritable information provides for continuity of life. Essential knowledge 3.A.1: DNA, and in some cases RNA, is the primary source
More informationOpening Activity. DNA is often compared to a ladder or a spiral staircase. Look at the picture above and answer the following questions.
Opening Activity DNA is often compared to a ladder or a spiral staircase. Look at the picture above and answer the following questions. 1. How is the structure of DNA similar to that of a ladder or spiral
More informationFrom Gene to Protein
8.2 Structure of DNA From Gene to Protein deoxyribonucleic acid - (DNA) - the ultimate source of all information in a cell This information is used by the cell to produce the protein molecules which are
More informationChapter 1 The Genetics Revolution MULTIPLE-CHOICE QUESTIONS. Section 1.1 (The birth of genetics)
Chapter 1 The Genetics Revolution MULTIPLE-CHOICE QUESTIONS Section 1.1 (The birth of genetics) 1. The early 1900s was an important period for genetics due to which of the following major events? A) the
More informationExam: Structure of DNA and RNA 1. Deoxyribonucleic Acid is abbreviated: a. DRNA b. DNA c. RNA d. MRNA
Exam: Structure of DNA and RNA 1. Deoxyribonucleic Acid is abbreviated: a. DRNA b. DNA c. RNA d. MRNA 2. Which two scientists discovered DNA? a. Mendel and Newton b. Bohr and Crick c. Watson and Crick
More informationtranslation The building blocks of proteins are? amino acids nitrogen containing bases like A, G, T, C, and U Complementary base pairing links
The actual process of assembling the proteins on the ribosome is called? translation The building blocks of proteins are? Complementary base pairing links Define and name the Purines amino acids nitrogen
More informationAdv Biology: DNA and RNA Study Guide
Adv Biology: DNA and RNA Study Guide Chapter 12 Vocabulary -Notes What experiments led up to the discovery of DNA being the hereditary material? o The discovery that DNA is the genetic code involved many
More informationNucleic Acids. By Sarah, Zach, Joanne, and Dean
Nucleic Acids By Sarah, Zach, Joanne, and Dean Basic Functions Carry genetic information (DNA storing it) Protein synthesis Helps in cell division (DNA replicates itself) RNA- numerous functions during
More informationAGENDA for 10/11/13 AGENDA: HOMEWORK: Due end of the period OBJECTIVES:
AGENDA for 10/11/13 AGENDA: 1. Finish 1.2.3 DNA Analysis Analyzing DNA Samples Using Current Forensic Methods OBJECTIVES: 1. Demonstrate the steps of gel electrophoresis 2. Analyze restriction fragment
More informationDNA. Deoxyribose Nucleic Acid
DNA Deoxyribose Nucleic Acid Biomolecules Remember 1. Carbohydrates 2. Lipids 3. Nucleic acids hold genetic information; code for proteins 4. Proteins History of DNA Who Discovered DNA Rosalind Franklin
More informationChapter 6. Genes and DNA. Table of Contents. Section 1 What Does DNA Look Like? Section 2 How DNA Works
Genes and DNA Table of Contents Section 1 What Does DNA Look Like? Section 1 What Does DNA Look Like? Objectives List three important events that led to understanding the structure of DNA. Describe the
More information4.1. Genetics as a Tool in Anthropology
4.1. Genetics as a Tool in Anthropology Each biological system and every human being is defined by its genetic material. The genetic material is stored in the cells of the body, mainly in the nucleus of
More informationBiology Evolution: Mutation I Science and Mathematics Education Research Group
a place of mind F A C U L T Y O F E D U C A T I O N Department of Curriculum and Pedagogy Biology Evolution: Mutation I Science and Mathematics Education Research Group Supported by UBC Teaching and Learning
More informationPolymerase Chain Reaction
Polymerase Chain Reaction Variations of PCR in the Diagnostic Lab The most common variations of standard PCR used in the diagnostic laboratory are: Reverse Transcriptase PCR (RT-PCR) Nested PCR (n-pcr)
More informationWrite: Unit 5 Review at the top.
Warm-up Take out a sheet of paper: Write: Unit 5 Review at the top. As each question goes on the board, write that question down and answer it. When answers come up, either write correct next to what you
More informationChapter 13 - Concept Mapping
Chapter 13 - Concept Mapping Using the terms and phrases provided below, complete the concept map showing the discovery of DNA structure. amount of base pairs five-carbon sugar purine DNA polymerases Franklin
More informationWhat happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!!
