Mark J. Kiel, Melih Acar, Glenn L. Radice, and Sean J. Morrison

Size: px
Start display at page:

Download "Mark J. Kiel, Melih Acar, Glenn L. Radice, and Sean J. Morrison"

Transcription

1 Cell Stem Cell, Volume 4 Supplemental Data Hematopoietic Stem Cells Do Not Depend on N-Cadherin to Regulate Their Maintenance Mark J. Kiel, Melih Acar, Glenn L. Radice, and Sean J. Morrison SUPPLEMENTAL EXPERIMENTAL PROCEDURES Supplemental N-cadherin excision analysis Alternate primer sequences for amplification of N-cadherin alleles were: N-cadherin NC1f 5 -ACC AGC TCG CTC TCA TTG G; N-cadherin NC1r 5 -GCT ATC CGG CAC ATG GAG; N-cadherin NC16f 5 -CCC TCA ACT CCT CCA GTA GC and N-cadherin NC16f 5 - AGC TGA GCT CGG TGT TTT CC. PCR primers NC1f and NC1r were designed to amplify a product containing the ATG start site of exon 1. PCR primers NC16f and NC16r were designed to amplify exon 16 of N-cadherin. Products were separated using 2% agarose gels to confirm the presence or absence of these amplicons. Products were sequenced and confirmed to correspond to N-cadherin. 5-fluorouracil administration A single intraperitoneal dose of 5-fluorouracil (Adrucil, Pharmacia and Upjohn Co., Kalamazoo, MI; 150mg/kg) was administered to Mx-1-Cre + N-cadherin fl/- and littermate control mice one day following 2 weeks of pipc injections. Isolation of HSCs using collagenase treatment and calcium-containing medium Bone marrow cells were flushed from the long bones (tibias and femurs) with Hank s buffered salt solution containing calcium and magnesium, supplemented with 2% heatinactivated calf serum (GIBCO). Flushed bones were crushed with scissors and incubated for 90 minutes in 0.125% collagenase II (GIBCO) at 37 o C. Bones were thoroughly triturated and filtered through nylon screen (45 um, Sefar America, Kansas City, MO) to obtain a single cell suspension before being washed and centrifuged. Staining for MNCD2 on HSCs was performed as described (see Methods section) with the exception that calcium and magnesium containing medium was used. Western blot analysis Cells were lysed in RIPA lysis buffer containing protease inhibitors (Roche), loaded onto NuPAGE 7% Tris-acetate gels (Invitrogen, Carlsbad CA) and electrotransferred onto Immobilon Transfer PVDF membranes (Millipore, Temecula CA) for 2-3 hours. Membranes were blocked in 5% non-fat milk protein in TBS (20mM Tris ph8.0, 150mM NaCl) buffer with 0.05% Tween- 20 (TBS-T) for 1 hour at room temperature. Membranes were incubated in primary anti-ncadherin MNCD2 antibody overnight at 4 o C at a dilution of 1:2,500. The membrane was washed 5 times for 1 hour in TBS-T and incubated in peroxidase-conjugated goat anti-rat IgG (catalogue 1

2 number: ; Jackson Immunoresearch, West Grove PA) at a dilution of 1:10,000 for 2 hours at room temperature. The membrane was then washed 5 times for 1 hour in TBS-T and 2 times for 30 minutes in TBS. Bands were visualized using SuperSignal West Femto Maximum Sensitivity Substrate (Pierce, Rockford IL). For the ß-actin loading control blot, anti-β-actin primary antibody (clone C4, Santa Cruz, Santa Cruz CA) was used at a dilution of 1:1,000 at 4 o C overnight. A fraction of the cell extracts used for the MNCD2 N-cadherin blot were loaded for the ß-actin blot. Postnatal day 0 (P0) forebrain cells were isolated, counted and serially diluted into RIPA buffer as a positive control for N-cadherin expression. Sorted CD45+ and surface IgM+ bone marrow cells from Mx-1-Cre + N-cadherin fl/- mice or littermate controls were diluted in RIPA buffer. Lineage - Sca-1 + c-kit + (LSK) cells from Mx-1-Cre + N-cadherin fl/- mice or littermate controls were sorted by flow-cytometry into HBSS +. Cells were then centrifuged at 500g for 5 minutes, the supernatant was aspirated and the pellet resuspended in <30ul of RIPA lysis buffer. Figure S1: Excision of N-cadherin from HSCs was confirmed by PCR using independent sets of primers. CD150 + CD48 - CD41 - lineage - Sca-1 + c-kit + bone marrow HSCs from pipctreated Mx-1-Cre + N-cadherin fl/- mice or littermate controls were cultured in methylcellulose for 14 days. Genomic DNA was then extracted from individual colonies and examined for N- cadherin deletion using primers that amplify ~200 bp of N-cadherin exon 1 and 5 -UTR (A) or ~300 bp of N-cadherin exon 16 (B). None of the DNA from colonies of pipc-treated Mx-1- Cre + N-cadherin fl/- mice retained exon 1, the region of N-cadherin deleted by Cre-mediated recombination (Kostetskii et al., 2005). In contrast, exon 1 was readily amplified from DNA from control littermate colonies (A). As expected, N-cadherin exon 16 was readily amplified from all colonies as this sequence is unaffected by Cre-mediated recombination (B). Sequencing of each band confirmed the specific amplification of N-cadherin. 2

3 Figure S2: Recovery of hematopoiesis following 5-fluorouracil-induced myelosuppression was not affected by N-cadherin deficiency. Peripheral blood, bone marrow, and spleen were examined in Mx-1-Cre + N-cadherin fl/- mice (black bars) or littermate controls (white bars) 10 days after a single dose of 5-fluorouracil (5-FU) that was administered following 2 weeks of pipc treatment. No statistically significant differences were observed in the concentration of white blood cells (WBC), erythrocytes (RBC) or platelets (Plts) from the blood of Mx-1-Cre + N- cadherin fl/- mice as compared to littermate controls (A). We also did not observe any differences in the composition or cellularity of bone marrow (B) or spleen (C) between Mx-1-Cre + N- cadherin fl/- mice and littermate controls. Although HSC surface markers transiently change their expression levels in the days immediately following 5-FU treatment (Randall and Weissman, 1998; Venezia et al., 2004) and it is uncertain whether these markers return to normal 10 days after 5-FU treatment, we assessed the content of CD150 + CD48 - CD41 - lineage - Sca-1 + c-kit + cells by flow-cytometry (D). We observed no difference in the frequency (E, G) or absolute number (F, H) of CD150 + CD48 - CD41 - lineage - Sca-1 + c-kit + cells in the bone marrow (E, F) or spleen (G, H) of Mx-1-Cre + N-cadherin fl/- mice or littermate controls. Data are from 2 to 5 mice per genotype. All error bars represent SD. N-cadherin deletion was confirmed by PCR of Mac-1 + myeloid cells from Mx-1-Cre + N-cadherin fl/- mice (I). 3

