Supplemental Figure S1. PGRN Binding to Sortilin.

Size: px
Start display at page:

Download "Supplemental Figure S1. PGRN Binding to Sortilin."

Transcription

1 1 Neuron, volume 68 Supplemental Data Sortilin-Mediated Endocytosis Determines Levels of the Frontotemporal Dementia Protein, Progranulin Fenghua Hu, Thihan Padukkavidana, Christian B. Vægter, Owen A. Brady, Yanqiu Zheng, Ian R. Mackenzie, Howard H. Feldman, Anders Nykjaer, and Stephen M. Strittmatter Supplemental Figure S1. PGRN Binding to Sortilin. (A) Size Exclusion Chromatography of recombinant PGRN protein. The indicated proteins, AP-PGRN, AP-PGRN-E, and mcherry-pgrn, were prepared from conditioned medium and then fractionated by size exclusion chromatography. The elution of the two AP proteins was monitored by AP activity with pnpp as substrate, and

2 the elution of the mcherry protein by fluorescence. The majority of protein species elutes at a position corresponding to the predicted size of a monomer. (B) AP-PGRN binding to neurons is displaced by untagged ligand. Cultured E17 Mouse cortical neurons at 21DIV were incubated with 10 nm AP-PGRN alone or 10 nm AP- PGRN plus 200 nm of His-PGRN at 4 C for 1 hour. The non-specific binding in the presence of His-PGRN is 18% of total binding. Scale bar = 50 μm. (C) Selectivity of PGRN for Sortilin as binding site. COS-7 cells expressing Sortilin, SorLA, NTR1 or NTR2 were incubated with conditioned media containing AP-fusion proteins as indicated. Binding was visualized with AP substrates. To confirm expression of SorLA, cells expressing Sortilin or SorLA were stained with anti-sortilin or anti-sorla antibodies. The expression of SorLA was further confirmed by immunoblot. (D-E) AP-GRN-E binds with high affinity to cortical neurons. (D) The binding of AP PGRN-E binding to cortical neurons 21 DIV is measured as a function of ligand concentration. Data are mean + sem. (E) The data from D are replotted. The K D is mean + sem from 4 independent experiments. 2

3 3 Supplemental Figure S2. Lack of PGRN Regulation of Neurite Outgrowth and Cell Survival in Cortical Culture. (A-C) Rat E18 primary cerebral cortex or hippocampal neurons were cultured with or without 300 nm Flag-PGRN for 24 hours and then stained with anti-ßiii tubulin to

4 visualize neurons and their neurites as shown in (C). The number of cells/well (B) and the neurite outgrowth per cell (A) was measured using an automated high content cell imager and neurite outgrowth analysis (ImageExpress, Molecular Dynamics). The data are mean + sd from 4 wells of an experiment representative of 3 independent cultures with similar results. In each well, more than 200 neurons were analyzed. No significant effect of PGRN was detected. (D, E) Rat E18 cerebral cortical cultures were exposed to standard medium or 150 nm Flag-PGRN or 500 nm staurosporine (positive control) for 7 days from 14 DIV to 21 DIV. Cultures were then fixed and stained for ßIII tubulin (green), nuclei (DAPI, blue) or cleaved caspase 3 (red). The percentage of cells positive for the apoptotic marker, cleaved caspase 3, was determined by automated image analysis. The data are mean + sd from 4 wells of an experiment representative of 3 independent cultures with similar results. In each well, more than 2,000 neurons were analyzed. No significant effect of PGRN was detected. 4

5 5 Supplemental Figure S3. Cellular Localization of PGRN and Sortilin in Spinal Cord Ventral Horn. (A) PGRN antibody is specific. Immunohistochemistry for PGRN was conducted for transverse L5 spinal cord sections form WT or GRN -/- mice that underwent sciatic nerve injury (resection) 21 days previously. No staining was seen in the GRN -/- samples. Scale bar, 50 μm. (B) Immunohistochemistry for PGRN, GFAP and Iba1 was conducted on L5 spinal cords of mice that had sciatic nerve injury (resection) 7 days previously. While colocalization of the microglial marker (Iba1) and injury-induced PGRN is observed, there is no co-localization of reactive astrocytes (GFAP) with PGRN. Scale bar, 50 μm. (C) Immunohistochemistry for Sortilin, NeuN and Iba1 was conducted on L5 spinal cords of mice that had sciatic nerve resection 7 days earlier. Colocalization is seen between Sortilin and NeuN. No colocalization was observed for Iba1 and Sortilin. Scale bar, 50 µm.

6 6

7 7 Supplemental Figure S4. Lack of PGRN or Sortilin Degenerative Phenotype in MN after Axotomy Despite TDP-43 Redistribution. (A) One week after unilateral sciatic nerve injury, mice were sacrificed and tissue processed. Transverse sections containing the L5 ventral horn of injured or uninjured side was stained with anti-tdp-43 and anti-neun, as indicated. Note the increased cytoplasmic TDP-43 in the large MN cell bodies after axonal injury. Scale bar, 20 μm. (B, C) Three weeks after unilateral sciatic nerve injury, cross-sections of the L5 ventral root were processed. Intact axonal profiles were scored for each entire root. Data are the mean + sem for 4-6 roots per group. No significant differences were noted. Scale bar, 10 μm.