What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!! Protein Synthesis/Gene Expression Why do we need to make proteins? To build parts for our body as
More informationLesson 8. DNA: The Molecule of Heredity. Gene Expression and Regulation. Introduction to Life Processes - SCI 102 1
Lesson 8 DNA: The Molecule of Heredity Gene Expression and Regulation Introduction to Life Processes - SCI 102 1 Genes and DNA Hereditary information is found in discrete units called genes Genes are segments
More informationDNA Structure DNA Nucleotide 3 Parts: 1. Phosphate Group 2. Sugar 3. Nitrogen Base
DNA,, RNA,, AND PROTEIN SYNTHESIS DNA Deoxyribonucleic Acid Enables cells to have different forms and perform different functions Primary functions of DNA: Store and transmit genetic information that tells
More informationGene Expression. Student:
Gene Expression Student: 1. A ribozyme is A. a section of the DNA that is expressed in the mrna. B. a self-splicing intron that acts like an enzyme. C. a complex made up of many ribosomes replicating the
More informationGene and DNA structure. Dr Saeb Aliwaini
Gene and DNA structure Dr Saeb Aliwaini 2016 DNA during cell cycle Cell cycle for different cell types Molecular Biology - "Study of the synthesis, structure, and function of macromolecules (DNA, RNA,
More informationDNA and the Production of Proteins Course Notes. Cell Biology. Sub-Topic 1.3 DNA and the Production of Proteins
Cell Biology Sub-Topic 1.3 DNA and the Production of Proteins On completion of this subtopic I will be able to state that: Chromosomes contain genetic information that gives rise to an organism s characteristics.
More informationWhat is a chromosome and where is it located and what does it
What is a chromosome and where is it located and what does it do? A general overview for neophytes A chromosome is one of the components of the cell inside the nucleus which codes for proteins and controls
More informationDNA. translation. base pairing rules for DNA Replication. thymine. cytosine. amino acids. The building blocks of proteins are?
2 strands, has the 5-carbon sugar deoxyribose, and has the nitrogen base Thymine. The actual process of assembling the proteins on the ribosome is called? DNA translation Adenine pairs with Thymine, Thymine
More informationNucleic acids. AP Biology
Nucleic acids 2006-2007 Nucleic Acids Information storage Nucleic Acids: Function: u genetic material stores information w genes w blueprint for building proteins n DNA DNA RNA proteins transfers information
More informationAll This For Four Letters!?! DNA and Its Role in Heredity
All This For Four Letters!?! DNA and Its Role in Heredity What Is the Evidence that the Gene Is DNA? By the 1920s, it was known that chromosomes consisted of DNA and proteins. A new dye stained DNA and
More informationAGENDA for 10/10/13 AGENDA: HOMEWORK: Due end of the period OBJECTIVES: Due Fri, 10-11
AGENDA for 10/10/13 AGENDA: 1. 1.2.3 DNA Analysis Analyzing DNA Samples Using Current Forensic Methods OBJECTIVES: 1. Demonstrate the steps of gel electrophoresis 2. Analyze restriction fragment length
More informationGENETICS 1 Classification, Heredity, DNA & RNA. Classification, Objectives At the end of this sub section you should be able to: Heredity, DNA and RNA
Classification, Heredity, DNA and Objectives At the end of this sub section you should be able to: RNA Heredity and Variation Gene Expression DNA structure DNA Profiling Protein Synthesis 1. Discuss the
More informationLecture 2: Central Dogma of Molecular Biology & Intro to Programming
Lecture 2: Central Dogma of Molecular Biology & Intro to Programming Central Dogma of Molecular Biology Proteins: workhorse molecules of biological systems Proteins are synthesized from the genetic blueprints
More information2. Why did researchers originally think that protein was the genetic material?
AP Biology Chapter 13 Reading Guide The Molecular Basis of Inheritance Concept 13.1 DNA is the Genetic Material 1. What are the two chemical components of chromosomes? 2. Why did researchers originally
More informationDNA and RNA. Chapter 12
DNA and RNA Chapter 12 History of DNA Late 1800 s scientists discovered that DNA is in the nucleus of the cell 1902 Walter Sutton proposed that hereditary material resided in the chromosomes in the nucleus
More informationChromosomes. Nucleosome. Chromosome. DNA double helix. Coils. Supercoils. Histones
Chromosomes Chromosome Nucleosome DNA double helix Coils Supercoils Histones Evidence That DNA Can Transform Bacteria Frederick Griffith s experiment 1928 Griffith called the phenomenon transformation
More informationDNA and RNA 2/14/2017. What is a Nucleic Acid? Parts of Nucleic Acid. DNA Structure. RNA Structure. DNA vs RNA. Nitrogen bases.