4 Figure S3: MNCD2 antibody did not detectably stain HSCs and the staining that was observed in whole bone marrow was unaffected by N-cadherin deletion. MNCD2 staining was compared to streptavidin-only negative control (first column) in whole bone marrow cells (A), CD150 + CD48 - CD41 - lineage - Sca-1 + c-kit + HSCs (B), and Flk2 - lineage - Sca-1 + c-kit + HSCs (C). Staining above background was only observed in whole bone marrow (A). In all cases, staining was unaffected by N-cadherin deficiency (third column shows Mx-1-Cre + N-cadherin fl/- mice after pipc treatment). N-cadherin deficiency was confirmed by PCR in pipc-treated Mx-1- Cre + N-cadherin fl/- mice (D). 4

5 Figure S4: MNCD2 antibody did not stain HSCs isolated from 2 month old, 1 year old or 2 year old mice. MNCD2 staining (red lines) was compared to streptavidin-only negative control (black lines) in CD150 + CD48 - CD41 - lineage - Sca-1 + c-kit + HSCs (A) and Flk2 - lineage - Sca-1 + c-kit + HSCs (B). An independent experiment, in which 2000 HSCs from 2 year old mice were analyzed with an independent aliquot of MNCD2 antibody yielded similar results (C). No staining above background was observed in either population at any age. Data are representative of 4 independent experiments. 5

6 Figure S5: MNCD2 antibody did not stain HSCs isolated by collagenase-treatment of bone and subsequently stained in calcium-containing medium. MNCD2 staining (red lines) in calcium-containing medium was compared to streptavidin-only negative control (black lines) in CD150 + CD48 - CD41 - lineage - Sca-1 + c-kit + HSCs (A and C) and Flk2 - lineage - Sca-1 + c-kit + HSCs (B) following collagenase-treatment of bones. The experiment in (C) was performed with a different aliquot of MNCD2 antibody as compared to that used in panels A or B. Similar results were obtained using medium without calcium and using traditional bone marrow flushing techniques. Either way, no staining above background was observed in either population. Results are from two independent experiments. 6

7 Figure S6: MNCD2 antibody strongly stained surface IgM + B-cells but that staining was unaffected by N-cadherin deletion. B220 hi surfaceigm + B-cells (A) were strongly stained by biotinylated MNCD2 antibody plus streptavidin-pharred (MNCD2, B, red lines) as compared to streptavidin-pharred control (2 only, B, black lines). B220 hi surfaceigm + B-cells from pipc treated Mx-1-Cre + N-cadherin fl/- mice showed a similar level of staining by MNCD2 antibody (B, right plot) as compared to cells isolated from littermate control mice (B, left plot). PCR analysis of genomic DNA from MNCD2 + bone marrow cells isolated from Mx-1-Cre + N-cadherin fl/- mice 5 months following initial pipc treatment showed complete excision of N-cadherin confirming N-cadherin deficiency in these cells (C). These results demonstrate that when used for flowcytometry, MNCD2 binds to something other than N-cadherin in the bone marrow. Results are from two independent experiments. 7

8 Figure S7: Western blot using MNCD2 antibody revealed N-cadherin expression in as few as 2,000 neonatal forebrain cells but no N-cadherin expression in 500,000 CD45 + bone marrow cells or in 10,000 Lineage - c-kit + Sca-1 + (LSK) cells. The only technique by which MNCD2 has been shown to specifically bind N-cadherin is Western blot (Radice et al., 1997). To independently test whether the MNCD2 staining observed on bone marrow cells by flowcytometry reflects N-cadherin expression, we performed a Western blot using MNCD2 antibody. A) N-cadherin was readily detected in as few as 2,000 neonatal forebrain cell equivalents (lane 1: 2x10 5 cell equivalents; lane 2: 2x10 4 cell equivalents; lane 3: 2x10 3 cell equivalents). In contrast, whether we used 5x10 5 CD45 + cells (lane 4), 10 5 sigm + B cells (lane 5), or 10 4 LSK cells (lane 6) from wild-type bone marrow or pipc-treated Mx-1-Cre + N-cadherin fl/- mice, this band could not be detected. ß-actin staining was performed as a loading control and could be detected in all samples except 2,000 neonatal forebrain cells (B; see long exposure to detect the ß-actin band in LSK cells). 8

9 Figure S8: N-cadherin expression cannot be detected within Lineage - c-kit + Sca-1 + (LSK) cells by Western blot. In case N-cadherin was expressed at very low levels within LSK cells, we examined the expression of N-cadherin by Western blot using up to 100,000 LSK cells. A) Although N-cadherin expression was readily detected in 30,000 P0 forebrain cells using MNCD2 antibody (lanes 1-3), no N-cadherin expression was detected in either 125,000 whole bone marrow (WBM) cells or in 30,000 to 100,000 LSK cells from control (wt; Mx-1-Cre - N- cadherin fl/- ) or Mx-1-Cre + N-cadherin fl/- cells (ko; lanes 4-8). Aliquots of the same samples were analyzed in a second Western blot for ß-actin levels, as a loading control. B) N-cadherin deletion was confirmed by PCR using genomic DNA from the WBM and LSK cells used in (A). The upper band represents the unrecombined floxed allele while the lower band represents the deleted allele. 9

10 Figure S9: Bone marrow cells that stain MNCD2 + by flow-cytometry do not express N- cadherin when analyzed by Western blot. To determine whether MNCD2 + bone marrow cells identified by flow-cytometry express N-cadherin protein, cells from wild-type C57BL mice that stained with MNCD2 antibody were sorted by flow-cytometry and analyzed for N-cadherin expression by Western blot using MNCD2 antibody. A) N-cadherin expression was readily detected in P0 forebrain cells but was not detected in whole bone marrow (WBM) cells or in cells that stained MNCD2 + by flow-cytometry. Both RIPA buffer soluble and insoluble protein fractions were analyzed. Aliquots of the same samples were analyzed in a second Western blot for ß-actin levels, as a loading control. These data indicate that MNCD2 antibody staining by flow-cytometry does not reflect N-cadherin expression. 10

11 SUPPLEMENTAL REFERENCES Kostetskii, I., Li, J., Xiong, Y., Zhou, R., Ferrari, V.A., Patel, V.V., Molkentin, J.D., and Radice, G.L. (2005). Induced deletion of the N-cadherin gene in the heart leads to dissolution of the intercalated disc structure. Circ Res 96, Radice, G.L., Rayburn, H., Matsunami, H., Knudsen, K.A., Takeichi, M., and Hynes, R.O. (1997). Developmental defects in mouse embryos lacking N-cadherin. Developmental biology 181, Randall, T.D., and Weissman, I.L. (1998). Characterization of a population of cells in the bone marrow that phenotypically mimics hematopoietic stem cells: resting stem cells or mystery population? Stem cells (Dayton, Ohio) 16, Venezia, T.A., Merchant, A.A., Ramos, C.A., Whitehouse, N.L., Young, A.S., Shaw, C.A., and Goodell, M.A. (2004). Molecular signatures of proliferation and quiescence in hematopoietic stem cells. PLoS biology 2, e