8 8 Supplemental Figure S5. Expression patterns for PGRN and Sortilin. Adult mouse expression data for GRN (A-C) and Sort1 (D-F) were downloaded from online databases. The microarray expression data (A, D) are from Gene Atlas (Su et al.,

9 2004; Wu et al., 2009) ( and the in situ hybridization analysis (B, C, E, F) from the Allen Brain Atlas (Lein et al., 2007) ( The in situ hybridization data are shown both in brightfield (B, E) and expression (C, F) views. Note high expression of Sort1 in multiple brain regions, and high expression of GRN in microglia. 9

10 10 Supplemental Figure S6. PGRN Levels in Sortilin and PGRN mutant mice. (A) Glycosylation of PGRN protein in the brain lysate. Tissue lysates collected from the cortex of 7-month-old mice of the indicated genotypes were subjected to PNGaseF treatment, Endo- -N-Acetylgalactosaminidase treatment or no enzyme treatment for 1 hour. The protein was then methanol precipitated, subjected to SDS-PAGE and

11 immunoblotted for PGRN. Both 73KDa and 78KDa PGRN protein bands collapse to one 63KDa band after PNGaseF treatment and do not do so with Endo- -N- Acetylgalactosaminidase treatment or no enzyme control. (B) Cerebral cortex lysates from 2-month-old mice were obtained from the indicated genotypes and immunoblotted for PGRN. (C) Quantification of PGRN level in the brain normalized to GAPDH level. For all genotypes, n = 4 mice. Mean + sem, **, P < 0.01, one-way ANOVA. (D) Cerebral cortex lysates from adult WT and GRN-/- mice were immunoblotted for Sortilin with an antibody recognizing the C-terminal region. The bottom panel shows an over-exposed view and the absence of any detectable carboxyl 15 kda fragment. (E) Cerebral cortex lysates from adult WT and Sort1-/- mice were immunoblotted for prosaposin (SAP), another Sortilin ligand. The two SAP panels were generated with different antibodies. While PGRN levels are increased in the Sort1-/- mice there is no change in prosaposin levels. (F) GRN mrna levels are not altered in mice lacking Sort1. RNA from cortex of 7- month-old mice was subjected to qrt-pcr with 2 different GRN probes. The resulting relative quantity of RNA was normalized to GAPDH mrna. No change in GRN mrna was seen in Sort1-/- compared to WT control. Mean + sem. 11

Sortilin-Mediated Endocytosis Determines Levels of the Frontotemporal Dementia Protein, Progranulin

Sortilin-Mediated Endocytosis Determines Levels of the Frontotemporal Dementia Protein, Progranulin Article Sortilin-Mediated Endocytosis Determines Levels of the Frontotemporal Dementia Protein, Progranulin Fenghua Hu, 1,2,3,4,8 Thihan Padukkavidana, 1,2,3,8 Christian B. Vægter, 5 Owen A. Brady, 4 Yanqiu

More information

Supplementary Figure 1. APP cleavage assay. HEK293 cells were transfected with various

Supplementary Figure 1. APP cleavage assay. HEK293 cells were transfected with various Supplementary Figure 1. APP cleavage assay. HEK293 cells were transfected with various GST-tagged N-terminal truncated APP fragments including GST-APP full-length (FL), APP (123-695), APP (189-695), or

More information

Supplementary Figure 1. α-synuclein is truncated in PD and LBD brains. Nature Structural & Molecular Biology: doi: /nsmb.

Supplementary Figure 1. α-synuclein is truncated in PD and LBD brains. Nature Structural & Molecular Biology: doi: /nsmb. Supplementary Figure 1 α-synuclein is truncated in PD and LBD brains. (a) Specificity of anti-n103 antibody. Anti-N103 antibody was coated on an ELISA plate and different concentrations of full-length

More information

Cleavage of tau by asparagine endopeptidase mediates the neurofibrillary pathology in

Cleavage of tau by asparagine endopeptidase mediates the neurofibrillary pathology in Supplementary information Cleavage of tau by asparagine endopeptidase mediates the neurofibrillary pathology in Alzheimer s disease Zhentao Zhang, Mingke Song, Xia Liu, Seong Su Kang, Il-Sun Kwon, Duc

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI:.38/ncb327 a b Sequence coverage (%) 4 3 2 IP: -GFP isoform IP: GFP IP: -GFP IP: GFP Sequence coverage (%) 4 3 2 IP: -GFP IP: GFP 33 52 58 isoform 2 33 49 47 IP: Control IP: Peptide Sequence Start

More information

Cytotoxicity of Botulinum Neurotoxins Reveals a Direct Role of

Cytotoxicity of Botulinum Neurotoxins Reveals a Direct Role of Supplementary Information Cytotoxicity of Botulinum Neurotoxins Reveals a Direct Role of Syntaxin 1 and SNAP-25 in Neuron Survival Lisheng Peng, Huisheng Liu, Hongyu Ruan, William H. Tepp, William H. Stoothoff,

More information

Regulation of axonal and dendritic growth by the extracellular calcium-sensing

Regulation of axonal and dendritic growth by the extracellular calcium-sensing Regulation of axonal and dendritic growth by the extracellular calcium-sensing receptor (CaSR). Thomas N. Vizard, Gerard W. O Keeffe, Humberto Gutierrez, Claudine H. Kos, Daniela Riccardi, Alun M. Davies

More information

Supplemental Materials

Supplemental Materials Supplemental Materials Flores-Pérez et al., Supplemental Materials, page 1 of 5 Supplemental Figure S1. Pull-down and BiFC controls, and quantitative analyses associated with the BiFC studies. (A) Controls

More information

DRG Pituitary Cerebral Cortex

DRG Pituitary Cerebral Cortex Liver Spinal cord Pons Atg5 -/- Atg5 +/+ DRG Pituitary Cerebral Cortex WT KO Supplementary Figure S1 Ubiquitin-positive IBs accumulate in Atg5 -/- tissues. Atg5 -/- neonatal tissues were fixed and decalcified.

More information

Supplemental Figure 1 Human REEP family of proteins can be divided into two distinct subfamilies. Residues (single letter amino acid code) identical

Supplemental Figure 1 Human REEP family of proteins can be divided into two distinct subfamilies. Residues (single letter amino acid code) identical Supplemental Figure Human REEP family of proteins can be divided into two distinct subfamilies. Residues (single letter amino acid code) identical in all six REEPs are highlighted in green. Additional

More information

NEURONAL CELL CULTURE MATRIX FOR BETTER MAINTENANCE AND SURVIVAL OF NEURONAL CELL CULTURES IN TISSUE CULTURE.