DNA and RNA Nucleic Acids What is a Nucleic Acid? Nucleic Acids are organic molecules that carry information needed to make proteins Remember: proteins carry out ALL cellular activity There are two types
More informationEvolutionary Computation. Lecture 1 January, 2007 Ivan Garibay
Evolutionary Computation Lecture 1 January, 2007 Ivan Garibay igaribay@cs.ucf.edu Lecture 1 What is Evolutionary Computation? Evolution, Genetics, DNA Historical Perspective Genetic Algorithm Components
More informationName 10 Molecular Biology of the Gene Test Date Study Guide You must know: The structure of DNA. The major steps to replication.
Name 10 Molecular Biology of the Gene Test Date Study Guide You must know: The structure of DNA. The major steps to replication. The difference between replication, transcription, and translation. How
More informationDNA: The Molecule Of Life
DNA: The Molecule Of Life Introductory Concepts -One unique set of DNA in an organism is termed its genome (link to fig 1-3) -DNA is the main component of chromosomes -Humans are diploid organisms, with
More informationUnit 3 Part II: Modern Genetics p
Unit 3.notebook June 03, 2014 Unit 3 Part II: Modern Genetics p.568 569 This part of the unit will focus on DNA how it s structure was determined how it replicates and how it codes for proteins. Mar 21
More informationGenetics and Heredity Power Point Questions
Name period date assigned date due date returned Genetics and Heredity Power Point Questions 1. Heredity is the process in which pass from parent to offspring. 2. is the study of heredity. 3. A trait is
More informationCan have defects in any of the steps in the synthesis of arginine. With arginine in the medium, all arg mutants can grow on minimal medium.
Molecular Biology I Biochemistry studying a single component in an organism Genetics studying an organism without that component Biochemical Genetics Look at the Arginine biosynthetic pathway: A B C Arginine
More informationC A T T A G C nitrogenous complimentary G T A A T C G to each other
Name DNA RNA Review Worksheet Date 1. What does DNA stand for? Deoxyribonucleic acid 2. What is DNA s primary function? - Provides a pattern for protein manufacture - Provides a pattern for replication
More informationLesson Overview Identifying the Substance of Genes
12.1 Identifying the Substance of Genes Griffith s Experiments The discovery of the chemical nature of the gene began in 1928 with British scientist Frederick Griffith, who was trying to figure out how
More information(Very) Basic Molecular Biology
(Very) Basic Molecular Biology (Very) Basic Molecular Biology Each human cell has 46 chromosomes --double-helix DNA molecule (Very) Basic Molecular Biology Each human cell has 46 chromosomes --double-helix
More informationDNA - The Double Helix
DNA - The Double Helix Recall that the nucleus is a small spherical, dense body in a cell. It is often called the "control center" because it controls all the activities of the cell including cell reproduction,
More informationDNA & THE GENETIC CODE DON T PANIC! THIS SECTION OF SLIDES IS AVAILABLE AT CLASS WEBSITE
DNA & THE GENETIC CODE DON T PANIC! THIS SECTION OF SLIDES IS AVAILABLE AT CLASS WEBSITE Recommended reading: The Double Helix: A Personal Account of the Discovery of the Structure of DNA, by James D.
More informationBasic Bioinformatics: Homology, Sequence Alignment,
Basic Bioinformatics: Homology, Sequence Alignment, and BLAST William S. Sanders Institute for Genomics, Biocomputing, and Biotechnology (IGBB) High Performance Computing Collaboratory (HPC 2 ) Mississippi
More informationThe structure, type and functions of a cell are all determined by chromosomes:
DNA Basics The structure, type and functions of a cell are all determined by chromosomes: They are found in the nucleus of a cell. These chromosomes are composed of DNA, the acronym for deoxyribonucleic
More informationCh 12.DNA and RNA.Biology.Landis
Identity Section 12 1 DNA (pages 287 294) This section tells about the experiments that helped scientists discover the relationship between genes and DNA. It also describes the chemical structure of the
More informationDNA, Replication and RNA
DNA, Replication and RNA The structure of DNA DNA, or Deoxyribonucleic Acid, is the blue prints for building all of life. DNA is a long molecule made up of units called NUCLEOTIDES. Each nucleotide is
More informationCELL BIOLOGY: DNA. Generalized nucleotide structure: NUCLEOTIDES: Each nucleotide monomer is made up of three linked molecules:
BIOLOGY 12 CELL BIOLOGY: DNA NAME: IMPORTANT FACTS: Nucleic acids are organic compounds found in all living cells and viruses. Two classes of nucleic acids: 1. DNA = ; found in the nucleus only. 2. RNA
More informationGriffith and Transformation (pages ) 1. What hypothesis did Griffith form from the results of his experiments?