PCR analysis was performed to show the presence and the integrity of the var1csa and var-

PCR analysis was performed to show the presence and the integrity of the var1csa and var- Supplementary information: Methods: Table S1: Primer Name Nucleotide sequence (5-3 ) DBL3-F tcc ccg cgg agt gaa aca tca tgt gac tg DBL3-R gac tag ttt ctt tca ata aat cac tcg c DBL5-F cgc cct agg tgc ttc

More information

In vivo BrdU Incorporation Assay for Murine Hematopioetic Stem Cells Ningfei An, Yubin Kang *

In vivo BrdU Incorporation Assay for Murine Hematopioetic Stem Cells Ningfei An, Yubin Kang * In vivo BrdU Incorporation Assay for Murine Hematopioetic Stem Cells Ningfei An, Yubin Kang * Division of Hematology-Oncology, Department of Medicine, Medical University of South Carolina, Charleston,

More information

(A-B) P2ry14 expression was assessed by (A) genotyping (upper arrow: WT; lower

(A-B) P2ry14 expression was assessed by (A) genotyping (upper arrow: WT; lower Supplementary Figures S1. (A-B) P2ry14 expression was assessed by (A) genotyping (upper arrow: ; lower arrow: KO) and (B) q-pcr analysis with Lin- cells, The white vertical line in panel A indicates that

More information

We designed the targeting vector in such a way that the first exon was flanked by two LoxP sites and

We designed the targeting vector in such a way that the first exon was flanked by two LoxP sites and Mice We designed the targeting vector in such a way that the first exon was flanked by two LoxP sites and an Frt flanked neo cassette (Fig. S1A). Targeted BA1 (C57BL/6 129/SvEv) hybrid embryonic stem cells

More information

IgG TrueBlot Protocol for Mouse, Rabbit or Goatderived Antibodies - For Research Use Only

IgG TrueBlot Protocol for Mouse, Rabbit or Goatderived Antibodies - For Research Use Only IgG TrueBlot Protocol for Mouse, Rabbit or Goatderived Antibodies - For Research Use Only Introduction The IgG TrueBlot for mouse, rabbit, or goat-derived antibodies represents unique series of respective

More information

SUPPLEMENTAL MATERIAL. Supplemental Methods:

SUPPLEMENTAL MATERIAL. Supplemental Methods: SUPPLEMENTAL MATERIAL Supplemental Methods: Immunoprecipitation- As we described but with some modifications [22]. As part of another ongoing project, lysate from human umbilical vein endothelial cells

More information

The GOODELL laboratory

The GOODELL laboratory The GOODELL laboratory Author Nathan Boles Feb.5, 2009 Title Hematopoietic Progenitor Staining Introduction This protocol describes the analysis or isolation of the early hematopoietic progenitors. HBSS+

More information

Electronic Supplementary Information

Electronic Supplementary Information Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2017 Electronic Supplementary Information Dissecting binding of a β-barrel outer membrane

More information

Single cell imaging of Bruton's Tyrosine Kinase using an irreversible inhibitor

Single cell imaging of Bruton's Tyrosine Kinase using an irreversible inhibitor SUPPLEMENTARY INFORMATION Single cell imaging of Bruton's Tyrosine Kinase using an irreversible inhibitor Anna Turetsky 1,a, Eunha Kim 1,a, Rainer H. Kohler 1, Miles A. Miller 1, Ralph Weissleder 1,2,

More information

MicroRNAs Modulate Hematopoietic Lineage Differentiation

MicroRNAs Modulate Hematopoietic Lineage Differentiation Chen et al., page 1 MicroRNAs Modulate Hematopoietic Lineage Differentiation Chang-Zheng Chen, Ling Li, Harvey F. Lodish, David. Bartel Supplemental Online Material Methods Cell isolation Murine bone marrow

More information

Anti-HB-EGF (Human) mab

Anti-HB-EGF (Human) mab Page 1 For Research Use Only. Not for use in diagnostic procedures. CODE No. D308-3 Anti-HB-EGF (Human) mab CLONALITY CLONE ISOTYPE QUANTITY SOURCE IMMUNOGEN FORMURATION STORAGE Monoclonal 3H4 Mouse IgG1

More information

88.7 <GFP-A>: EGFP GFP. Null. % of Cells! <APC-A> B220!

88.7 <GFP-A>: EGFP GFP. Null. % of Cells! <APC-A> B220! B. C. 1 Cell Number (X18) A. % of Cells % of Max 8 Con 6 4 88.7 1 13 14 : EGFP 4 6 4 1 WT 8 % of% ofcells Max 6 6 4 G. 1 13 B Hdac3-/- 14 15 1 13 14 15 Ter119 Ly6C Wild type WT 4

More information

Supplemental Information Inventory

Supplemental Information Inventory Cell Stem Cell, Volume 6 Supplemental Information Distinct Hematopoietic Stem Cell Subtypes Are Differentially Regulated by TGF-β1 Grant A. Challen, Nathan C. Boles, Stuart M. Chambers, and Margaret A.

More information

Revised: RG-RV2 by Fukuhara et al.

Revised: RG-RV2 by Fukuhara et al. Supplemental Figure 1 The generation of Spns2 conditional knockout mice. (A) Schematic representation of the wild type Spns2 locus (Spns2 + ), the targeted allele, the floxed allele (Spns2 f ) and the

More information

F4/80, CD11b, Gr-1, NK1.1, CD3, CD4, CD8 and CD19. A-antigen was detected with FITCconjugated

F4/80, CD11b, Gr-1, NK1.1, CD3, CD4, CD8 and CD19. A-antigen was detected with FITCconjugated SDC MATERIALS AND METHODS Flow Cytometric Detection of A-Antigen Expression Single cell suspensions were prepared from bone marrow, lymph node and spleen. Peripheral blood was obtained and erythrocytes

More information

Gα 13 Activation Assay Kit

Gα 13 Activation Assay Kit A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based Gα 13 Activation Assay Kit Catalog Number: 80401 20 assays NewEast Biosciences 1 Table of Content Product

More information

Supplementary Figure 1A A404 Cells +/- Retinoic Acid

Supplementary Figure 1A A404 Cells +/- Retinoic Acid Supplementary Figure 1A A44 Cells +/- Retinoic Acid 1 1 H3 Lys4 di-methylation SM-actin VEC cfos (-) RA (+) RA 14 1 1 8 6 4 H3 Lys79 di-methylation SM-actin VEC cfos (-) RA (+) RA Supplementary Figure