NEURONAL CELL CULTURE MATRIX FOR BETTER MAINTENANCE AND SURVIVAL OF NEURONAL CELL CULTURES IN TISSUE CULTURE. NEURONAL CELL CULTURE MATRIX FOR BETTER MAINTENANCE AND SURVIVAL OF NEURONAL CELL CULTURES IN TISSUE CULTURE. D. R. Aguirre, N. DiMassa, Chrystal Johnson, H. Eran, R. Perez, C.V.R. Sharma, M.V.R. Sharma,

More information

Stargazin regulates AMPA receptor trafficking through adaptor protein. complexes during long term depression

Stargazin regulates AMPA receptor trafficking through adaptor protein. complexes during long term depression Supplementary Information Stargazin regulates AMPA receptor trafficking through adaptor protein complexes during long term depression Shinji Matsuda, Wataru Kakegawa, Timotheus Budisantoso, Toshihiro Nomura,

More information

Supplementary Figure 1: Expression of RNF8, HERC2 and NEURL4 in the cerebellum and knockdown of RNF8 by RNAi (a) Lysates of the cerebellum from rat

Supplementary Figure 1: Expression of RNF8, HERC2 and NEURL4 in the cerebellum and knockdown of RNF8 by RNAi (a) Lysates of the cerebellum from rat Supplementary Figure 1: Expression of RNF8, HERC2 and NEURL4 in the cerebellum and knockdown of RNF8 by RNAi (a) Lysates of the cerebellum from rat pups at P6, P14, P22, P30 and adult (A) rats were subjected

More information

Nature Structural & Molecular Biology: doi: /nsmb.3308

Nature Structural & Molecular Biology: doi: /nsmb.3308 Supplementary Figure 1 Analysis of CED-3 autoactivation and CED-4-induced CED-3 activation. (a) Repeat experiments of Fig. 1a. (b) Repeat experiments of Fig. 1b. (c) Quantitative analysis of three independent

More information

Supplementary Figures and Legends.

Supplementary Figures and Legends. Supplementary Figures and Legends. Supplementary Figure 1: Impact of injury on Rb1 and PPARϒ expression. Following ipsilateral axotomy injury, adult DRG expression of Rb1 mrna declined (*p

More information

Supplementary Figure 1. Nature Structural & Molecular Biology: doi: /nsmb.3494

Supplementary Figure 1. Nature Structural & Molecular Biology: doi: /nsmb.3494 Supplementary Figure 1 Pol structure-function analysis (a) Inactivating polymerase and helicase mutations do not alter the stability of Pol. Flag epitopes were introduced using CRISPR/Cas9 gene targeting

More information

Figure S1. USP-46 is expressed in several tissues including the nervous system

Figure S1. USP-46 is expressed in several tissues including the nervous system Supplemental Figure legends Figure S1. USP-46 is expressed in several tissues including the nervous system Transgenic animals expressing a transcriptional reporter (P::GFP) were imaged using epifluorescence

More information

3 P p25. p43 p41 28 FADD. cflips. PE-Cy5 [Fluorescence intensity]

3 P p25. p43 p41 28 FADD. cflips. PE-Cy5 [Fluorescence intensity] L S p4 3 D3 76 N S L Ve ct or p4 3 D3 76 N S L Ve ct or A aspase 8 FADD TRAF2 D95-R - + Vector D95L TL I S L D376N T RAIL-R1 T RAIL-R2 D95-R E-y5 [Fluorescence intensity] Supplemental Fig. 1 Different

More information

Supplementary Figure 1 Phosphorylated tau accumulates in Nrf2 (-/-) mice. Hippocampal tissues obtained from Nrf2 (-/-) (10 months old, 4 male; 2

Supplementary Figure 1 Phosphorylated tau accumulates in Nrf2 (-/-) mice. Hippocampal tissues obtained from Nrf2 (-/-) (10 months old, 4 male; 2 Supplementary Figure 1 Phosphorylated tau accumulates in Nrf2 (-/-) mice. Hippocampal tissues obtained from Nrf2 (-/-) (10 months old, 4 male; 2 female) or wild-type (5 months old, 1 male; 11 months old,

More information

Molecular Techniques. 3 Goals in Molecular Biology. Nucleic Acids: DNA and RNA. Disclaimer Nucleic Acids Proteins

Molecular Techniques. 3 Goals in Molecular Biology. Nucleic Acids: DNA and RNA. Disclaimer Nucleic Acids Proteins Molecular Techniques Disclaimer Nucleic Acids Proteins Houpt, CMN, 9-30-11 3 Goals in Molecular Biology Identify All nucleic acids (and proteins) are chemically identical in aggregate - need to identify

More information

SUPPLEMENTARY INFORMATION SUPPLEMENTARY FIGURES

SUPPLEMENTARY INFORMATION SUPPLEMENTARY FIGURES SUPPLEMENTARY INFORMATION SUPPLEMENTARY FIGURES Supplementary Figure 1. Generation of inducible BICD2 knock-out mice. A) The mouse BICD2 locus and gene targeting constructs. To generate an inducible Bicd2

More information

DCLK-immunopositive. Bars, 100 µm for B, 50 µm for C.

DCLK-immunopositive. Bars, 100 µm for B, 50 µm for C. Supplementary Figure S1. Characterization of rabbit polyclonal anti-dclk antibody. (A) Immunoblotting of COS7 cells transfected with DCLK1-GFP and DCLK2-GFP expression plasmids probed with anti-dclk antibody

More information

Hyper sensitive protein detection by Tandem-HTRF reveals Cyclin D1

Hyper sensitive protein detection by Tandem-HTRF reveals Cyclin D1 Hyper sensitive protein detection by Tandem-HTRF reveals Cyclin D1 dynamics in adult mouse Alexandre Zampieri, Julien Champagne, Baptiste Auzemery, Ivanna Fuentes, Benjamin Maurel and Frédéric Bienvenu

More information

(A) Schematic illustration of sciatic nerve ligation. P, proximal; D, distal to the ligation site.

