Inventory of Supplemental Information for Melkman-Zehavi et al.

Size: px
Start display at page:

Download "Inventory of Supplemental Information for Melkman-Zehavi et al."

Transcription

1 Inventory of Supplemental Information for Melkman-Zehavi et al. Supplementary methods for Melkman et al. Supplementary Figures Figure S1, related to Figure 2 Islet size and total beta cell mass of mutant animals is not significantly different from that of control mice. Analysis of pancreatic tissue that was isolated from agematched animals at 3 weeks post Tamoxifen treatment. (A) The mean (± SEM) beta cell mass of control (n = 2) and mutant animal (n = 3) tissues was calculated by morphometry. (B) Comparable distribution of islet size (displayed as area of insulin staining) between control and mutant animals. (C) Comparable and low apoptosis frequency detected in three control and three mutant animals (>20 islets per animal). Figure S2, related to Figure 2 Mutant beta cells maintain normal PC1/3 expression. Immunostaining of GFP expression (A,D) and PC1/3 (B,E) shows their colocalization in the merged picture (yellow, C,F) in both control (A-C) and mutant (D-F) animals. Figure S3 related to Figure 4 Mutant beta cells maintain expression of beta cell markers. Quantification of individual beta cells co-expressing insulin and transcription factors relevant to insulin transcription: Pax6, NKX6.1 and MAFA (control) and beta cells that underwent recombination, co-expressing GFP and the same set of transcription factors. Three animals in each group; >27 islets; >1300 individual beta cells per group. Figure S4 Expression array analysis of mirna expressed in adult mouse islets. A vertical histogram listing mirna expressed in isolated islets, listed by their relative fluorescence intensity after hybridization to a home-printed microarray (Ambion). Note that the design of this array did not contain features for mir-375.

2 Supplementary methods for Melkman et al.: Primers for PCR genotyping. Gene Forward primer Reverse primer Dicer1 CCTGACAGTGACGGTCCAAAG CATGACTCTTCAACTCAAACT Cre TGCCACGACCAAGTGACAGC CCAGGTTACGGATATAGTTCATG GFP CCTACGGCGTGCAGTGCTTCAGC CGGCGAGCTGCACGCTGCGTCCTC Primers for quantitative real-time PCR of mrnas. Gene Forward primer Reverse primer Dicer1 CACGCCTCCTACCACTACAACA CCTGGAGAATGCTGCCGTGGGT insulin1 CCTGTTGGTGCACTTCCTAC TGCAGTAGTTCTCCAGCTGG insulin2 CGTGGCTTCTTCTACACACCC AGCTCCAGTTGTGCCACTTGT Pdx1 TTCCCGAATGGAACCGAGC GTAGGCAGTACGGGTCCTCT Nkx2.2 CCGGGCGGAGAAAGGTATG CTGTAGGCGGAAAAGGGGA Nkx6.1 TCAGTCAAGGTCTGGTTCC CGATTTGTGCTTTTTCAGCA MafA AGGAGGAGGTCATCCGACTG CTTCTCGCTCTCCAGAATGTG NeouroD1 GACCCAGAAACTGTCTAAAATAGAGACA AAGGAGACCAGATCAGGGCTTT Stx3 GAAGGCACGGGATGAAACTAA GGACAGTCCAATAATCAACGCTA Hes1 GTCTAAGCCAACTGAAAACACTGATT TGCCTTCTCTAGCTTGGAATGC Insm1 CGGCCACCTTCTACAGCTC GGAGGATCACCTGTCTATTCTCA Crem GCTGAGGCTGATGAAAAACA GCCACACGATTTTCAAGACA Sox6 GACAGCGTTCTGTCATCTCAGCAA CGTTCCGGGGTTCCAAAAGTAACA Tle4 TTTACAGGCTCAATACCACAGTC TGCACAGATAGCATTTAGTCGTT Bhlhe22 GGGGAGAGGGAGGTTTAGTG CCCTTTCATCACTTGCCAAT HPRT CTGGTTAAGCAGTACAGCCCCAAA TGGCCTGTATCCAACACTTCGAGA GAPDH TGGCAAAGTGGAGATTGTTGCC AAGATGGTGATGGGCTTCCCG Primary antibodies Antibody guinea pig anti-insulin rabbit anti-glucagon rabbit anti-somatostatin goat anti-gfp Concentration and manufacturer 1:200; DAKO 1:200; DAKO 1:200; Zymed 1:100; Abcam

3 rabbit anti-gfp rabbit anti-pdx1 Rabbit anti-ngn3 mouse anti-nkx6.1 Rabbit anti-mafa Rabbit anti-synaptophysin Rabbit anti-pax6 Goat anti-ghrelin rabbit anti-activated caspase-3 rabbit anti-prohormone convertase 1/3 1:250; Invitrogen 1: 5000 Beta Cell Biology Consortium 1:300; Santa cruz 1:100; hybridoma bank 1:100, Bethyl 1:100, DAKO 1:300; Chemicon 1:50; Santa cruz 1:50, cell signaling 1:100; Chemicon Secondary antibodies conjugated to CY2, CY3, or CY5 were all from Jackson Immunoresearch Laboratories (1:100). Histomorphometry To determine beta cell mass, consecutive paraffin sections 5 μm in thickness and 75 μm apart spanning the entire pancreas (approximately 9 sections/ pancreas) were stained for insulin and counterstained using Harris hematoxylin (Sigma). Digital images of sections were obtained at a low magnification ( 40) and stitched using NIS-Elements software. The fraction of beta cells was determined by measuring the area of insulin immuno-reactivity divided by the area of the whole pancreas, determined by counter-staining with hematoxylin. The mass of beta cells was calculated as the product of pancreas weight and the fraction of tissue covered by beta cells. Anti-miRNA Oligonucleotide (AMO) synthesis and purification. AMOs were designed as reverse complements to the targeted mirnas and were made with 2 -O-Methyl RNA (2 OMe) bases with phosphodiester linkages using standard phosphoramidite chemistry at Integrated DNA Technologies (Coralville, IA, USA). Each AMO had a non-nucleotide chemical modifier, called ZEN inserted between the last and next to last base on both the 5 - and 3 -ends.this modifier is a napthylazo group which non-specifically increases binding affinity (T m ) and also renders the

