NgR1 and NgR3 are Receptors for Chondroitin Sulfate Proteoglycans

Transcription

1 NgR1 and NgR3 are Receptors for Chondroitin Sulfate Proteoglycans Travis L. Dickendesher 1,2, Katherine T. Baldwin 2,3, Yevgeniya A. Mironova 2,3, Yoshiki Koriyama 5,6, Stephen J. Raiker 2,8, Kim L. Askew 9, Andrew Wood 9, Cédric G. Geoffroy 10, Binhai Zheng 10, Claire D. Liepmann 11, Yasuhiro Katagiri 11, Larry I. Benowitz 5,6,7, Herbert M. Geller 11, and Roman J. Giger 1,2,3,4 1 Neuroscience Program 2 Department of Cell & Developmental Biology 3 Cellular & Molecular Biology Program 4 Department of Neurology University of Michigan School of Medicine 3065 BSRB, 109 Zina Pitcher Place Ann Arbor, MI Laboratory for Neuroscience Research in Neurosurgery and F. M. Kirby Neurobiology Center, Children's Hospital 6 Department of Surgery 7 Program in Neuroscience Harvard Medical School Boston, MA Department of Biomedical Genetics University of Rochester School of Medicine and Dentistry 601 Elmwood Avenue Rochester, NY Neuroscience Research Unit Pfizer Global Research and Development Groton, CT Department of Neurosciences University of California San Diego School of Medicine La Jolla, CA Developmental Neurobiology Section Division of Intramural Research, National Heart, Lung, and Blood Institute National Institutes of Health Bethesda, MD 20892

2 Supplementary Figure 1: Generation of Nogo receptor conditional knockout mice. (a) Targeting strategy for the generation of NgR1, NgR2, and NgR3 conditional knockout mice. The mouse NgR1 and NgR3 genes are each comprised of 2 coding exons and the mouse NgR2 gene is comprised of 3 coding exons. For all three genes, exon 2 was flanked by loxp sites (black

3 triangles). Exons are shown in blue. The size of exons in base pairs (bp) and introns in kilobases (kb) is indicated. A neo/ura selection marker (orange) flanked by frt sites (green boxes) was inserted in each of the three gene loci. (b) NgR3 gene targeting strategy. (Top) Distribution of BamH1 and Xba1 restriction sites relative to exon2 of the mouse NgR3 gene. (Middle) Targeting vector for generation of NgR3 conditional knockout mice. (Bottom) Targeted locus in NgR3 conditional mutants. The position of the 5 and 3 outside probes used for Southern blot analysis (XbaI) of double selected embryonic stem cells is indicated. To generate germline deletion mutants, mice carrying conditional alleles were crossed with protamine cre transgenic mice and then intercrossed to generate double and triple mutants. (c) PCR genotyping of DNA isolated from tail biopsies of WT and NgR123 / mice. For all primer sets (NgR1, NgR2, NgR3), the null PCR product is larger than the WT PCR product. PCR primers for NgR1 conditional mice include: 5 GGTCTAGGGATGCATCTCAG 3, 5 ACATCTGAAGGCCTTCTGG 3, and 5 GTGGTCTGTGTGGCTCCTGC 3 (WT allele 200bp, conditional allele 300bp, null allele 320bp); PCR primers for NgR2 conditional mice include: 5 CAGTCTTGCAGCTGACTGTAGCTGAG 3, 5 GACCTGTGGGGAGAGCATAGTGAG 3, and 5 GTTTAACGGCTAGCCAGCCAACATC 3 (WT allele 333bp, conditional allele 425bp, null allele 458bp); and PCR primers for NgR3 conditional mice include: 5 AGTGCTCTGAGATTGCTGGTTGC 3, 5 GGAAGGGTATCACGTCTCACTCGG 3, and 5 CAGAAAAGCAGGCTGGGAAGC 3 (WT allele 255bp, conditional allele 340bp, null allele 370bp). (d) Western blot analysis of Concanavalin A affinity-purified proteins from adult brain lysates of WT and NgR123 / mice, using polyclonal rabbit anti NgR1, NgR2, and NgR3 immune sera (normalized to β actin), shows that triple mutants are null for NgR1, NgR2, and NgR3 protein.