(A) Schematic illustration of sciatic nerve ligation. P, proximal; D, distal to the ligation site. SUPPLEMENTRY INFORMTION SUPPLEMENTL FIGURES Figure S1. () Schematic illustration of sciatic nerve ligation. P, proximal; D, distal to the ligation site. () Western blot of ligated and unligated sciatic

More information

Figure S1 is related to Figure 1B, showing more details of outer segment of

Figure S1 is related to Figure 1B, showing more details of outer segment of Supplemental Information Supplementary Figure legends and Figures Figure S1. Electron microscopic images in Sema4A +/+ and Sema4A / retinas Figure S1 is related to Figure 1B, showing more details of outer

More information

A 3D human triculture system modeling neurodegeneration and neuroinflammation in Alzheimer s disease

A 3D human triculture system modeling neurodegeneration and neuroinflammation in Alzheimer s disease SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41593-018-0175-4 In the format provided by the authors and unedited. A 3D human triculture system modeling neurodegeneration and neuroinflammation

More information

Supplementary Data. Flvcr1a TCTAAGGCCCAGTAGGACCC GGCCTCAACTGCCTGGGAGC AGAGGGCAACCTCGGTGTCC

Supplementary Data. Flvcr1a TCTAAGGCCCAGTAGGACCC GGCCTCAACTGCCTGGGAGC AGAGGGCAACCTCGGTGTCC Supplementary Data Supplementary Materials and Methods Measurement of reactive oxygen species accumulation in fresh intestinal rings Accumulation of reactive oxygen species in fresh intestinal rings was

More information

Supplementary Figure 1. Drawing of spinal cord open-book preparations and DiI tracing. Nature Neuroscience: doi: /nn.3893

Supplementary Figure 1. Drawing of spinal cord open-book preparations and DiI tracing. Nature Neuroscience: doi: /nn.3893 Supplementary Figure 1 Drawing of spinal cord open-book preparations and DiI tracing. Supplementary Figure 2 In ovo electroporation of dominant-negative PlexinA1 in commissural neurons induces midline

More information

Supplementary Figure 1. GST pull-down analysis of the interaction of GST-cIAP1 (A, B), GSTcIAP1

Supplementary Figure 1. GST pull-down analysis of the interaction of GST-cIAP1 (A, B), GSTcIAP1 Legends Supplementary Figure 1. GST pull-down analysis of the interaction of GST- (A, B), GST mutants (B) or GST- (C) with indicated proteins. A, B, Cell lysate from untransfected HeLa cells were loaded

More information

GFP CCD2 GFP IP:GFP

GFP CCD2 GFP IP:GFP D1 D2 1 75 95 148 178 492 GFP CCD1 CCD2 CCD2 GFP D1 D2 GFP D1 D2 Beclin 1 IB:GFP IP:GFP Supplementary Figure 1: Mapping domains required for binding to HEK293T cells are transfected with EGFP-tagged mutant

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/4/167/ra20/dc1 Supplementary Materials for Poly(ADP-Ribose) (PAR) Binding to Apoptosis-Inducing Factor Is Critical for PAR Polymerase-1 Dependent Cell Death (Parthanatos)

More information

Parthanatos mediates AIMP2-activated age-dependent dopaminergic neuronal loss

Parthanatos mediates AIMP2-activated age-dependent dopaminergic neuronal loss SUPPLEMENTARY INFORMATION Parthanatos mediates AIMP2-activated age-dependent dopaminergic neuronal loss Yunjong Lee, Senthilkumar S. Karuppagounder, Joo-Ho Shin, Yun-Il Lee, Han Seok Ko, Debbie Swing,

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Thompson et al., http://www.jcb.org/cgi/content/full/jcb.200909067/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Modification-specific antibodies do not detect unmodified

More information

Coleman et al., Supplementary Figure 1

Coleman et al., Supplementary Figure 1 Coleman et al., Supplementary Figure 1 BrdU Merge G1 Early S Mid S Supplementary Figure 1. Sequential destruction of CRL4 Cdt2 targets during the G1/S transition. HCT116 cells were synchronized by sequential

More information

Supplemental Figure 1: GB-induced cell death is ROS-dependent. (a-b) K562 cells pre-incubated or not with NAC for 1h were treated with a sublytic

Supplemental Figure 1: GB-induced cell death is ROS-dependent. (a-b) K562 cells pre-incubated or not with NAC for 1h were treated with a sublytic Supplemental Figure 1: GB-induced cell death is ROS-dependent. (a-b) K562 cells pre-incubated or not with NAC for 1h were treated with a sublytic dose of P +/- GB. ROS production (a) and cell death (b)

More information

Supplemental Data. Liu et al. (2013). Plant Cell /tpc

Supplemental Data. Liu et al. (2013). Plant Cell /tpc Supplemental Figure 1. The GFP Tag Does Not Disturb the Physiological Functions of WDL3. (A) RT-PCR analysis of WDL3 expression in wild-type, WDL3-GFP, and WDL3 (without the GFP tag) transgenic seedlings.