4 AMO resistant to exonuclease degradation (K.A. Lennox and M.A. Behlke, manuscript in preparation). Each AMO also had a 3 -cholesterol-teg modifier (Glen Research, Sterling, VA, USA). The AMOs were purified using reversed-phase high performance liquid chromatography (RP-HPLC). Electrospray-ionization liquid chromatography mass spectroscopy (ESI-LCMS) of the oligonucleotides was conducted using an Oligo HTCS system (Novatia, Princeton, NJ), which consisted of ThermoFinnigan TSQ7000, Xcalibur data system, ProMass data processing software and Paradigm MS4 HPLC (MichromBioResources, Auburn, CA). Experimental molar masses for all single strand oligomers were within 1.5 g/mol of expected mass. Oligonucleotides were prepared as sodium salts. The NC1 AMO is a non-targeting control oligonucleotide that is not complementary to any entry in mirbase. A list of all AMOs employed in this study are listed in the table below. Name Sequence (5 3 ) NC1 AMO Let-7cAMO Let-7fAMO mmu-mir-7aamo mmu-mir-9 AMO mmu-mir-24amo mmu-mir-26aamo mmu-mir-27bamo mmu-mir-30aamo mmu-mir-141amo mmu-mir-148aamo mmu-mir-182amo mmu-mir-200camo mmu-mir-375amo G z CGUAUUAUAGCCGAUUAACG z A-Chol A z ACCAUACAACCUACUACCUC z A-Chol A z ACUAUACAAUCUACUACCUC z A-Chol A z CAACAAAAUCACUAGUCUUCC z A-Chol U z CAUACAGCUAGAUAACCAAAG z A-Chol C z UGUUCCUGCUGAACUGAGCC z A-Chol A z GCCUAUCCUGGAUUACUUGA z A-Chol G z CAGAACUUAGCCACUGUGA z A-Chol C z UUCCAGUCGAGGAUGUUUAC z A-Chol C z CAUCUUUACCAGACAGUGUU z A-Chol A z CAAAGUUCUGUAGUGCACUG z A-Chol C z GGUGUGAGUUCUACCAUUGCCAA z A-Chol U z CCAUCAUUACCCGGCAGUAUU z A-Chol U z CACGCGAGCCGAACGAACAA z A-Chol

5 A 3 control mutant Beta cell mass (mg) 2 1 B % of total events >50001 µm µm µm µm µm µm 2 0 control mutant C Caspase positive cells (%) control mutant Supp. figure 1

6 GFP PC1/3 Merge A B C mutant Control D E F Supp. figure 2

7 120 insulin+ cells GFP+ cells ** cells coexpressing the markers (%) Nkx6.1 Pax6 MafA Supp Figure 3

8 Intensity Intensity Supp. figure 4

Supplementary Figure 1.

Supplementary Figure 1. Supplementary Figure 1. (A) UCSC Genome Browser view of region immediately downstream of the NEUROG3 start codon. All candidate grna target sites which meet the G(N 19 )NGG constraint are aligned to illustrate

More information

In general, 8- to 10-week-old adult females were ovariectomized and rested for 10 days

In general, 8- to 10-week-old adult females were ovariectomized and rested for 10 days Animal injections and tissue processing In general, 8- to 10-week-old adult females were ovariectomized and rested for 10 days before they received any injections. Mice were injected with sesame seed oil

More information

IMMUNOPATHOLOGY. This SOP will be applied to npod paraffin samples stained by immunohistochemistry.

IMMUNOPATHOLOGY. This SOP will be applied to npod paraffin samples stained by immunohistochemistry. 1 PURPOSE IMMUNOPATHOLOGY The purpose of this Standard Operating Procedure (SOP) is to outline procedures for immunopathology preparation and analysis of npod samples. 2 SCOPE This SOP will be applied

More information

A population of Nestin expressing progenitors in the cerebellum exhibits increased tumorigenicity

A population of Nestin expressing progenitors in the cerebellum exhibits increased tumorigenicity A population of Nestin expressing progenitors in the cerebellum exhibits increased tumorigenicity Peng Li 1,2, Fang Du 1, Larra W. Yuelling 1, Tiffany Lin 3, Renata E. Muradimova 1, Rossella Tricarico

More information

Supplemental Figure 1 (Figure S1), related to Figure 1 Figure S1 provides evidence to demonstrate Nfatc1Cre is a mouse line that directed gene

Supplemental Figure 1 (Figure S1), related to Figure 1 Figure S1 provides evidence to demonstrate Nfatc1Cre is a mouse line that directed gene Developmental Cell, Volume 25 Supplemental Information Brg1 Governs a Positive Feedback Circuit in the Hair Follicle for Tissue Regeneration and Repair Yiqin Xiong, Wei Li, Ching Shang, Richard M. Chen,

More information

Positive selection gates for the collection of LRCs or nonlrcs had to be drawn based on the location and