4 Supplementary Figure 2: Myelin inhibition of DRG neurons is mediated by Nogo receptor independent mechanisms. (a) P7 dorsal root ganglion (DRG) neurons from WT, NgR1 /, NgR12 /, NgR3 /, and NgR123 / pups are strongly and equally inhibited when plated on crude CNS myelin substrate (40μg/ml). On CNS myelin isolated from NogoABC;MAG;OMgp triple null (NMO / ) mice (40μg/ml), DRG neurons from all genotypes show enhanced neurite outgrowth, with no significant difference between WT and NgR single or compound mutant neurons. On a BSA control substrate, neurite length of all five genotypes is comparable. (b) Quantification of neurite length. At least 300 neurites of TuJ1 labeled cells were counted per condition (n=7 independent experiments). Light gray bars (BSA); black bars (WT myelin); dark gray bars (NMO myelin). Results are presented as mean ±SEMs (one way ANOVA, Tukey s post hoc), n.s.=not significant. Scale bar, 50μm.

5

6 Supplementary Figure 3: Proteoglycans participate in binding of soluble NgR1 and NgR3 to brain sections. Binding of soluble AP NgR1 CT+stalk (5nM) or AP NgR3 CT+stalk (5nM) to brain tissue sections of (a) NogoABC;MAG;OMgp triple mutants, (b) NgR123 triple mutants, or (c) p75 / (exoniii), p75 / (exoniv), NgR1 /, GalNAcT / (GM2/GD2 synthase), and GD3S / (GD3 synthase) mutants is indistinguishable from WT mice. This suggests that binding of AP NgR1 CT+stalk and AP NgR3 CT+stalk to brain is mediated by novel, as of yet unidentified binding partners. To examine whether binding of AP NgR1 CT+stalk or AP NgR3 CT+stalk to brain is mediated by a protein protein interaction, tissue sections were pretreated with heat (3 hours in a 75⁰C water bath) or preincubated with trypsin. Neither treatment significantly reduced binding. This suggests that carbohydrate structures participate in Nogo receptor binding. To examine whether Nogo receptors associate with neural glycoconjugates, brain tissue sections were preincubated with glycopeptidase F, N acetylglucosaminidase, Vibrio cholerae neuraminidase (VCN), endoneuraminidase N (Endo N), heparinase III, or chondroitinase ABC. Digestion with heparinase III or chondroitinase ABC leads to a partial, yet substantial reduction in binding of AP NgR1 CT+stalk or AP NgR3 CT+stalk. The most pronounced reduction is observed in the presence of heparin (50µg/ml). In marked contrast, glycopeptidase F, N acetylglucosaminidase, VCN, or Endo N incubation does not lead to a substantial reduction in fusion protein binding. Together, these results suggest that neural glycosaminoglycans (GAGs) participate in soluble NgR1 and NgR3 binding to brain tissue. Scale bar, 50µm.

7

8 Supplementary Figure 4: Ligand dependent association of NgR1 and NgR3. (a) In transfected COS 7 cells, the NgR1 co receptors p75 NTR, TROY, and Lingo 1 show binding to bath applied, soluble NgR1 Fc, but not to NgR3 Fc. AP Fc was used as a negative control. (b) Co immunoprecipitation (IP) experiments in HEK293T cells confirm that p75 NTR interacts with NgR1 in cis, but not with NgR2 or NgR3. For IP experiments, HEK293T cells were co transfected with p75 NTR and either NgR1 myc, NgR2 myc, or NgR3 myc. Cell lysates were immunoprecipitated with anti p75 NTR, and the immune complex was analyzed by anti myc western blotting. (c) HEK293T cells were transfected with NgR1 and either NgR2 myc or NgR3 myc. Prior to lysis and IP with anti NgR1, cells were incubated for 30 minutes with CSPGs. The precipitated immune complex was analyzed by anti myc western blotting. A CSPG dependent association of NgR1 and NgR3, but not NgR1 and NgR2, was observed. (d) The ligand dependent interaction of NgR1and NgR3 is not sensitive to co expression of p75 NTR. HEK293T cells were transfected with NgR1, NgR3 myc, and p75 NTR ; cell lysates were immunoprecipitated with anti NgR1; and the immune complex was analyzed by anti myc and anti p75 NTR western blotting, revealing the presence of p75 NTR and NgR3. (e) In CGNs, p75 NTR is not necessary for inhibition on substrate bound CSPGs (10μg/ml). P7 CGNs from WT and p75 NTR / pups are strongly and equally inhibited when plated on CSPGs. A partial release of inhibition was observed in the presence of the bath applied ROCK inhibitor Y (10µM). On a BSA control substrate, neurite lengths of WT and p75 NTR / CGNs are comparable, and increased in the presence of Y (f) Quantification of neurite length. At least 150 neurites of TuJ1 labeled cells were counted per condition (n=3 independent experiments). Light gray bars (WT); black bars (p75 / ) dark gray bars (WT w/ Y 27632). Results are presented as mean