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Moutin et al., http://www.jcb.org/cgi/content/full/jcb.201110101/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Tagged Homer1a and Homer are functional and display different

More information

At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in

At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in Supplementary Materials and Methods Barrier function assays At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in acidic X-gal mix (100 mm phosphate buffer at ph4.3, 3 mm

More information

Supplemental material

Supplemental material Supplemental material THE JOURNAL OF CELL BIOLOGY Gillespie et al., http://www.jcb.org/cgi/content/full/jcb.200907037/dc1 repressor complex induced by p38- Gillespie et al. Figure S1. Reduced fiber size

More information

Supplemental Data. Sethi et al. (2014). Plant Cell /tpc

Supplemental Data. Sethi et al. (2014). Plant Cell /tpc Supplemental Data Supplemental Figure 1. MYC2 Binds to the E-box but not the E1-box of the MPK6 Promoter. (A) E1-box and E-box (wild type) containing MPK6 promoter fragment. The region shown in red denotes

More information

Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling

Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Glendining KA 1, Markie D 2, Gardner RJM 4, Franz EA 3, Robertson SP 4, Jasoni CL 1 Supplementary

More information

To examine the silencing effects of Celsr3 shrna, we co transfected 293T cells with expression

To examine the silencing effects of Celsr3 shrna, we co transfected 293T cells with expression Supplemental figures Supplemental Figure. 1. Silencing expression of Celsr3 by shrna. To examine the silencing effects of Celsr3 shrna, we co transfected 293T cells with expression plasmids for the shrna

More information

Supplementary Figure 1: Derivation and characterization of RN ips cell lines. (a) RN ips cells maintain expression of pluripotency markers OCT4 and

Supplementary Figure 1: Derivation and characterization of RN ips cell lines. (a) RN ips cells maintain expression of pluripotency markers OCT4 and Supplementary Figure 1: Derivation and characterization of RN ips cell lines. (a) RN ips cells maintain expression of pluripotency markers OCT4 and SSEA4 after 10 passages in mtesr 1 medium. (b) Schematic

More information

SUPPLEMENTARY NOTE 3. Supplememtary Note 3, Wehr et al., Monitoring Regulated Protein-Protein Interactions Using Split-TEV 1

SUPPLEMENTARY NOTE 3. Supplememtary Note 3, Wehr et al., Monitoring Regulated Protein-Protein Interactions Using Split-TEV 1 SUPPLEMENTARY NOTE 3 Fluorescent Proteolysis-only TEV-Reporters We generated TEV reporter that allow visualizing TEV activity at the membrane and in the cytosol of living cells not relying on the addition

More information

Final Narrative. Principal Investigator Name, Address, Telephone Number

Final Narrative. Principal Investigator Name, Address, Telephone Number Final Narrative Report Principal Investigator Name, Address, Telephone Number Melitta Schachner, Ph.D. W.M. Keck Center for Collaborative Neuroscience 604 Allison Road, 0-251 Piscataway, NJ 08854 Ph: 732-445-1780

More information

Supplementary Figure 1. Pathologically phosphorylated Tau is localized to the presynaptic terminals of Alzheimer s disease (AD) patient brains.

Supplementary Figure 1. Pathologically phosphorylated Tau is localized to the presynaptic terminals of Alzheimer s disease (AD) patient brains. Supplementary Figure 1. Pathologically phosphorylated Tau is localized to the presynaptic terminals of Alzheimer s disease (AD) patient brains. Ultrathin (70 nm) sections of healthy control or AD patient

More information

Sarker et al. Supplementary Material. Subcellular Fractionation

Sarker et al. Supplementary Material. Subcellular Fractionation Supplementary Material Subcellular Fractionation Transfected 293T cells were harvested with phosphate buffered saline (PBS) and centrifuged at 2000 rpm (500g) for 3 min. The pellet was washed, re-centrifuged

More information

Figure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab.

Figure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab. / 36B4 mrna ratio Figure S1 * 2. 1.6 1.2.8 *.4 control TNFα BRL49653 Figure S2 Su bw AT p iw Anti- (COOH-terminal peptide) Ab Blot : Anti-GST-(45-127) Ab β-actin Figure S3 HB2 HW AT BA T Figure S4 A TAG

More information

Figure S1. Related to Figure 1, to show 3-D images of nerve/vessel patterning.

Figure S1. Related to Figure 1, to show 3-D images of nerve/vessel patterning. Supplemental Information Inventory of Supplemental Information Figure S1. Related to Figure 1, to show 3-D images of nerve/vessel patterning. Figure S2. Related to Figure 4, to validate Npn-1 signaling

More information

Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or

Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or absence of the acetyltransferase CBP and acetylated TDP-43

More information

Supplementary Information Cyclin Y inhibits plasticity-induced AMPA receptor exocytosis and LTP

Supplementary Information Cyclin Y inhibits plasticity-induced AMPA receptor exocytosis and LTP Supplementary Information Cyclin Y inhibits plasticity-induced AMPA receptor exocytosis and LTP Eunsil Cho, Dong-Hyun Kim, Young-Na Hur, Daniel J. Whitcomb, Philip Regan, Jung-Hwa Hong, Hanna Kim, Young

More information

Supplemental Materials and Methods

Supplemental Materials and Methods Supplemental Materials and Methods In situ hybridization In situ hybridization analysis of HFE2 and genin mrna in rat liver tissues was performed as previously described (1). Briefly, the digoxigenin-labeled

More information

hnrnp D/AUF1 Rabbit IgG hnrnp M

hnrnp D/AUF1 Rabbit IgG hnrnp M Mouse IgG Goat IgG Rabbit IgG Mouse IgG hnrnp F Goat IgG Mouse IgG Kb 6 4 3 2 15 5 Supplementary Figure S1. In vivo binding of TERRA-bound RBPs to target RNAs. Immunoprecipitation (IP) assay using 3 mg

More information

BF Fox-3 HLA merge A 3

BF Fox-3 HLA merge A 3 Supplementary Figure 1 F Fox-3 merge 3 SN TRL L P L TRL SN P Supplementary Figure 1. Series of low magnification brightfield and immunofluorescence images (Fox-3 in green/, and in red). ircles indicate

More information

Positive selection gates for the collection of LRCs or nonlrcs had to be drawn based on the location and