Positive selection gates for the collection of LRCs or nonlrcs had to be drawn based on the location and Determining positive selection gates for LRCs and nonlrcs Positive selection gates for the collection of LRCs or nonlrcs had to be drawn based on the location and shape of the Gaussian distributions. For

More information

MeCP2. MeCP2/α-tubulin. GFP mir1-1 mir132

MeCP2. MeCP2/α-tubulin. GFP mir1-1 mir132 Conservation Figure S1. Schematic showing 3 UTR (top; thick black line), mir132 MRE (arrow) and nucleotide sequence conservation (vertical black lines; http://genome.ucsc.edu). a GFP mir1-1 mir132 b GFP

More information

Supplemental Table/Figure Legends

Supplemental Table/Figure Legends MiR-26a is required for skeletal muscle differentiation and regeneration in mice Bijan K. Dey, Jeffrey Gagan, Zhen Yan #, Anindya Dutta Supplemental Table/Figure Legends Suppl. Table 1: Effect of overexpression

More information

Design. Construction. Characterization

Design. Construction. Characterization Design Construction Characterization DNA mrna (messenger) A C C transcription translation C A C protein His A T G C T A C G Plasmids replicon copy number incompatibility selection marker origin of replication

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature12119 SUPPLEMENTARY FIGURES AND LEGENDS pre-let-7a- 1 +14U pre-let-7a- 1 Ddx3x Dhx30 Dis3l2 Elavl1 Ggt5 Hnrnph 2 Osbpl5 Puf60 Rnpc3 Rpl7 Sf3b3 Sf3b4 Tia1 Triobp U2af1 U2af2 1 6 2 4 3

More information

IGF-1 promotes the development and cytotoxic activity of human NK cells regulated

IGF-1 promotes the development and cytotoxic activity of human NK cells regulated Supplementary Information for IGF-1 promotes the development and cytotoxic activity of human NK cells regulated by mir-483-3p Fang Ni 1, 2, Rui Sun 1, Binqing Fu 1, Fuyan Wang 1, Chuang Guo 1, Zhigang

More information

Supplementary Data. Flvcr1a TCTAAGGCCCAGTAGGACCC GGCCTCAACTGCCTGGGAGC AGAGGGCAACCTCGGTGTCC

Supplementary Data. Flvcr1a TCTAAGGCCCAGTAGGACCC GGCCTCAACTGCCTGGGAGC AGAGGGCAACCTCGGTGTCC Supplementary Data Supplementary Materials and Methods Measurement of reactive oxygen species accumulation in fresh intestinal rings Accumulation of reactive oxygen species in fresh intestinal rings was

More information

Cell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan).

Cell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan). 1 2 3 4 5 6 7 8 Supplemental Materials and Methods Cell proliferation assay Cell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan). GCs were plated at 96-well

More information

Nature Biotechnology: doi: /nbt Supplementary Figure 1. Generation of NSCs from hpscs in SDC medium.

Nature Biotechnology: doi: /nbt Supplementary Figure 1. Generation of NSCs from hpscs in SDC medium. Supplementary Figure 1 Generation of NSCs from hpscs in SDC medium. (a) Q-PCR of pluripotent markers (OCT4, NANOG), neural markers (SOX1, PAX6, N-Cadherin), markers for the other germ layers (T, EOMES,

More information

TRIPLE (Insulin, Glucagon and EGFP) Immunofluorescence Staining Protocol in Pancreas Woogyun Choi 1, Randal J. Kaufman 2 and Sung Hoon Back 3*

TRIPLE (Insulin, Glucagon and EGFP) Immunofluorescence Staining Protocol in Pancreas Woogyun Choi 1, Randal J. Kaufman 2 and Sung Hoon Back 3* TRIPLE (Insulin, Glucagon and EGFP) Immunofluorescence Staining Protocol in Pancreas Woogyun Choi 1, Randal J. Kaufman 2 and Sung Hoon Back 3* 1 School of Biological Sciences, University of Ulsan, Ulsan,

More information

Supplemental Figures Supplemental Figure 1

Supplemental Figures Supplemental Figure 1 Supplemental Figures Supplemental Figure 1 The de novo and salvage purine synthesis pathways are shown converging on GMP synthesis (A). Enzymes and intermediates not involved in MPA action and/or guanosine

More information

Supplemental Figure S1. PGRN Binding to Sortilin.

Supplemental Figure S1. PGRN Binding to Sortilin. 1 Neuron, volume 68 Supplemental Data Sortilin-Mediated Endocytosis Determines Levels of the Frontotemporal Dementia Protein, Progranulin Fenghua Hu, Thihan Padukkavidana, Christian B. Vægter, Owen A.

More information

Supplementary Figure 1. Homozygous rag2 E450fs mutants are healthy and viable similar to wild-type and heterozygous siblings.

Supplementary Figure 1. Homozygous rag2 E450fs mutants are healthy and viable similar to wild-type and heterozygous siblings. Supplementary Figure 1 Homozygous rag2 E450fs mutants are healthy and viable similar to wild-type and heterozygous siblings. (left) Representative bright-field images of wild type (wt), heterozygous (het)

More information

Alteration of microrna expression correlates to fatty acidmediated. insulin resistance in mouse myoblasts

Alteration of microrna expression correlates to fatty acidmediated. insulin resistance in mouse myoblasts Alteration of microrna expression correlates to fatty acidmediated insulin resistance in mouse myoblasts Supplemental Data Correlation coefficient matrix con PA PA 0.9425 1.0000 PA+OA 0.9407 0.9626 con

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTY INFORMATION doi:10.1038/nature20785 Extended data Fig 1f Extended data Fig 1h 37 KD 37 KD Extended data Fig 1i Extended data Fig 4c Extended data Fig 3b Extended data Fig 4j 37 KD 37 KD Extended