9 ±SEMs. ** P< (one way ANOVA, Tukey s post hoc), n.s.= not significant. Scale bar: a, 20μm; e, 70μm.

10 Supplementary Figure 5: NgR1 and NgR3 show very similar GAG binding preferences. (a) Schematic of the ELISA strategy used to test whether soluble NgRs and RPTPσ bind directly to immobilized GAGs. ELISA plates were precoated with streptavidin and incubated with biotinylated GAGs. Increasing concentrations of soluble receptor fusion proteins were added to the plates, the plates were rinsed, and bound AP activity was quantified. (b) Summary of ELISA data. NgR1 and NgR3 bind directly to CS B, CS D, CS E, and heparin, but not to CS A or CS C. (c) Soluble RPTPσ(1 3) competes effectively with NgR1 for binding to CS E. The binding of AP NgR1 to CS E decreases in the presence of increasing doses of RPTPσ(1 3) Fc. (d) Replacement of both GAG binding motifs of NgR1 with the corresponding sequences of NgR2 (NgR1 C27 K277 /NgR2 V281 G399 Fc) abolishes binding to P1 rat brain tissue sections. (e) Quantification of NgR1 Fc and NgR1 C27 K277 /NgR2 V281 G399 Fc binding to CS B, CS E, and heparin by ELISA. Scale bar, 50μm.

11

12 Supplementary Figure 6: Evidence for Nogo receptor independent mechanisms for CSPG inhibition. (a) CSPG dose response effect on P7 CGN neurite outgrowth inhibition. When adsorbed to culture plates at 1μg/ml, CSPGs do not significantly inhibit neurite outgrowth. At 10μg/ml, neurite length is decreased in all genotypes; however, NgR123 / and RPTPσ / neurites are significantly longer than WT, NgR1 /, NgR12 /, and NgR3 / neurites. At 100μg/ml CSPG, NgR123 / and RPTPσ / CGNs no longer show enhanced neurite growth compared to controls. Light gray bars (WT); black bars (NgR1 / ); purple bars (NgR12 / ); dark gray bars (NgR3 / ); blue bars (NgR123 / ); orange bars (RPTPσ / ). At least 300 neurites were counted per condition (n=4 independent experiments). Results are presented as mean ±SEMs. ** P< (one way ANOVA, Tukey s post hoc), n.s.=not significant. (b) WT, NgR1 /, and NgR123 / P7 DRG neurons are strongly inhibited when plated on substrate bound CSPGs (10μg/ml). RPTPσ / DRG neurons show a significant, yet incomplete release of CSPG inhibition. On a BSA control substrate, neurite length of all four genotypes is comparable. Gray bars (BSA); black bars (CSPGs). At least 300 neurites of TuJ1 labeled cells were counted per condition (n=4 independent experiments). Results are presented as mean ±SEMs. ** P< (one way ANOVA, Tukey s post hoc). Scale bar, 30μm.