Positive selection gates for the collection of LRCs or nonlrcs had to be drawn based on the location and Determining positive selection gates for LRCs and nonlrcs Positive selection gates for the collection of LRCs or nonlrcs had to be drawn based on the location and shape of the Gaussian distributions. For

More information

Supplemental Data. Wu et al. (2). Plant Cell..5/tpc RGLG Hormonal treatment H2O B RGLG µm ABA µm ACC µm GA Time (hours) µm µm MJ µm IA

Supplemental Data. Wu et al. (2). Plant Cell..5/tpc RGLG Hormonal treatment H2O B RGLG µm ABA µm ACC µm GA Time (hours) µm µm MJ µm IA Supplemental Data. Wu et al. (2). Plant Cell..5/tpc..4. A B Supplemental Figure. Immunoblot analysis verifies the expression of the AD-PP2C and BD-RGLG proteins in the Y2H assay. Total proteins were extracted

More information

Figure S1. Verification of ihog Mutation by Protein Immunoblotting Figure S2. Verification of ihog and boi

Figure S1. Verification of ihog Mutation by Protein Immunoblotting Figure S2. Verification of ihog and boi Figure S1. Verification of ihog Mutation by Protein Immunoblotting Extracts from S2R+ cells, embryos, and adults were analyzed by immunoprecipitation and immunoblotting with anti-ihog antibody. The Ihog

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Kanaani et al., http://www.jcb.org/cgi/content/full/jcb.200912101/dc1 Figure S1. The K2 rabbit polyclonal antibody is specific for GAD67,

More information

Figure legends for supplement

Figure legends for supplement Figure legends for supplement Supplemental Figure 1 Characterization of purified and recombinant proteins Relevant fractions related the final stage of the purification protocol(bingham et al., 1998; Toba

More information

Inventory of Supplemental Information for Melkman-Zehavi et al.

Inventory of Supplemental Information for Melkman-Zehavi et al. Inventory of Supplemental Information for Melkman-Zehavi et al. Supplementary methods for Melkman et al. Supplementary Figures Figure S1, related to Figure 2 Islet size and total beta cell mass of mutant

More information

WESTERN BLOT. BCH462- Practical

WESTERN BLOT. BCH462- Practical WESTERN BLOT BCH462- Practical What is Antigen [Ag]? What is Antibody [Ab]? Immunoassay: is a test that uses the highly specific and selective antigen-antibody reactions forming antibody and antigen complexes

More information

Supplementary Figure 1 PARP1 is involved in regulating the stability of mrnas from pro-inflammatory cytokine/chemokine mediators.

Supplementary Figure 1 PARP1 is involved in regulating the stability of mrnas from pro-inflammatory cytokine/chemokine mediators. Supplementary Figure 1 PARP1 is involved in regulating the stability of mrnas from pro-inflammatory cytokine/chemokine mediators. (a) A graphic depiction of the approach to determining the stability of

More information

Supplementary Information

Supplementary Information Supplementary Information Supplementary Figure 1. ZBTB20 expression in the developing DRG. ZBTB20 expression in the developing DRG was detected by immunohistochemistry using anti-zbtb20 antibody 9A10 on

More information

Supplementary Fig. 1

Supplementary Fig. 1 a FL (1-2266) NL (1-1190) CL (1191-2266) HA-ICE1: - HA-ICE1: - - - FLAG-ICE2: + + + + FLAG-ELL: + + + + + + IP: anti-ha FLAG-ICE2 HA-ICE1-FL HA-ICE1-NL HA-ICE1-CL FLAG-ICE2 b IP: anti-ha FL (1-2266) NL

More information

Supplemental Data. Furlan et al. Plant Cell (2017) /tpc

Supplemental Data. Furlan et al. Plant Cell (2017) /tpc Supplemental Data. Furlan et al. Plant Cell (0) 0.0/tpc..00. Supplemental Data. Furlan et al. Plant Cell (0) 0.0/tpc..00. Supplemental Data. Furlan et al. Plant Cell (0) 0.0/tpc..00. Supplemental Figure.

More information

Supplementary Fig. 1. Multiple five micron sections of liver tissues of rats treated

Supplementary Fig. 1. Multiple five micron sections of liver tissues of rats treated Supplementary Figure Legends Supplementary Fig. 1. Multiple five micron sections of liver tissues of rats treated with either vehicle (left; n=3) or CCl 4 (right; n=3) were co-immunostained for NRP-1 (green)

More information

Supplementary figures (Zhang)

Supplementary figures (Zhang) Supplementary figures (Zhang) Supplementary figure 1. Characterization of hesc-derived astroglia. (a) Treatment of astroglia with LIF and CNTF increases the proportion of GFAP+ cells, whereas the percentage

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature11094 Supplementary Figures Supplementary Figure 1: Analysis of GFP expression in P0 wild type and mutant ( E1-4) Fezf2-Gfp BAC transgenic mice. Epifluorescent images of sagittal forebrain

More information

Supplemental Fig. 1: PEA-15 knockdown efficiency assessed by immunohistochemistry and qpcr

Supplemental Fig. 1: PEA-15 knockdown efficiency assessed by immunohistochemistry and qpcr Supplemental figure legends Supplemental Fig. 1: PEA-15 knockdown efficiency assessed by immunohistochemistry and qpcr A, LβT2 cells were transfected with either scrambled or PEA-15 sirna. Cells were then

More information

Supplementary Figure 1 a

Supplementary Figure 1 a 3 min PMA 45 min PMA AnnexinV-FITC Supplementary Figure 1 5 min PMA 15 min PMA a 9 min PMA 12 min PMA 5 min FGF7 15 min FGF7 3 min FGF7 6 min FGF7 9 min FGF7 12 min FGF7 5 min control 3 min control 6 min

More information

Xu et al., Supplementary Figures 1-7

Xu et al., Supplementary Figures 1-7 Xu et al., Supplementary Figures 1-7 Supplementary Figure 1. PIPKI is required for ciliogenesis. (a) PIPKI localizes at the basal body of primary cilium. RPE-1 cells treated with two sirnas targeting to

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full//59/ra7/dc1 Supplementary Materials for Dok-7 ctivates the Muscle Receptor Kinase MuSK and Shapes Synapse Formation kane Inoue, Kiyoko Setoguchi, Yosuke Matsubara,

More information

Fig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.