More information

Supplementary Fig. S1. Schematic representation of mouse lines Pax6 fl/fl and mrx-cre used in this study. (A) To generate Pax6 fl/ fl

Supplementary Fig. S1. Schematic representation of mouse lines Pax6 fl/fl and mrx-cre used in this study. (A) To generate Pax6 fl/ fl Supplementary Fig. S1. Schematic representation of mouse lines Pax6 fl/fl and mrx-cre used in this study. (A) To generate Pax6 fl/ fl, loxp sites flanking exons 3-6 (red arrowheads) were introduced into

More information

Supplementary Figure 1. Nature Structural & Molecular Biology: doi: /nsmb.3494

Supplementary Figure 1. Nature Structural & Molecular Biology: doi: /nsmb.3494 Supplementary Figure 1 Pol structure-function analysis (a) Inactivating polymerase and helicase mutations do not alter the stability of Pol. Flag epitopes were introduced using CRISPR/Cas9 gene targeting

More information

Supplementary Figure S1. Alterations in Fzr1( / );Nestin-Cre brains. (a) P10 Cdh1-deficient brains display low levels of Myelin basic protein (MBP)

Supplementary Figure S1. Alterations in Fzr1( / );Nestin-Cre brains. (a) P10 Cdh1-deficient brains display low levels of Myelin basic protein (MBP) Supplementary Figure S1. Alterations in Fzr1( / );Nestin-Cre brains. (a) P10 Cdh1-deficient brains display low levels of Myelin basic protein (MBP) in the cortex (area 1 as defined in Fig. 2a), and corpus

More information

SGN-6106 Computational Systems Biology I

SGN-6106 Computational Systems Biology I SGN-6106 Computational Systems Biology I A View of Modern Measurement Systems in Cell Biology Kaisa-Leena Taattola 21.2.2007 1 The cell a complex system (Source: Lehninger Principles of Biochemistry 4th

More information

Blimp-1/PRDM1 rabbit monoclonal antibody (C14A4) was purchased from Cell Signaling

Blimp-1/PRDM1 rabbit monoclonal antibody (C14A4) was purchased from Cell Signaling 1 2 3 4 5 6 7 8 9 10 11 Supplementary Methods Antibodies Blimp-1/PRDM1 rabbit monoclonal antibody (C14A4) was purchased from Cell Signaling (Danvers, MA) and used at 1:1000 to detect the total PRDM1 protein

More information

Supplementary Figure S1

Supplementary Figure S1 Supplementary Figure S1 Figure S1. CENP- FP constructs target to centromeres irrespective of site of tagging. FP- CENP and CENP- FP constructs were transfected into U2OS cells and counterstained with anti-

More information

A Survey of Genetic Methods

A Survey of Genetic Methods IBS 8102 Cell, Molecular, and Developmental Biology A Survey of Genetic Methods January 24, 2008 DNA RNA Hybridization ** * radioactive probe reverse transcriptase polymerase chain reaction RT PCR DNA

More information

Supplementary Figure Legends

Supplementary Figure Legends Supplementary Figure Legends Figure S1 gene targeting strategy for disruption of chicken gene, related to Figure 1 (f)-(i). (a) The locus and the targeting constructs showing HpaI restriction sites. The

More information

SUPPLEMENTARY INFORMATION FILE

SUPPLEMENTARY INFORMATION FILE SUPPLEMENTARY INFORMATION FILE Existence of a microrna pathway in anucleate platelets Patricia Landry, Isabelle Plante, Dominique L. Ouellet, Marjorie P. Perron, Guy Rousseau & Patrick Provost 1. SUPPLEMENTARY

More information

Microarrays and Stem Cells

Microarrays and Stem Cells Microarray Background Information Microarrays and Stem Cells Stem cells are the building blocks that allow the body to produce new cells and repair tissues. Scientists are actively investigating the potential

More information

Supplementary Information Alternative splicing of CD44 mrna by ESRP1 enhances lung colonization of metastatic cancer cell

Supplementary Information Alternative splicing of CD44 mrna by ESRP1 enhances lung colonization of metastatic cancer cell Supplementary Information Alternative splicing of CD44 mrna by ESRP1 enhances lung colonization of metastatic cancer cell Supplementary Figures S1-S3 Supplementary Methods Supplementary Figure S1. Identification

More information

Methods Western blot analysis of plg Quantification of plasminogen accumulation by ELISA Immunohistochemical analysis

Methods Western blot analysis of plg Quantification of plasminogen accumulation by ELISA Immunohistochemical analysis Methods Western blot analysis of plg Wild-type mice first received a standardized burn wound and then were intravenously administered 2 mg of human plg (Omnio AB, Umeå, Sweden). 24 hours after wounding

More information

Table S1. Components for knockout serum replacer medium (KSR medium) (500 ml) Component Supplier Catalogue number

Table S1. Components for knockout serum replacer medium (KSR medium) (500 ml) Component Supplier Catalogue number Table S1. Components for knockout serum replacer medium (KSR medium) (500 ml) Component Supplier Catalogue number Stock Concentration Final concentration Volume used Advanced DMEM/F12 Invitrogen 12634010-78%

More information

Supplemental material

Supplemental material Supplemental material THE JOURNAL OF CELL BIOLOGY Taylor et al., http://www.jcb.org/cgi/content/full/jcb.201403021/dc1 Figure S1. Representative images of Cav 1a -YFP mutants with and without LMB treatment.