Section 12 1 DNA (pages 287 294) This section tells about the experiments that helped scientists discover the relationship between genes and DNA. It also describes the chemical structure of the DNA molecule.
More informationIndependent Study Guide The Blueprint of Life, from DNA to Protein (Chapter 7)
Independent Study Guide The Blueprint of Life, from DNA to Protein (Chapter 7) I. General Principles (Chapter 7 introduction) a. Morse code distinct series of dots and dashes encode the 26 letters of the
More informationReview of ORGANIC CHEMISTRY
Nucleic Acids: DNA Review of ORGANIC CHEMISTRY Definition: Contains CARBON (C) and Hydrogen (H) Large polymers can be made of smaller individual monomers. Ex: For carbohydrates, polysaccharides are large
More informationIMBB Molecular biology, DNA
IMBB 2013 Molecular biology, DNA What is Molecular Biology? Molecular biology is the study of biology at a molecular level, especially DNA and RNA Molecular biology is the study of molecular underpinnings
More informationThe study of the structure, function, and interaction of cellular proteins is called. A) bioinformatics B) haplotypics C) genomics D) proteomics
Human Biology, 12e (Mader / Windelspecht) Chapter 21 DNA Which of the following is not a component of a DNA molecule? A) a nitrogen-containing base B) deoxyribose sugar C) phosphate D) phospholipid Messenger
More informationDina Al-Tamimi. Faisal Nimri. Ma amoun Ahram. 1 P a g e
1 Dina Al-Tamimi Faisal Nimri Ma amoun Ahram 1 P a g e **Difference between Molecular Biology and Genetics: Molecular Biology: is a fancy term of biochemistry. It is the science that deals with DNA, RNA
More informationMolecular Genetics I DNA
Molecular Genetics I DNA Deoxyribonucleic acid is the molecule that encodes the characteristics of living things. It is the molecule that is passed from a mother cell to daughter cells, and the molecule
More information3.A.1 DNA and RNA: Structure and Replication
3.A.1 DNA and RNA: Structure and Replication Each DNA polymer is made of Nucleotides (monomer) which are made of: a) Phosphate group: Negatively charged and polar b) Sugar: deoxyribose- a 5 carbon sugar
More informationChapter 9. Topics - Genetics - Flow of Genetics - Regulation - Mutation - Recombination
Chapter 9 Topics - Genetics - Flow of Genetics - Regulation - Mutation - Recombination 1 Genetics Genome Chromosome Gene Protein Genotype Phenotype 2 Terms and concepts gene Fundamental unit of heredity
More informationMolecular basis of genetic variation
Molecular basis of genetic variation Trygve Bakken Department of Neurosciences University of California, San Diego presented by Thomas Nichols, PhD Department of Statistics & Warwick Manufacturing Group
More informationQuiz 1. Bloe8 Chapter question online student quizzes
Bloe8 Chapter 9 2 15-question online student quizzes Questions are organized by section number and have an (F), (C), or (A) at the beginning to designate the modified Bloom categories used in the test
More informationDr. Ramesh U2 L2. Basic structure of DNA and RNA Introduction to Genetics
Dr. Ramesh U2 L2 Basic structure of DNA and RNA Introduction to Genetics Do Now! Directions: Answer the following questions in complete sentences. 1. Where is DNA located in the eukaryotic cell? 2. Where
More informationNucleic acids. How DNA works. DNA RNA Protein. DNA (deoxyribonucleic acid) RNA (ribonucleic acid) Central Dogma of Molecular Biology
Nucleic acid chemistry and basic molecular theory Nucleic acids DNA (deoxyribonucleic acid) RNA (ribonucleic acid) Central Dogma of Molecular Biology Cell cycle DNA RNA Protein Transcription Translation
More informationE. Incorrect! The four different DNA nucleotides follow a strict base pairing arrangement:
AP Biology - Problem Drill 10: Molecular and Human Genetics Question No. 1 of 10 Instructions: (1) Read the problem and answer choices carefully, (2) Work the problems on paper as 1. Which of the following
More informationName: - Bio A.P. DNA Replication & Protein Synthesis
Name: - Bio A.P. DNA Replication & Protein Synthesis 1 ESSENTIAL KNOWLEDGE Big Idea 3: Living Systems store, retrieve, transmit and respond to information critical to living systems Enduring Understanding:
More informationReview of Old Information: What is the monomer and polymer of: Macromolecule Monomer Polymer Carbohydrate Lipid Protein
Section 1.8 Question of the Day: Name: Review of Old Information: What is the monomer and polymer of: Macromolecule Monomer Polymer Carbohydrate Lipid Protein New Information: One of the most important
More information