More information

SUPPLEMENTAL METHODS. Chromatin immunoprecipitation (ChIP) assay. Cell culture. Non-ablated mouse transplantation. Hematology and flow cytometry

SUPPLEMENTAL METHODS. Chromatin immunoprecipitation (ChIP) assay. Cell culture. Non-ablated mouse transplantation. Hematology and flow cytometry SUPPLEMENTAL METHODS Cell culture EML C1 cells were cultured in IMDM 20% horse serum, 1% antibiotic-antimycotic (Gibco by Life Technologies) 15% SCF conditioned medium from BHK/ MKL cells or 50 100 ng/ml

More information

Cdc42 Activation Assay Kit

Cdc42 Activation Assay Kit A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based Cdc42 Activation Assay Kit Catalog Number: 80701 20 assays 1 Table of Content Product Description 3 Assay

More information

Nongenetic Reprogramming of the Ligand Specificity. of Growth Factor Receptors by Bispecific DNA Aptamers

Nongenetic Reprogramming of the Ligand Specificity. of Growth Factor Receptors by Bispecific DNA Aptamers Supporting Information For Nongenetic Reprogramming of the Ligand Specificity of Growth Factor Receptors by Bispecific DNA Aptamers Ryosuke Ueki,* Saki Atsuta, Ayaka Ueki and Shinsuke Sando* Department

More information

MLN8237 induces proliferation arrest, expression of differentiation markers and

MLN8237 induces proliferation arrest, expression of differentiation markers and Supplementary Figure Legends Supplementary Figure 1 827 induces proliferation arrest, expression of differentiation markers and polyploidization of a human erythroleukemia cell line with the activating

More information

Arabidopsis actin depolymerizing factor AtADF4 mediates defense signal transduction triggered by the Pseudomonas syringae effector AvrPphB

Arabidopsis actin depolymerizing factor AtADF4 mediates defense signal transduction triggered by the Pseudomonas syringae effector AvrPphB Arabidopsis actin depolymerizing factor mediates defense signal transduction triggered by the Pseudomonas syringae effector AvrPphB Files in this Data Supplement: Supplemental Table S1 Supplemental Table

More information

Anti-Pim-1 (Cat#3247), anti-met (Cat#3127), anti-ron (Cat#2654), Anti-EGFR

Anti-Pim-1 (Cat#3247), anti-met (Cat#3127), anti-ron (Cat#2654), Anti-EGFR Supplementary Methods Antibodies Anti-Pim-1 (Cat#3247), anti-met (Cat#3127), anti-ron (Cat#2654), Anti-EGFR (Cat#2646), anti-igf1r (Cat#3018), anti-insr (Cat#3020), anti-akt (pan, Cat#4691), anti-phospho-akt

More information

Hes6. PPARα. PPARγ HNF4 CD36

Hes6. PPARα. PPARγ HNF4 CD36 SUPPLEMENTARY INFORMATION Supplementary Table Positions and Sequences of ChIP primers -63 AGGTCACTGCCA -79 AGGTCTGCTGTG Hes6-0067 GGGCAaAGTTCA ACOT -395 GGGGCAgAGTTCA PPARα -309 GGCTCAaAGTTCAaGTTCA CPTa

More information

Supplemental Table 1. Mutant ADAMTS3 alleles detected in HEK293T clone 4C2. WT CCTGTCACTTTGGTTGATAGC MVLLSLWLIAAALVEVR

Supplemental Table 1. Mutant ADAMTS3 alleles detected in HEK293T clone 4C2. WT CCTGTCACTTTGGTTGATAGC MVLLSLWLIAAALVEVR Supplemental Dataset Supplemental Table 1. Mutant ADAMTS3 alleles detected in HEK293T clone 4C2. DNA sequence Amino acid sequence WT CCTGTCACTTTGGTTGATAGC MVLLSLWLIAAALVEVR Allele 1 CCTGTC------------------GATAGC

More information

Flow cytometry Stained cells were analyzed and sorted by SORP FACS Aria (BD Biosciences).

Flow cytometry Stained cells were analyzed and sorted by SORP FACS Aria (BD Biosciences). Mice C57BL/6-Ly5.1 or -Ly5.2 congenic mice were used for LSK transduction and competitive repopulation assays. Animal care was in accordance with the guidelines of Keio University for animal and recombinant

More information

Supplementary Fig. 1. Isolation and in vitro expansion of EpCAM + cholangiocytes. For collagenase perfusion, enzyme solution was injected from the

Supplementary Fig. 1. Isolation and in vitro expansion of EpCAM + cholangiocytes. For collagenase perfusion, enzyme solution was injected from the Supplementary Fig. 1. Isolation and in vitro expansion of EpCAM + cholangiocytes. For collagenase perfusion, enzyme solution was injected from the portal vein for digesting adult livers, whereas it was

More information

Supporting Information

Supporting Information Supporting Information Transfection of DNA Cages into Mammalian Cells Email: a.turberfield@physics.ox.ac.uk Table of Contents Supporting Figure 1 DNA tetrahedra used in transfection experiments 2 Supporting

More information

1. Cross-linking and cell harvesting

1. Cross-linking and cell harvesting ChIP is a powerful tool that allows the specific matching of proteins or histone modifications to regions of the genome. Chromatin is isolated and antibodies to the antigen of interest are used to determine

More information

a Lamtor1 (gene) b Lamtor1 (mrna) c WT Lamtor1 Lamtor1 flox Lamtor2 A.U. p = LysM-Cre Lamtor3 Lamtor4 Lamtor5 BMDMs: Φ WT Φ KO β-actin WT BMDMs

a Lamtor1 (gene) b Lamtor1 (mrna) c WT Lamtor1 Lamtor1 flox Lamtor2 A.U. p = LysM-Cre Lamtor3 Lamtor4 Lamtor5 BMDMs: Φ WT Φ KO β-actin WT BMDMs a Lamtor (gene) b Lamtor (mrna) c BMDMs: Φ WT Φ KO Lamtor flox 8 bp LysM-Cre 93 bp..5 p =.4 WT BMDMs: Φ WT Φ KO Lamtor (protein) BMDMs: Φ WT Φ KO Lamtor 8 kda Lamtor 4 kda Lamtor3 4 kda Lamtor4 kda Lamtor5.5

More information

DRG Pituitary Cerebral Cortex

DRG Pituitary Cerebral Cortex Liver Spinal cord Pons Atg5 -/- Atg5 +/+ DRG Pituitary Cerebral Cortex WT KO Supplementary Figure S1 Ubiquitin-positive IBs accumulate in Atg5 -/- tissues. Atg5 -/- neonatal tissues were fixed and decalcified.