More information

Supplementary Figure 1 An overview of pirna biogenesis during fetal mouse reprogramming. (a) (b)

Supplementary Figure 1 An overview of pirna biogenesis during fetal mouse reprogramming. (a) (b) Supplementary Figure 1 An overview of pirna biogenesis during fetal mouse reprogramming. (a) A schematic overview of the production and amplification of a single pirna from a transposon transcript. The

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Moutin et al., http://www.jcb.org/cgi/content/full/jcb.201110101/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Tagged Homer1a and Homer are functional and display different

More information

RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,

RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe, Materials and methods Oligonucleotides and DNA constructs RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by Dharmacon Inc. (Lafayette, CO). The sequences were: 122-2 OMe, 5

More information

Spironolactone ameliorates PIT1-dependent vascular osteoinduction in klotho-hypomorphic mice

Spironolactone ameliorates PIT1-dependent vascular osteoinduction in klotho-hypomorphic mice Spironolactone ameliorates PIT1-dependent vascular osteoinduction in klotho-hypomorphic mice Supplementary Material Supplementary Methods Materials Spironolactone, aldosterone and β-glycerophosphate were

More information

Methods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology -

Methods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology - Methods of Biomaterials Testing Lesson 3-5 Biochemical Methods - Molecular Biology - Chromosomes in the Cell Nucleus DNA in the Chromosome Deoxyribonucleic Acid (DNA) DNA has double-helix structure The

More information

Introduction to Microarray Analysis

Introduction to Microarray Analysis Introduction to Microarray Analysis Methods Course: Gene Expression Data Analysis -Day One Rainer Spang Microarrays Highly parallel measurement devices for gene expression levels 1. How does the microarray

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Fig. S1. Specificity of perilipin antibody in SAT compared to various organs. (A) Images of SAT at E18.5 stained with perilipin and CD31 antibody. Scale bars: 100 μm. SAT stained

More information

Supplementary Table 1. Primers used to construct full-length or various truncated mutants of ISG12b2.

Supplementary Table 1. Primers used to construct full-length or various truncated mutants of ISG12b2. Supplementary Table 1. Primers used to construct full-length or various truncated mutants of ISG12b2. Construct name ISG12b2 (No tag) HA-ISG12b2 (N-HA) ISG12b2-HA (C-HA; FL-HA) 94-283-HA (FL-GFP) 93-GFP

More information

Suplementary Materials Epub: No 2016_1339 Vol. 63, Regular paper

Suplementary Materials Epub: No 2016_1339 Vol. 63, Regular paper Suplementary Materials Epub: No 2016_1339 Vol. 63, 2016 https://doi.org/10.18388/abp.2016_1339 Regular paper How short RNAs impact the human ribonuclease Dicer activity: putative regulatory feedback-loops

More information

Proteasome activity is required for the initiation of precancerous pancreatic

Proteasome activity is required for the initiation of precancerous pancreatic Proteasome activity is required for the initiation of precancerous pancreatic lesions Takaki Furuyama 1,2, Shinji Tanaka 1,2*, Shu Shimada 1, Yoshimitsu Akiyama 1, Satoshi Matsumura 2, Yusuke Mitsunori

More information

NCode mirna profiling. Sensitive, reproducible mirna profiling

NCode mirna profiling. Sensitive, reproducible mirna profiling Sensitive, reproducible mirna profiling Complete solutions for profiling mirna expression patterns Complete, optimized platform for mirna profiling Quick and efficient mirna expression analysis Superior

More information

2054, Chap. 14, page 1

2054, Chap. 14, page 1 2054, Chap. 14, page 1 I. Recombinant DNA technology (Chapter 14) A. recombinant DNA technology = collection of methods used to perform genetic engineering 1. genetic engineering = deliberate modification

More information

Basics of Recombinant DNA Technology Biochemistry 302. March 5, 2004 Bob Kelm

Basics of Recombinant DNA Technology Biochemistry 302. March 5, 2004 Bob Kelm Basics of Recombinant DNA Technology Biochemistry 302 March 5, 2004 Bob Kelm Applications of recombinant DNA technology Mapping and identifying genes (DNA cloning) Propagating genes (DNA subcloning) Modifying

More information

DNA Microarray Technology

DNA Microarray Technology 2 DNA Microarray Technology 2.1 Overview DNA microarrays are assays for quantifying the types and amounts of mrna transcripts present in a collection of cells. The number of mrna molecules derived from

More information

Technical Review. Real time PCR

Technical Review. Real time PCR Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously

More information

Isolation, culture, and transfection of primary mammary epithelial organoids

Isolation, culture, and transfection of primary mammary epithelial organoids Supplementary Experimental Procedures Isolation, culture, and transfection of primary mammary epithelial organoids Primary mammary epithelial organoids were prepared from 8-week-old CD1 mice (Charles River)

More information

Supplemental Materials and Methods

Supplemental Materials and Methods Supplemental Materials and Methods In situ hybridization In situ hybridization analysis of HFE2 and genin mrna in rat liver tissues was performed as previously described (1). Briefly, the digoxigenin-labeled

More information

hnrnp D/AUF1 Rabbit IgG hnrnp M

hnrnp D/AUF1 Rabbit IgG hnrnp M Mouse IgG Goat IgG Rabbit IgG Mouse IgG hnrnp F Goat IgG Mouse IgG Kb 6 4 3 2 15 5 Supplementary Figure S1. In vivo binding of TERRA-bound RBPs to target RNAs. Immunoprecipitation (IP) assay using 3 mg

More information

Viral RNAi suppressor reversibly binds sirna to. outcompete Dicer and RISC via multiple-turnover