Fig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG. Fig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.SCUBE2, E-cadherin.Myc, or HA.p120-catenin was transfected in a combination

More information

HCT116 SW48 Nutlin: p53

HCT116 SW48 Nutlin: p53 Figure S HCT6 SW8 Nutlin: - + - + p GAPDH Figure S. Nutlin- treatment induces p protein. HCT6 and SW8 cells were left untreated or treated for 8 hr with Nutlin- ( µm) to up-regulate p. Whole cell lysates

More information

Supplemental Materials. Matrix Proteases Contribute to Progression of Pelvic Organ Prolapse in Mice and Humans

Supplemental Materials. Matrix Proteases Contribute to Progression of Pelvic Organ Prolapse in Mice and Humans Supplemental Materials Matrix Proteases Contribute to Progression of Pelvic Organ Prolapse in Mice and Humans Madhusudhan Budatha, Shayzreen Roshanravan, Qian Zheng, Cecilia Weislander, Shelby L. Chapman,

More information

Figure S1. Specificity of polyclonal anti stabilin-1 and anti stabilin-2 antibodies Lysates of 293T cells transfected with empty vector, mouse

Figure S1. Specificity of polyclonal anti stabilin-1 and anti stabilin-2 antibodies Lysates of 293T cells transfected with empty vector, mouse Figure S1. Specificity of polyclonal anti stabilin-1 and anti stabilin-2 antibodies Lysates of 293T cells transfected with empty vector, mouse stabilin-1, or mouse stabilin-2 were immunoblotted using anti

More information

NgR1 and NgR3 are Receptors for Chondroitin Sulfate Proteoglycans

NgR1 and NgR3 are Receptors for Chondroitin Sulfate Proteoglycans NgR1 and NgR3 are Receptors for Chondroitin Sulfate Proteoglycans Travis L. Dickendesher 1,2, Katherine T. Baldwin 2,3, Yevgeniya A. Mironova 2,3, Yoshiki Koriyama 5,6, Stephen J. Raiker 2,8, Kim L. Askew

More information

Supplementary Table 1. Primers used to construct full-length or various truncated mutants of ISG12b2.

Supplementary Table 1. Primers used to construct full-length or various truncated mutants of ISG12b2. Supplementary Table 1. Primers used to construct full-length or various truncated mutants of ISG12b2. Construct name ISG12b2 (No tag) HA-ISG12b2 (N-HA) ISG12b2-HA (C-HA; FL-HA) 94-283-HA (FL-GFP) 93-GFP

More information

Supplementary Fig. 1. Schematic structure of TRAIP and RAP80. The prey line below TRAIP indicates bait and the two lines above RAP80 highlight the

Supplementary Fig. 1. Schematic structure of TRAIP and RAP80. The prey line below TRAIP indicates bait and the two lines above RAP80 highlight the Supplementary Fig. 1. Schematic structure of TRAIP and RAP80. The prey line below TRAIP indicates bait and the two lines above RAP80 highlight the prey clones identified in the yeast two hybrid screen.

More information

APA105Hu01 100µg Active Nerve Growth Factor (NGF) Organism Species: Homo sapiens (Human) Instruction manual

APA105Hu01 100µg Active Nerve Growth Factor (NGF) Organism Species: Homo sapiens (Human) Instruction manual APA105Hu01 100µg Active Nerve Growth Factor (NGF) Organism Species: Homo sapiens (Human) Instruction manual FOR RESEARCH USE ONLY NOT FOR USE IN CLINICAL DIAGNOSTIC PROCEDURES [ PROPERTIES ] 1th Edition

More information

SUPPLEMENTARY FIGURES

SUPPLEMENTARY FIGURES SUPPLEMENTARY FIGURES Supplementary Figure S1. Generation of a synaptobrevin2-mrfp knock-in mouse. (a) Targeting strategy of Syb2-mRFP knock-in mouse leaving the synaptobrevin2 gene locus intact except

More information

A brain-targeted, modified neurosin (kallikrein-6) reduces α-synuclein accumulation in a mouse model of multiple system atrophy

A brain-targeted, modified neurosin (kallikrein-6) reduces α-synuclein accumulation in a mouse model of multiple system atrophy Spencer et al. Molecular Neurodegeneration (2015) 10:48 DOI 10.1186/s13024-015-0043-6 RESEARCH ARTICLE A brain-targeted, modified neurosin (kallikrein-6) reduces α-synuclein accumulation in a mouse model

More information

Supplementary information

Supplementary information Supplementary information Supplementary figures Figure S1 Level of mycdet1 protein in DET1 OE-1, OE-2 and OE-3 transgenic lines. Total protein extract from wild type Col0, det1-1 mutant and DET1 OE lines

More information

Supplemental Information. Loss of MicroRNA-7 Regulation Leads. to a-synuclein Accumulation and. Dopaminergic Neuronal Loss In Vivo

Supplemental Information. Loss of MicroRNA-7 Regulation Leads. to a-synuclein Accumulation and. Dopaminergic Neuronal Loss In Vivo YMTHE, Volume 25 Supplemental Information Loss of MicroRNA-7 Regulation Leads to a-synuclein Accumulation and Dopaminergic Neuronal Loss In Vivo Kirsty J. McMillan, Tracey K. Murray, Nora Bengoa-Vergniory,

More information

Development of Novel Advanced Cell Culture Surfaces that Provide Better Cell Growth and Attachment for Cell-Based Assays