More information

Supplementary Figure 1. Localization of MST1 in RPE cells. Proliferating or ciliated HA- MST1 expressing RPE cells (see Fig. 5b for establishment of

Supplementary Figure 1. Localization of MST1 in RPE cells. Proliferating or ciliated HA- MST1 expressing RPE cells (see Fig. 5b for establishment of Supplementary Figure 1. Localization of MST1 in RPE cells. Proliferating or ciliated HA- MST1 expressing RPE cells (see Fig. 5b for establishment of the cell line) were immunostained for HA, acetylated

More information

Rab5 Activation Assay Kit

Rab5 Activation Assay Kit A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based Rab5 Activation Assay Kit Catalog Number: 83701 20 assays 24 Whitewoods Lane 1 Table of Content Product

More information

Supplementary Information (Ha, et. al) Supplementary Figures Supplementary Fig. S1

Supplementary Information (Ha, et. al) Supplementary Figures Supplementary Fig. S1 Supplementary Information (Ha, et. al) Supplementary Figures Supplementary Fig. S1 a His-ORMDL3 ~ 17 His-ORMDL3 GST-ORMDL3 - + - + IPTG GST-ORMDL3 ~ b Integrated Density (ORMDL3/ -actin) 0.4 0.3 0.2 0.1

More information

Arf6 Activation Assay Kit

Arf6 Activation Assay Kit A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based Arf6 Activation Assay Kit Catalog Number: 82401 20 assays NewEast Biosciences 1 Table of Content Product

More information

SANTA CRUZ BIOTECHNOLOGY, INC.

SANTA CRUZ BIOTECHNOLOGY, INC. TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same

More information

Quantitative reverse-transcription PCR. Transcript levels of flgs, flgr, flia and flha were

Quantitative reverse-transcription PCR. Transcript levels of flgs, flgr, flia and flha were 1 Supplemental methods 2 3 4 5 6 7 8 9 1 11 12 13 14 15 16 17 18 19 21 22 23 Quantitative reverse-transcription PCR. Transcript levels of flgs, flgr, flia and flha were monitored by quantitative reverse-transcription

More information

Supplemental Information

Supplemental Information Supplemental Information Intrinsic protein-protein interaction mediated and chaperonin assisted sequential assembly of a stable Bardet Biedl syndome protein complex, the BBSome * Qihong Zhang 1#, Dahai

More information

RheB Activation Assay Kit

RheB Activation Assay Kit A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based RheB Activation Assay Kit Catalog Number: 81201 20 assays NewEast Biosciences 1 FAX: 610-945-2008 Table

More information

Multiple layers of B cell memory with different effector functions. Ismail Dogan, Barbara Bertocci, Valérie Vilmont, Frédéric Delbos,

Multiple layers of B cell memory with different effector functions. Ismail Dogan, Barbara Bertocci, Valérie Vilmont, Frédéric Delbos, Multiple layers of B cell memory with different effector functions Ismail Dogan, Barbara Bertocci, Valérie Vilmont, Frédéric Delbos, Jérome Mégret, Sébastien Storck, Claude-Agnès Reynaud & Jean-Claude

More information

Gα i Activation Assay Kit

Gα i Activation Assay Kit A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based Gα i Activation Assay Kit Catalog Number 80301 20 assays NewEast Biosciences, Inc 1 Table of Content Product

More information

Supplemental Data Supplemental Figure 1.

Supplemental Data Supplemental Figure 1. Supplemental Data Supplemental Figure 1. Silique arrangement in the wild-type, jhs, and complemented lines. Wild-type (WT) (A), the jhs1 mutant (B,C), and the jhs1 mutant complemented with JHS1 (Com) (D)

More information

CRISPR-based gene disruption in murine HSPCs. Ayumi Kitano and Daisuke Nakada

CRISPR-based gene disruption in murine HSPCs. Ayumi Kitano and Daisuke Nakada CRISPR-based gene disruption in murine HSPCs Ayumi Kitano and Daisuke Nakada Nakada Lab Protocol INTRODUCTION We recently described fast, efficient, and cost-effective methods to directly modify the genomes

More information

Supplementary. Table 1: Oligonucleotides and Plasmids. complementary to positions from 77 of the SRα '- GCT CTA GAG AAC TTG AAG TAC AGA CTG C

Supplementary. Table 1: Oligonucleotides and Plasmids. complementary to positions from 77 of the SRα '- GCT CTA GAG AAC TTG AAG TAC AGA CTG C Supplementary Table 1: Oligonucleotides and Plasmids 913954 5'- GCT CTA GAG AAC TTG AAG TAC AGA CTG C 913955 5'- CCC AAG CTT ACA GTG TGG CCA TTC TGC TG 223396 5'- CGA CGC GTA CAG TGT GGC CAT TCT GCT G

More information

Western blot. Protein was run on a 12% SDS page gel and blotted onto PVDF

Western blot. Protein was run on a 12% SDS page gel and blotted onto PVDF Supplemental Data Methods Western blot. Protein was run on a % SDS page gel and blotted onto PVDF membrane (Millipore) by wet transfer. The blots were first incubated with MR monoclonal antibodies () diluted

More information

Fig. S1 TGF RI inhibitor SB effectively blocks phosphorylation of Smad2 induced by TGF. FET cells were treated with TGF in the presence of

Fig. S1 TGF RI inhibitor SB effectively blocks phosphorylation of Smad2 induced by TGF. FET cells were treated with TGF in the presence of Fig. S1 TGF RI inhibitor SB525334 effectively blocks phosphorylation of Smad2 induced by TGF. FET cells were treated with TGF in the presence of different concentrations of SB525334. Cells were lysed and

More information

Supplementary data. sienigma. F-Enigma F-EnigmaSM. a-p53

Supplementary data. sienigma. F-Enigma F-EnigmaSM. a-p53 Supplementary data Supplemental Figure 1 A sienigma #2 sienigma sicontrol a-enigma - + ++ - - - - - - + ++ - - - - - - ++ B sienigma F-Enigma F-EnigmaSM a-flag HLK3 cells - - - + ++ + ++ - + - + + - -

More information

Supplementary Material

Supplementary Material Supplementary Material Supplementary Methods Cell synchronization. For synchronized cell growth, thymidine was added to 30% confluent U2OS cells to a final concentration of 2.5mM. Cells were incubated

More information

B. ADM: C. D. Apoptosis: 1.68% 2.99% 1.31% Figure.S1,Li et al. number. invaded cells. HuH7 BxPC-3 DLD-1.

B. ADM: C. D. Apoptosis: 1.68% 2.99% 1.31% Figure.S1,Li et al. number. invaded cells. HuH7 BxPC-3 DLD-1. A. - Figure.S1,Li et al. B. : - + - + - + E-cadherin CK19 α-sma vimentin β -actin C. D. Apoptosis: 1.68% 2.99% 1.31% - : - + - + - + Apoptosis: 48.33% 45.32% 44.59% E. invaded cells number 400 300 200

More information

Supplemental material

Supplemental material Supplemental material THE JOURNAL OF CELL BIOLOGY Taylor et al., http://www.jcb.org/cgi/content/full/jcb.201403021/dc1 Figure S1. Representative images of Cav 1a -YFP mutants with and without LMB treatment.