Viral RNAi suppressor reversibly binds sirna to. outcompete Dicer and RISC via multiple-turnover Supplementary Data Viral RNAi suppressor reversibly binds sirna to outcompete Dicer and RISC via multiple-turnover Renata A. Rawlings 1,2, Vishalakshi Krishnan 2 and Nils G. Walter 2 * 1 Biophysics and

More information

Supplementary Materials and Methods:

Supplementary Materials and Methods: Supplementary Materials and Methods: Preclinical chemoprevention experimental design Mice were weighed and each mammary tumor was manually palpated and measured with digital calipers once a week from 4

More information

Test Bank for Molecular Cell Biology 7th Edition by Lodish

Test Bank for Molecular Cell Biology 7th Edition by Lodish Test Bank for Molecular Cell Biology 7th Edition by Lodish Link download full: http://testbankair.com/download/test-bank-formolecular-cell-biology-7th-edition-by-lodish/ Chapter 5 Molecular Genetic Techniques

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature10928 Materials and Methods 1. Plant material and growth conditions. All plant lines used were in Col-0 background unless otherwise specified. pif4-101 mutant

More information

SUPPLEMENTAL MATERIAL. Supplemental material contains Supplemental Figure Legends and Supplemental Figures 1 to

SUPPLEMENTAL MATERIAL. Supplemental material contains Supplemental Figure Legends and Supplemental Figures 1 to SUPPLEMENTAL MATERIAL Supplemental material contains Supplemental Figure Legends and Supplemental Figures 1 to 6. SUPPLEMENTAL FIGURE LEGENDS Supplemental Figure 1. Overview of the mechanisms by which

More information

Selected Techniques Part I

Selected Techniques Part I 1 Selected Techniques Part I Gel Electrophoresis Can be both qualitative and quantitative Qualitative About what size is the fragment? How many fragments are present? Is there in insert or not? Quantitative

More information

CELL BIOLOGY - CLUTCH CH TECHNIQUES IN CELL BIOLOGY.

CELL BIOLOGY - CLUTCH CH TECHNIQUES IN CELL BIOLOGY. !! www.clutchprep.com CONCEPT: LIGHT MICROSCOPE A light microscope uses light waves and magnification to view specimens Can be used to visualize transparent, and some cellular components - Can visualize

More information

Supplementary Methods

Supplementary Methods Supplementary Methods Reverse transcribed Quantitative PCR. Total RNA was isolated from bone marrow derived macrophages using RNeasy Mini Kit (Qiagen), DNase-treated (Promega RQ1), and reverse transcribed

More information

Molecular Cell Biology - Problem Drill 11: Recombinant DNA

Molecular Cell Biology - Problem Drill 11: Recombinant DNA Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna

More information

Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit

Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit Application Note 13 RNA Sample Preparation Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit B. Lam, PhD 1, P. Roberts, MSc 1 Y. Haj-Ahmad, M.Sc., Ph.D 1,2 1 Norgen

More information

Applicazioni biotecnologiche

Applicazioni biotecnologiche Applicazioni biotecnologiche Analisi forense Sintesi di proteine ricombinanti Restriction Fragment Length Polymorphism (RFLP) Polymorphism (more fully genetic polymorphism) refers to the simultaneous occurrence

More information

Schematic representation of the endogenous PALB2 locus and gene-disruption constructs

Schematic representation of the endogenous PALB2 locus and gene-disruption constructs Supplementary Figures Supplementary Figure 1. Generation of PALB2 -/- and BRCA2 -/- /PALB2 -/- DT40 cells. (A) Schematic representation of the endogenous PALB2 locus and gene-disruption constructs carrying

More information

Supplementary Fig. 1.

Supplementary Fig. 1. Supplementary Fig. 1. RNAi-induced reduction in E(z) or Esc or mutations in Polycomb Group genes or corto partially rescues oogenesis of piwi mutants. (a) In vitro reconstituted PRC2 complexes (represented

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION DOI: 1.138/NMAT3777 Biophysical regulation of epigenetic state and cell reprogramming Authors: Timothy L. Downing 1,2, Jennifer Soto 1,2, Constant Morez 2,3,, Timothee Houssin

More information

Sarker et al. Supplementary Material. Subcellular Fractionation

Sarker et al. Supplementary Material. Subcellular Fractionation Supplementary Material Subcellular Fractionation Transfected 293T cells were harvested with phosphate buffered saline (PBS) and centrifuged at 2000 rpm (500g) for 3 min. The pellet was washed, re-centrifuged

More information

Figure S1. Specificity of immunofluorescence staining in STC-1 cells. STC-1 cells

Figure S1. Specificity of immunofluorescence staining in STC-1 cells. STC-1 cells Supplementary Figures and Tables Figure S1. Figure S1. Specificity of immunofluorescence staining in STC-1 cells. STC-1 cells were treated with donkey-anti rabbit antibody conjugated with Dylight488 or

More information

Supplementary Information

Supplementary Information Supplementary Information Supplementary Figure 1: Identification of new regulators of MuSC by a proteome-based shrna screen. (a) FACS plots of GFP + and GFP - cells from Pax7 ICN -Z/EG (upper panel) and

More information

Green Fluorescent Protein (GFP) Purification. Hydrophobic Interaction Chromatography

Green Fluorescent Protein (GFP) Purification. Hydrophobic Interaction Chromatography Green Fluorescent Protein (GFP) Purification Hydrophobic Interaction Chromatography What is the GFP gene? GFP is a green fluorescent protein that is normally found in jellyfish. It has been engineered

More information

Nodal expression was directly inhibited using antisense Morpholino oligonucleotides

Nodal expression was directly inhibited using antisense Morpholino oligonucleotides Supplementary Note Rationale for Morpholino based inhibition of Nodal expression Nodal expression was directly inhibited using antisense Morpholino oligonucleotides (MO Nodal ) fluorescently labeled with