13

14 Supplementary Figure 7: In adult mice, the combined loss of NgR1 and NgR3, but not NgR1 and NgR2, is sufficient to significantly enhance axon regeneration following retro orbital optic nerve crush injury. (a i) Two weeks following optic nerve injury, regenerative axonal growth was assessed by anti GAP43 immunolabeling of longitudinal optic nerve sections. (a i ) To assess whether retinal ganglion cells (RGCs) in a growth activated state show an additive growth effect when combined with genetic ablation of Nogo receptors, a separate group of animals received an intraocular injection (i.o.) of Zymosan at the time of optic nerve injury. Anti GAP43 immunolabeling of injured optic nerve from (a) WT, (b) NgR1 /, (c) NgR2 /, (d) NgR3 /, (e) RPTPσ /, and (f) NgR12 / mice fails to identify significant regenerative growth of axons beyond the lesion site (asterisk). (g) NgR13 / and (h) NgR123 / mice show increased and comparable axonal regeneration, which is further enhanced in (i) NgR13/RPTPσ / (NgR13/σ / ) triple mutant mice. Following i.o. Zymosan injection, (b ) NgR1 /, (c ) NgR2 /, (d ) NgR3 /, (e ) RPTPσ /, and (f ) NgR12 / mice do not show enhanced regeneration compared to (a ) WT mice with i.o. Zymosan. An additive effect of i.o. Zymosan with genetic manipulation was observed for (g ) NgR13 / and (h ) NgR123 / mice. (i ) Loss of NgR1, NgR3 and RPTPσ (NgR13/σ / ) combined with i.o. Zymosan resulted in a further increase of fiber growth (see main manuscript for details). Scale bar, 200μm.

15

16 Supplementary Figure 8: Optic nerve injury induced retinal ganglion cell death is similar in WT and NgR123 / triple mutants. (a) To assess cell loss in the retinal ganglion cell (RGC) layer 14 days after nerve crush injury, coronal sections of WT and NgR123 / retina were immunolabeled with TuJ1 and compared to uninjured retina. Intraocular injection of Zymosan increased the density of TuJ1 labeled cells in the RGC layer; however, this effect was independent of the Nogo receptor genotype. (b) Quantification of the density of TuJ1 + cells in the RGC layer per field of view as a percentage of the uninjured WT control. Cell counts were performed on at least 15 sections per condition (n=3 independent experiments). Gray bars (WT); black bars (NgR123 / ). Results are presented as mean ±SEMs (one way ANOVA, Tukey s post hoc), n.s.=not significant. (c) Time course of RGC death following optic nerve injury. Shown is the quantification of the density of TuJ1 + cells in the RGC layer per field of view (at 0, 3, 5, 7, 9, 14, and 19 days following injury) as a percentage of the uninjured retina. The majority of cell death occurs by 7 days post optic nerve injury. Cell counts were performed on at least 10 sections per condition. Results are presented as mean ±SEMs. (d-e) Time course of caspase 3 activation following optic nerve injury. The number of RGCs labeled for activated caspase 3 is shown as a percentage of the total number of cells (TUJ1 positive) per field of view at each time point (0, 3, 5, 7, 9, 14, and 19 days following injury). The peak of activated caspase 3 labeling is seen between 3 and 5 days post injury. Cell counts were performed on at least 10 sections per condition. Results are presented as mean ±SEMs. Scale bar: a, 30μm; d, 60μm.

17 Supplementary Figure 9: Intraocular Zymosan injection does not affect the expression of Nogo receptors or RPTPσ in the retinal ganglion cell layer. In situ hybridization on adult WT retina with digoxigenin labeled crna probes specific for (a) NgR1, (b) NgR2, (c) NgR3, and (d) RPTPσ transcripts. Mice received either no Zymosan, or intraocular Zymosan injection on day 0, followed by examination at 3 or 7 days post injection. Zymosan injection does not result in any obvious changes in expression of NgRs or RPTPσ in the retinal ganglion cell (RGC) layer or inner nuclear layer. For quantification of receptor expression in the RGC layer, all retinal sections were developed for the same amount of time. The expression of each receptor in the RGC layer is shown as a percentage of the No Zymosan control. At least 20 sections were assessed per condition (n=4 independent experiments). Light gray bars (No Zymosan); black bars (Zymosan 3d); dark gray bars (Zymosan 7d). Results are presented as mean ±SEMs (one way ANOVA, Tukey s post hoc), n.s.= not significant. Scale bar, 80μm.