More information

Supplemental methods:

Supplemental methods: Supplemental methods: ASC-J9 treatment ASC-J9 was patented by the University of Rochester, the University of North Carolina, and AndroScience Corp., and then licensed to AndroScience Corp. Both the University

More information

Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde

Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde Supplementary text Supplementary materials and methods Histopathological examination Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde (PFA) and embedded in paraffin wax with

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Fig. 1 Characterization of GSCs. a. Immunostaining of primary GSC spheres from GSC lines. Nestin (neural progenitor marker, red), TLX (green). Merged images of nestin,

More information

Supplementary Figure 1: Analysis of monocyte subsets and lineage relationships. (a) Gating strategy for definition of MDP and cmop populations in BM

Supplementary Figure 1: Analysis of monocyte subsets and lineage relationships. (a) Gating strategy for definition of MDP and cmop populations in BM Supplementary Figure 1: Analysis of monocyte subsets and lineage relationships. (a) Gating strategy for definition of MDP and cmop populations in BM of Cx3cr1 GFP/+ mice related to Fig. 1a. MDP was defined

More information

Supporting Information

Supporting Information Supporting Information He et al. 10.1073/pnas.1116302108 SI Methods Cell Culture. Mouse J774A.1 and RAW 264.7 macrophages were obtained from ATCC and were cultured in MEM supplemented with 10% FS (Sigma)

More information

Technical Note Detection of post-immunoprecipitation proteins by Western blot using the Quick Western Kit IRDye 680RD

Technical Note Detection of post-immunoprecipitation proteins by Western blot using the Quick Western Kit IRDye 680RD Technical Note Detection of post-immunoprecipitation proteins by Western blot using the Quick Western Kit IRDye 680RD Developed for: Aerius, Odyssey Classic, Odyssey CLx and Odyssey Sa Imaging Systems

More information

BD IMag. Streptavidin Particles Plus - DM. Technical Data Sheet. Product Information

BD IMag. Streptavidin Particles Plus - DM. Technical Data Sheet. Product Information Technical Data Sheet Streptavidin Particles Plus - DM Product Information Material Number: Size: Storage Buffer: 557812 5 ml Aqueous buffered solution containing BSA and 0.09% sodium azide. Description

More information

ΔPDD1 x ΔPDD1. ΔPDD1 x wild type. 70 kd Pdd1. Pdd3

ΔPDD1 x ΔPDD1. ΔPDD1 x wild type. 70 kd Pdd1. Pdd3 Supplemental Fig. S1 ΔPDD1 x wild type ΔPDD1 x ΔPDD1 70 kd Pdd1 50 kd 37 kd Pdd3 Supplemental Fig. S1. ΔPDD1 strains express no detectable Pdd1 protein. Western blot analysis of whole-protein extracts

More information

Dierks Supplementary Fig. S1

Dierks Supplementary Fig. S1 Dierks Supplementary Fig. S1 ITK SYK PH TH K42R wt K42R (kinase deficient) R29C E42K Y323F R29C E42K Y323F (reduced phospholipid binding) (enhanced phospholipid binding) (reduced Cbl binding) E42K Y323F

More information

Preparation of Mouse Bone Marrow Stromal Cells

Preparation of Mouse Bone Marrow Stromal Cells Preparation of Mouse Bone Marrow Stromal Cells A single-step stem cell purification method using adhesion to cell culture plastic was employed as described in the Reference. Briefly, neonatal and adult

More information

Hematopoietic stem cell transplantation without irradiation

Hematopoietic stem cell transplantation without irradiation nature methods Hematopoietic stem cell transplantation without irradiation Claudia Waskow, Vikas Madan, Susanne Bartels, Céline Costa, Rosel Blasig & Hans-Reimer Rodewald Supplementary figures and text:

More information

ab Ran Activation Assay Kit

ab Ran Activation Assay Kit ab173247 Ran Activation Assay Kit Instructions for Use For the simple and fast measurement of Ran activation. This product is for research use only and is not intended for diagnostic use. Version 1 Last

More information

Project 07/111 Final Report October 31, Project Title: Cloning and expression of porcine complement C3d for enhanced vaccines

Project 07/111 Final Report October 31, Project Title: Cloning and expression of porcine complement C3d for enhanced vaccines Project 07/111 Final Report October 31, 2007. Project Title: Cloning and expression of porcine complement C3d for enhanced vaccines Project Leader: Dr Douglas C. Hodgins (519-824-4120 Ex 54758, fax 519-824-5930)

More information

RNA was isolated using NucleoSpin RNA II (Macherey-Nagel, Bethlehem, PA) according to the

RNA was isolated using NucleoSpin RNA II (Macherey-Nagel, Bethlehem, PA) according to the Supplementary Methods RT-PCR and real-time PCR analysis RNA was isolated using NucleoSpin RNA II (Macherey-Nagel, Bethlehem, PA) according to the manufacturer s protocol and quantified by measuring the

More information

Generation of App knock-in mice reveals deletion mutations protective against Alzheimer s. disease-like pathology. Nagata et al.

Generation of App knock-in mice reveals deletion mutations protective against Alzheimer s. disease-like pathology. Nagata et al. Generation of App knock-in mice reveals deletion mutations protective against Alzheimer s disease-like pathology Nagata et al. Supplementary Fig 1. Previous App knock-in model did not show Aβ accumulation

More information

High Pure PCR Template Preparation Kit for preparation of 100 nucleic acid samples Cat. No

High Pure PCR Template Preparation Kit for preparation of 100 nucleic acid samples Cat. No for preparation of 100 nucleic acid samples Cat. No. 1 796 88 Principle Cells are lysed during a short incubation with Proteinase K in the presence of a chaotropic salt (guanidine HCl), which immediately

More information

SUPPLEMENTAL MATERIAL

SUPPLEMENTAL MATERIAL SUPPLEMENTAL MATERIAL MATERIALS AND METHODS Generation of TSPOΔ/Δ murine embryonic fibroblasts Embryos were harvested from 13.5-day pregnant TSPOfl/fl mice. After dissection to eviscerate and remove the

More information

Cat. # Product Size DS130 DynaExpress TA PCR Cloning Kit (ptakn-2) 20 reactions Box 1 (-20 ) ptakn-2 Vector, linearized 20 µl (50 ng/µl) 1