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. Effect of timing of DE dissociation and RA concentration on lung field specification in hpscs. (a) Effect of duration of endoderm induction on expression of

More information

Guide for ordering of mircury LNA probes and LNA oligonucleotides

Guide for ordering of mircury LNA probes and LNA oligonucleotides 1 Guide for ordering of mircury LNA probes and LNA oligonucleotides microrna mrna Other Detection, p.2-3 in situ hybridization, p.6-7 Other application, p.8-9 Kckdown (in vitro), p.4-5 Other mrna application,

More information

Figure S1 is related to Figure 1B, showing more details of outer segment of

Figure S1 is related to Figure 1B, showing more details of outer segment of Supplemental Information Supplementary Figure legends and Figures Figure S1. Electron microscopic images in Sema4A +/+ and Sema4A / retinas Figure S1 is related to Figure 1B, showing more details of outer

More information

MicroRNA Destabilization Enables. Dynamic Regulation of the mir-16 Family. In Response to Cell-Cycle Changes SUPPLEMENTAL INFORMATION

MicroRNA Destabilization Enables. Dynamic Regulation of the mir-16 Family. In Response to Cell-Cycle Changes SUPPLEMENTAL INFORMATION Molecular Cell, Volume 43 SUPPLEMENTAL INFORMATION MicroRNA Destabilization Enables Dynamic Regulation of the mir-16 Family In Response to Cell-Cycle Changes Olivia S. Risland, Sue-Jean Hong, and David

More information

Nature Medicine doi: /nm.2548

Nature Medicine doi: /nm.2548 Supplementary Table 1: Genotypes of offspring and embryos from matings of Pmm2 WT/F118L mice with Pmm2 WT/R137H mice total events Pmm2 WT/WT Pmm2 WT/R137H Pmm2 WT/F118L Pmm2 R137H/F118L offspring 117 (100%)

More information

Computing with large data sets

Computing with large data sets Computing with large data sets Richard Bonneau, spring 2009 Lecture 14 (week 8): genomics 1 Central dogma Gene expression DNA RNA Protein v22.0480: computing with data, Richard Bonneau Lecture 14 places

More information

Supplementary Table S1

Supplementary Table S1 Primers used in RT-qPCR, ChIP and Bisulphite-Sequencing. Quantitative real-time RT-PCR primers Supplementary Table S1 gene Forward primer sequence Reverse primer sequence Product TRAIL CAACTCCGTCAGCTCGTTAGAAAG

More information

Supporting Information

Supporting Information Supporting Information Nowakowski et al. 10.1073/pnas.1219385110 SI Materials and Methods Primary Antibodies. Primary antibodies used in this study were raised against BrdU (rat, 1:50; Abcam), cleaved

More information

Supplemental Table S1. RT-PCR primers used in this study

Supplemental Table S1. RT-PCR primers used in this study Supplemental Table S1. RT-PCR primers used in this study -----------------------------------------------------------------------------------------------------------------------------------------------

More information

Supporting Online Material for

Supporting Online Material for www.sciencemag.org/cgi/content/full/1154040/dc1 Supporting Online Material for Selective Blockade of MicroRNA Processing by Lin-28 Srinivas R. Viswanathan, George Q. Daley,* Richard I. Gregory* *To whom

More information

Supplemental Figure legends Figure S1. (A) (B) (C) (D) Figure S2. Figure S3. (A-E) Figure S4. Figure S5. (A, C, E, G, I) (B, D, F, H, Figure S6.

Supplemental Figure legends Figure S1. (A) (B) (C) (D) Figure S2. Figure S3. (A-E) Figure S4. Figure S5. (A, C, E, G, I) (B, D, F, H, Figure S6. Supplemental Figure legends Figure S1. Map-based cloning and complementation testing for ZOP1. (A) ZOP1 was mapped to a ~273-kb interval on Chromosome 1. In the interval, a single-nucleotide G to A substitution

More information

Gene Forward Primer Reverse Primer GAPDH ATCATCCCTGCCTCTACTGG GTCAGGTCCACCACTGACAC SSB1 AACTTCAGTGAGCCAAACCC GTTCTCAGAGGCTGGAGAGG

Gene Forward Primer Reverse Primer GAPDH ATCATCCCTGCCTCTACTGG GTCAGGTCCACCACTGACAC SSB1 AACTTCAGTGAGCCAAACCC GTTCTCAGAGGCTGGAGAGG Supplemental Data EXPERIMENTAL PROCEDURES Plasmids and Antibodies- Full length cdna of INT11 or INT12 were cloned into ps- Flag-SBP vector respectively. Anti-RNA pol II (RPB1) was purchased from Santa

More information

Electrophoretic Mobility Shift Assay (EMSA). Nuclear extracts were. oligonucleotide spanning the NF-kB site (5 -GATCC-

Electrophoretic Mobility Shift Assay (EMSA). Nuclear extracts were. oligonucleotide spanning the NF-kB site (5 -GATCC- SUPPLEMENTARY MATERIALS AND METHODS Electrophoretic Mobility Shift Assay (EMSA). Nuclear extracts were prepared as previously described. (1) A [ 32 P] datp-labeled doublestranded oligonucleotide spanning

More information

Galina Gabriely, Ph.D. BWH/HMS

Galina Gabriely, Ph.D. BWH/HMS Galina Gabriely, Ph.D. BWH/HMS Email: ggabriely@rics.bwh.harvard.edu Outline: microrna overview microrna expression analysis microrna functional analysis microrna (mirna) Characteristics mirnas discovered