Development of Novel Advanced Cell Culture Surfaces that Provide Better Cell Growth and Attachment for Cell-Based Assays Development of Novel Advanced Cell Culture Surfaces that Provide Better Cell Growth and Attachment for Cell-Based Assays Elizabeth J. Abraham, Ph.D. BD Biosciences Outline Overview of surfaces and culture

More information

Rer1 and calnexin regulate endoplasmic reticulum retention of a peripheral myelin protein 22 mutant that causes type 1A Charcot-Marie-Tooth disease

Rer1 and calnexin regulate endoplasmic reticulum retention of a peripheral myelin protein 22 mutant that causes type 1A Charcot-Marie-Tooth disease Rer1 and calnexin regulate endoplasmic reticulum retention of a peripheral myelin protein mutant that causes type 1A Charcot-Marie-Tooth disease Taichi Hara, Yukiko Hashimoto, Tomoko Akuzawa, Rika Hirai,

More information

Supplementary Information

Supplementary Information Supplementary Information Supplementary Figure S1 (a) P-cRAF colocalizes with LC3 puncta. Immunofluorescence (IF) depicting colocalization of P-cRAF (green) and LC3 puncta (red) in NIH/3T3 cells treated

More information

Schematic representation of the endogenous PALB2 locus and gene-disruption constructs

Schematic representation of the endogenous PALB2 locus and gene-disruption constructs Supplementary Figures Supplementary Figure 1. Generation of PALB2 -/- and BRCA2 -/- /PALB2 -/- DT40 cells. (A) Schematic representation of the endogenous PALB2 locus and gene-disruption constructs carrying

More information

Applicazioni biotecnologiche

Applicazioni biotecnologiche Applicazioni biotecnologiche Analisi forense Sintesi di proteine ricombinanti Restriction Fragment Length Polymorphism (RFLP) Polymorphism (more fully genetic polymorphism) refers to the simultaneous occurrence

More information

Nature Biotechnology: doi: /nbt Supplementary Figure 1. Mass spectrometry characterization of epoxide reactions.

Nature Biotechnology: doi: /nbt Supplementary Figure 1. Mass spectrometry characterization of epoxide reactions. Supplementary Figure 1 Mass spectrometry characterization of epoxide reactions. (a) Degree of amine reactivity of bovine serum albumin (BSA) with epoxide molecules having different numbers of epoxide groups:

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Nakajima and Tanoue, http://www.jcb.org/cgi/content/full/jcb.201104118/dc1 Figure S1. DLD-1 cells exhibit the characteristic morphology

More information

Nature Immunology: doi: /ni.3101

Nature Immunology: doi: /ni.3101 Supplementary Figure 1 Generation of Plvap / mice. (a) Schematic presentation of the targeting construct as well as the wild-type and targeted Plvap alleles]. PuroR, puromycin resistance. The location

More information

(phosphatase tensin) domain is shown in dark gray, the FH1 domain in black, and the

(phosphatase tensin) domain is shown in dark gray, the FH1 domain in black, and the Supplemental Figure 1. Predicted Domain Organization of the AFH14 Protein. (A) Schematic representation of the predicted domain organization of AFH14. The PTEN (phosphatase tensin) domain is shown in dark

More information

Piscataway, NJ February 2007

Piscataway, NJ February 2007 Final Progress Report for the New Jersey Commission on Spinal Cord Research Submitted by David P. Crockett, PhD for the late Ira B. Black, MD Department of Neuroscience and Cell Biology UMDNJ-Robert Wood

More information

JCB. Supplemental material THE JOURNAL OF CELL BIOLOGY. Hong et al.,

JCB. Supplemental material THE JOURNAL OF CELL BIOLOGY. Hong et al., Supplemental material JCB Hong et al., http://www.jcb.org/cgi/content/full/jcb.201412127/dc1 THE JOURNAL OF CELL BIOLOGY Figure S1. Analysis of purified proteins by SDS-PAGE and pull-down assays. (A) Coomassie-stained

More information

Input. Pulldown GST. GST-Ahi1

Input. Pulldown GST. GST-Ahi1 A kd 250 150 100 75 50 37 25 -GST-Ahi1 +GST-Ahi1 kd 148 98 64 50 37 22 GST GST-Ahi1 C kd 250 148 98 64 50 Control Input Hap1A Hap1 Pulldown GST GST-Ahi1 Hap1A Hap1 Hap1A Hap1 Figure S1. (A) Ahi1 western

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature12138 Supplementary Figure 1. Knockdown of KRAS leads to a reduction in macropinocytosis. (a) KRAS knockdown in MIA PaCa-2 cells expressing KRASspecific shrnas

More information

Visualizing Cells Molecular Biology of the Cell - Chapter 9

Visualizing Cells Molecular Biology of the Cell - Chapter 9 Visualizing Cells Molecular Biology of the Cell - Chapter 9 Resolution, Detection Magnification Interaction of Light with matter: Absorbtion, Refraction, Reflection, Fluorescence Light Microscopy Absorbtion

More information

Supplemental Figures Supplemental Figure 1

Supplemental Figures Supplemental Figure 1 Supplemental Figures Supplemental Figure 1 The de novo and salvage purine synthesis pathways are shown converging on GMP synthesis (A). Enzymes and intermediates not involved in MPA action and/or guanosine

More information

Supplementary Figure S1. Alterations in Fzr1( / );Nestin-Cre brains. (a) P10 Cdh1-deficient brains display low levels of Myelin basic protein (MBP)

Supplementary Figure S1. Alterations in Fzr1( / );Nestin-Cre brains. (a) P10 Cdh1-deficient brains display low levels of Myelin basic protein (MBP) Supplementary Figure S1. Alterations in Fzr1( / );Nestin-Cre brains. (a) P10 Cdh1-deficient brains display low levels of Myelin basic protein (MBP) in the cortex (area 1 as defined in Fig. 2a), and corpus

More information