Cat. # Product Size DS130 DynaExpress TA PCR Cloning Kit (ptakn-2) 20 reactions Box 1 (-20 ) ptakn-2 Vector, linearized 20 µl (50 ng/µl) 1 Product Name: Kit Component TA PCR Cloning Kit (ptakn-2) Cat. # Product Size DS130 TA PCR Cloning Kit (ptakn-2) 20 reactions Box 1 (-20 ) ptakn-2 Vector, linearized 20 µl (50 ng/µl) 1 2 Ligation Buffer

More information

Supplementary Information: Materials and Methods. Immunoblot and immunoprecipitation. Cells were washed in phosphate buffered

Supplementary Information: Materials and Methods. Immunoblot and immunoprecipitation. Cells were washed in phosphate buffered Supplementary Information: Materials and Methods Immunoblot and immunoprecipitation. Cells were washed in phosphate buffered saline (PBS) and lysed in TNN lysis buffer (50mM Tris at ph 8.0, 120mM NaCl

More information

Supporting Information

Supporting Information Supporting Information Tal et al. 10.1073/pnas.0807694106 SI Materials and Methods VSV Infection and Quantification. Infection was carried out by seeding 5 10 5 MEF cells per well in a 6-well plate and

More information

RhoC Activation Assay Kit

RhoC Activation Assay Kit Product Manual RhoC Activation Assay Kit Catalog Number STA-403-C 20 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Small GTP-binding proteins (or GTPases) are a family

More information

Dolphin-Chemi Plus. Aim: To visualise and evaluate the performance of chemiluminescent immunoblots using Wealtec s Dolphin-Chemi plus image system

Dolphin-Chemi Plus. Aim: To visualise and evaluate the performance of chemiluminescent immunoblots using Wealtec s Dolphin-Chemi plus image system Application Note 03 Dolphin-Chemi plus 8/22/2007 Dolphin-Chemi Plus Aim: To visualise and evaluate the performance of chemiluminescent immunoblots using Wealtec s Dolphin-Chemi plus image system INTRODUCTION

More information

Nature Immunology: doi: /ni.3694

Nature Immunology: doi: /ni.3694 Supplementary Figure 1 Expression of Bhlhe41 and Bhlhe40 in B cell development and mature B cell subsets. (a) Scatter plot showing differential expression of genes between splenic B-1a cells and follicular

More information

Add 5µl of 3N NaOH to DNA sample (final concentration 0.3N NaOH).

Add 5µl of 3N NaOH to DNA sample (final concentration 0.3N NaOH). Bisulfite Treatment of DNA Dilute DNA sample to 2µg DNA in 50µl ddh 2 O. Add 5µl of 3N NaOH to DNA sample (final concentration 0.3N NaOH). Incubate in a 37ºC water bath for 30 minutes. To 55µl samples

More information

RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,

RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe, Materials and methods Oligonucleotides and DNA constructs RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by Dharmacon Inc. (Lafayette, CO). The sequences were: 122-2 OMe, 5

More information

Chromatin immunoprecipitation (ChIP) ES and FACS-sorted GFP+/Flk1+ cells were fixed in 1% formaldehyde and sonicated until fragments of an average

Chromatin immunoprecipitation (ChIP) ES and FACS-sorted GFP+/Flk1+ cells were fixed in 1% formaldehyde and sonicated until fragments of an average Chromatin immunoprecipitation (ChIP) ES and FACS-sorted cells were fixed in % formaldehyde and sonicated until fragments of an average size of 5 bp were obtained. Soluble, sheared chromatin was diluted

More information

Antibodies used in this study Figure S1. Akt expression in neutrophils from WT and individual Akt isoform knockout mice

Antibodies used in this study Figure S1. Akt expression in neutrophils from WT and individual Akt isoform knockout mice ntibodies used in this study The anti β-actin monoclonal antibody (Sigma-ldrich, St. Louis, MO) was generated against a slightly modified human β-actin N-terminal peptide, c-sp-sp-sp-ile-la-la-leu-val-ile-

More information

Supplemental Materials and Methods

Supplemental Materials and Methods Supplemental Materials and Methods In situ hybridization In situ hybridization analysis of HFE2 and genin mrna in rat liver tissues was performed as previously described (1). Briefly, the digoxigenin-labeled

More information

Overexpression Normal expression Overexpression Normal expression. 26 (21.1%) N (%) P-value a N (%)

Overexpression Normal expression Overexpression Normal expression. 26 (21.1%) N (%) P-value a N (%) SUPPLEMENTARY TABLES Table S1. Alteration of ZNF322A protein expression levels in relation to clinicopathological parameters in 123 Asian and 74 Caucasian lung cancer patients. Asian patients Caucasian

More information

1. Goat Anti-Caspase-3 (CPP32) Antibody, R&D systems (cat #AF-605-NA), 0.5ug/ml

1. Goat Anti-Caspase-3 (CPP32) Antibody, R&D systems (cat #AF-605-NA), 0.5ug/ml Western Blot Antibodies: 1. Goat Anti-Caspase-3 (CPP32) Antibody, R&D systems (cat #AF-605-NA), 0.5ug/ml 2. Goat Anti-human LAP (TGF-b1) Antibody, R&D Systems (cat #AF-246-NA), 0.1-0.2 ug/ml 3. Rabbit

More information

Spironolactone ameliorates PIT1-dependent vascular osteoinduction in klotho-hypomorphic mice

Spironolactone ameliorates PIT1-dependent vascular osteoinduction in klotho-hypomorphic mice Spironolactone ameliorates PIT1-dependent vascular osteoinduction in klotho-hypomorphic mice Supplementary Material Supplementary Methods Materials Spironolactone, aldosterone and β-glycerophosphate were

More information

Product Datasheet. Histone H4 [Dimethyl Lys20] Antibody NB SS. Unit Size: mg

Product Datasheet. Histone H4 [Dimethyl Lys20] Antibody NB SS. Unit Size: mg Product Datasheet Histone H4 [Dimethyl Lys20] Antibody NB21-2089SS Unit Size: 0.025 mg Store at 4C short term. Aliquot and store at -20C long term. Avoid freeze-thaw cycles. Protocols, Publications, Related

More information

Protein A Agarose Immunoprecipitation Kit

Protein A Agarose Immunoprecipitation Kit Protein A Agarose Immunoprecipitation Kit Catalog Number KA0568 20 Reactions Version: 01 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 General Information...