More information

Expressed genes profiling (Microarrays) Overview Of Gene Expression Control Profiling Of Expressed Genes

Expressed genes profiling (Microarrays) Overview Of Gene Expression Control Profiling Of Expressed Genes Expressed genes profiling (Microarrays) Overview Of Gene Expression Control Profiling Of Expressed Genes Genes can be regulated at many levels Usually, gene regulation, are referring to transcriptional

More information

Deep sequencing reveals global patterns of mrna recruitment

Deep sequencing reveals global patterns of mrna recruitment Supplementary information for: Deep sequencing reveals global patterns of mrna recruitment during translation initiation Rong Gao 1#*, Kai Yu 1#, Ju-Kui Nie 1,Teng-Fei Lian 1, Jian-Shi Jin 1, Anders Liljas

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Supplementary Figure 1. Functional assays of hepatocyte-like cells induced from H1 hescs (a) P450 and AAT staining, PAS staining, LDL uptake assay, and ICG uptake and release assay

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/10/496/eaam6291/dc1 Supplementary Materials for Regulation of autophagy, NF-κB signaling, and cell viability by mir-124 in KRAS mutant mesenchymal-like NSCLC cells

More information

11/22/13. Proteomics, functional genomics, and systems biology. Biosciences 741: Genomics Fall, 2013 Week 11

11/22/13. Proteomics, functional genomics, and systems biology. Biosciences 741: Genomics Fall, 2013 Week 11 Proteomics, functional genomics, and systems biology Biosciences 741: Genomics Fall, 2013 Week 11 1 Figure 6.1 The future of genomics Functional Genomics The field of functional genomics represents the

More information

Supplementary Fig. 1. Isolation and in vitro expansion of EpCAM + cholangiocytes. For collagenase perfusion, enzyme solution was injected from the

Supplementary Fig. 1. Isolation and in vitro expansion of EpCAM + cholangiocytes. For collagenase perfusion, enzyme solution was injected from the Supplementary Fig. 1. Isolation and in vitro expansion of EpCAM + cholangiocytes. For collagenase perfusion, enzyme solution was injected from the portal vein for digesting adult livers, whereas it was

More information

Mirror-image polymerase chain reaction

Mirror-image polymerase chain reaction Supplementary Information Mirror-image polymerase chain reaction Wenjun Jiang 1,4, Baochang Zhang 2,4, Chuyao Fan 1,4, Min Wang 1,4, Jiaxing Wang 2, Qiang Deng 1, Xianyu Liu 1, Ji Chen 1, Jishen Zheng

More information

HPV E6 oncoprotein targets histone methyltransferases for modulating specific. Chih-Hung Hsu, Kai-Lin Peng, Hua-Ci Jhang, Chia-Hui Lin, Shwu-Yuan Wu,

HPV E6 oncoprotein targets histone methyltransferases for modulating specific. Chih-Hung Hsu, Kai-Lin Peng, Hua-Ci Jhang, Chia-Hui Lin, Shwu-Yuan Wu, 1 HPV E oncoprotein targets histone methyltransferases for modulating specific gene transcription 3 5 Chih-Hung Hsu, Kai-Lin Peng, Hua-Ci Jhang, Chia-Hui Lin, Shwu-Yuan Wu, Cheng-Ming Chiang, Sheng-Chung

More information

Supplementary Information

Supplementary Information Supplementary Information Supplementary Figures Supplementary Figure 1. qrt-pcr analysis of the expression of candidate factors including SOX2, MITF, PAX3, DLX5, FOXD3, LEF1, MSX1, PAX6, SOX2 and SOX9

More information

Allele-specific locus binding and genome editing by CRISPR at the

Allele-specific locus binding and genome editing by CRISPR at the Supplementary Information Allele-specific locus binding and genome editing by CRISPR at the p6ink4a locus Toshitsugu Fujita, Miyuki Yuno, and Hodaka Fujii Supplementary Figure Legends Supplementary Figure

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. Diffusion of MCF-7 and 3T3 cells. (a) High-resolution image (40x): DAPI and Cy5-CellTracker TM stained MCF-7 cells. (b) Corresponding high-resolution (40x)

More information

Xiaoqing Zhang, Guo Zhang, Hai Zhang, Michael Karin, Hua Bai, and Dongsheng Cai

Xiaoqing Zhang, Guo Zhang, Hai Zhang, Michael Karin, Hua Bai, and Dongsheng Cai Cell, Volume 135 Supplemental Data Hypothalamic IKKβ/NF-κB and ER Stress Link Overnutrition to Energy Imbalance and Obesity Xiaoqing Zhang, Guo Zhang, Hai Zhang, Michael Karin, Hua Bai, and Dongsheng Cai

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION a before amputation regeneration regenerated limb DERMIS SKELETON MUSCLE SCHWANN CELLS EPIDERMIS DERMIS SKELETON MUSCLE SCHWANN CELLS EPIDERMIS developmental origin: lateral plate mesoderm presomitic mesoderm

More information

3.1.4 DNA Microarray Technology

3.1.4 DNA Microarray Technology 3.1.4 DNA Microarray Technology Scientists have discovered that one of the differences between healthy and cancer is which genes are turned on in each. Scientists can compare the gene expression patterns

More information

Utility of Branched DNA Hybridization Methodology for the Quantitation of Oligonucleotides

Utility of Branched DNA Hybridization Methodology for the Quantitation of Oligonucleotides Utility of Branched DNA Hybridization Methodology for the Quantitation of Oligonucleotides Laboratory Sciences, MPI Research, A Charles River Company Amy Smith, BA, Senior Director, Bioanalytical/Analytical

More information