18

19 Supplementary Table: Summary of optic nerve regeneration studies. (a) Two weeks following injury, regeneration in NgR123 /, NgR13 /, and NgR13/RPTPσ / compound mutant mice is significantly increased compared to WT mice at 0.2 and 0.4mm distal to the injury site. Compared to WT mice, regeneration in NgR1 /, NgR2 /, NgR3 /, NgR12 /, or RPTPσ / at 0.2 and 0.4mm is not significantly enhanced. *** P< (one way ANOVA, Tukey s post hoc), n.s.= not significant. (b) Following intraorbital Zymosan injection, regeneration in NgR123 /, NgR13 /, and NgR13/RPTPσ / compound mutant mice is significantly enhanced compared to WT mice at 0.2 and 0.8mm distal to the injury site. There is no significant difference in axon regeneration between WT mice and NgR1 /, NgR2 /, NgR3 /, NgR12 /, or RPTPσ / mutant mice. *** P< 0.001, ** P<0.01 (one way ANOVA, Tukey s post hoc), n.s.= not significant. (c) Two weeks following injury, regeneration in NgR123 / mice is significantly increased compared to WT, NgR1 /, NgR2 /, NgR3 /, NgR12 /, and RPTPσ / mice, and decreased compared to NgR13/RPTPσ / mice, at 0.2 and 0.4mm distal to the injury site. There is no significant difference in the regeneration phenotype of NgR123 / and NgR13 / compound mutants. *** P< 0.001, ** P<0.01 (one way ANOVA, Tukey s post hoc), n.s.= not significant. (d) Following intraocular Zymosan injection, axon regeneration in NgR123 / mice is significantly increased compared to WT, NgR1 /, NgR2 /, NgR3 /, NgR12 /, and RPTPσ / mice at 0.2 and 0.8mm distal to the injury site. There is no significant difference in axon regeneration between NgR123 / and NgR13 / or NgR13/RPTPσ / mutant mice (with intraocular Zymosan injection) at these distances. At distances 0.4, 0.6, 1.0, 1.2, and 1.4mm beyond the injury site, axon regeneration in NgR13/RPTPσ / mice is significantly greater than in NgR123 / mice (with intraocular Zymosan injection). *** P< 0.001, ** P<0.01, * P<0.05 (one way ANOVA, Tukey s post hoc), n.s.= not significant. (e) For an unbiased assessment of the optic nerve regeneration phenotype in Nogo

20 receptor single and compound mutants, two independent data sets were generated by two independent surgeons: K. Baldwin (University of Michigan) and Y. Koriyama (visiting scientist from Kanazawa University). Both surgeons were originally trained in the laboratory of L. Benowitz. A total of 84 mice (K.B. 51 mice, Y.K 33 mice) were operated on, and each surgeon performed crush injury on the following genotypes: WT, NgR1 /, and NgR123 / mice. Only optic nerves from mice that showed no bleeding, infection, degeneration, or other complications of the operated eye were included for quantification of regenerating axons. The two data sets were then compared and analyzed for any significant differences between them, comparing the total number of GAP43 + axons for each genotype at two prespecified distances (0.4mm, 1.0mm) beyond the lesion site (unpaired t test). While there is some variation in the number of regenerating fibers, the principal findings of the two independently generated data sets are very comparable: WT mice (129 background or C57BL/6 background) show minimal regeneration of GAP43 + retinal ganglion cell axons. Regeneration in NgR1 / mice is not enhanced compared to WT mice. Both data sets show a modest but significant increase in regenerating axons in NgR123 / mice (P< 0.001, K.B; P< 0.05, Y.K.). WT mice that received Zymosan show greatly enhanced axon regeneration compared to WT mice that did not receive Zymosan. Notably, regeneration in Zymosan treated WT mice is significantly enhanced compared to NgR123 / mice without Zymosan (P< for both data sets). Importantly, both data sets show significantly enhanced fiber growth at mm beyond the injury site in NgR123 / mice with Zymosan compared to WT mice with Zymosan (P< 0.05 at 1.0, 1.2, and 1.4mm; P< 0.01 at 0.8mm; P< at 0.2, 0.4, and 0.6mm K.B.; P< 0.05 at 0.4 and 0.6mm; P< 0.01 at 0.2, 1.2, and 1.4mm; P< at 0.8 and 1.0mm Y.K.).