More information

Supporting Online Material. 3. Analysis of in vivo TLR4-mediated response in TRIF-deficient mice

Supporting Online Material. 3. Analysis of in vivo TLR4-mediated response in TRIF-deficient mice Supporting Online Material 1. Materials and Methods 2. Generation of TRIF-deficient mice 3. Analysis of in vivo TLR4-mediated response in TRIF-deficient mice 4. Measurement of LPS-induced IRAK-1 kinase

More information

Rassf1a -/- Sav1 +/- mice. Supplementary Figures:

Rassf1a -/- Sav1 +/- mice. Supplementary Figures: 1 Supplementary Figures: Figure S1: Genotyping of Rassf1a and Sav1 mutant mice. A. Rassf1a knockout mice lack exon 1 of the Rassf1 gene. A diagram and typical PCR genotyping of wildtype and Rassf1a -/-

More information

Gene Sequence Annealing Temperature. Actin 5 : 5 -CATCACTATTGGCAACGAGC-3 60 C 3 : 5 -ACGCAGCTCAGTAACAGTCC-3 PCR product: 410 bp

Gene Sequence Annealing Temperature. Actin 5 : 5 -CATCACTATTGGCAACGAGC-3 60 C 3 : 5 -ACGCAGCTCAGTAACAGTCC-3 PCR product: 410 bp Supporting Materials and Methods RT-PCR RT-PCR was performed as described in ref. 1 using the following oligonucleotides and PCR conditions: 2 min at 95 C, (20 s at 95 C, 20 s at the annealing temp, and

More information

strain devoid of the aox1 gene [1]. Thus, the identification of AOX1 in the intracellular

strain devoid of the aox1 gene [1]. Thus, the identification of AOX1 in the intracellular Additional file 2 Identification of AOX1 in P. pastoris GS115 with a Mut s phenotype Results and Discussion The HBsAg producing strain was originally identified as a Mut s (methanol utilization slow) strain

More information

SUPPLEMENTARY INFORMATION. LIN-28 co-transcriptionally binds primary let-7 to regulate mirna maturation in C. elegans

SUPPLEMENTARY INFORMATION. LIN-28 co-transcriptionally binds primary let-7 to regulate mirna maturation in C. elegans SUPPLEMENTARY INFORMATION LIN-28 co-transcriptionally binds primary let-7 to regulate mirna maturation in C. elegans Priscilla M. Van Wynsberghe 1, Zoya S. Kai 1, Katlin B. Massirer 2-4, Victoria H. Burton

More information

Supplemental Table 1: Sequences of real time PCR primers. Primers were intronspanning

Supplemental Table 1: Sequences of real time PCR primers. Primers were intronspanning Symbol Accession Number Sense-primer (5-3 ) Antisense-primer (5-3 ) T a C ACTB NM_001101.3 CCAGAGGCGTACAGGGATAG CCAACCGCGAGAAGATGA 57 HSD3B2 NM_000198.3 CTTGGACAAGGCCTTCAGAC TCAAGTACAGTCAGCTTGGTCCT 60

More information

Nature Medicine doi: /nm.2548

Nature Medicine doi: /nm.2548 Supplementary Table 1: Genotypes of offspring and embryos from matings of Pmm2 WT/F118L mice with Pmm2 WT/R137H mice total events Pmm2 WT/WT Pmm2 WT/R137H Pmm2 WT/F118L Pmm2 R137H/F118L offspring 117 (100%)

More information

Supplement 1: Sequences of Capture Probes. Capture probes were /5AmMC6/CTG TAG GTG CGG GTG GAC GTA GTC

Supplement 1: Sequences of Capture Probes. Capture probes were /5AmMC6/CTG TAG GTG CGG GTG GAC GTA GTC Supplementary Appendixes Supplement 1: Sequences of Capture Probes. Capture probes were /5AmMC6/CTG TAG GTG CGG GTG GAC GTA GTC ACG TAG CTC CGG CTG GA-3 for vimentin, /5AmMC6/TCC CTC GCG CGT GGC TTC CGC

More information

An engineered tryptophan zipper-type peptide as a molecular recognition scaffold

An engineered tryptophan zipper-type peptide as a molecular recognition scaffold SUPPLEMENTARY MATERIAL An engineered tryptophan zipper-type peptide as a molecular recognition scaffold Zihao Cheng and Robert E. Campbell* Supplementary Methods Library construction for FRET-based screening

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb3240 Supplementary Figure 1 GBM cell lines display similar levels of p100 to p52 processing but respond differentially to TWEAK-induced TERT expression according to TERT promoter mutation

More information

Chemiluminescent Substrates

Chemiluminescent Substrates s Cost comparisons between various s Table 6. Blotting cost comparison between SuperSignal, GE Healthcare's ECL and Western Lightning Products. SuperSignal GE Healthcare (APB) Western West Pico ECL Lightning

More information

Methods Western blot analysis of plg Quantification of plasminogen accumulation by ELISA Immunohistochemical analysis

Methods Western blot analysis of plg Quantification of plasminogen accumulation by ELISA Immunohistochemical analysis Methods Western blot analysis of plg Wild-type mice first received a standardized burn wound and then were intravenously administered 2 mg of human plg (Omnio AB, Umeå, Sweden). 24 hours after wounding

More information

Figure S1. Characterization of the irx9l-1 mutant. (A) Diagram of the Arabidopsis IRX9L gene drawn based on information from TAIR (the Arabidopsis

Figure S1. Characterization of the irx9l-1 mutant. (A) Diagram of the Arabidopsis IRX9L gene drawn based on information from TAIR (the Arabidopsis 1 2 3 4 5 6 7 8 9 10 11 12 Figure S1. Characterization of the irx9l-1 mutant. (A) Diagram of the Arabidopsis IRX9L gene drawn based on information from TAIR (the Arabidopsis Information Research). Exons

More information

His Tag Western and LumiBlot Reagents Sensitive detection of His Tag fusion proteins

His Tag Western and LumiBlot Reagents Sensitive detection of His Tag fusion proteins His Tag Western and LumiBlot Reagents Sensitive detection of His Tag fusion proteins The His Tag Reagents are kits containing optimized components for blot detection using the His Tag Monoclonal Antibody.

More information

Antibodies against PCNA were previously described [1]. To deplete PCNA from Xenopus egg

Antibodies against PCNA were previously described [1]. To deplete PCNA from Xenopus egg Supplementary information Supplementary methods PCNA antibody and immunodepletion Antibodies against PCNA were previously described [1]. To deplete PCNA from Xenopus egg extracts, one volume of protein

More information

Supplementary Figure 1. Xbp1 deficiency does not alter hematopoietic cellularity.

Supplementary Figure 1. Xbp1 deficiency does not alter hematopoietic cellularity. Supplementary Figure 1 Xbp1 deficiency does not alter hematopoietic cellularity. Absolute number of leukocytes obtained from bone marrow (BM, 2 tibias and 2 femurs per mouse) of Xbp1 f/f and Xbp1 Vav1

More information

Western blotting technique: principle, procedure and application

Western blotting technique: principle, procedure and application Western blotting technique: principle, procedure and application The term blotting refers to the transfer of biological samples from a gel to a membrane and their subsequent detection on the surface of

More information