Supporting Information Lin et al.

Transcription

1 Supporting Information Lin et al. SI Materials and Methods. Isolation and culture of human MSCs and ECFCs Human watmscs were isolated from normal discarded subcutaneous white adipose tissue obtained during clinically indicated procedures in accordance with an Institutional Review Board-approved protocol, as previously described (1). Human bmmscs were isolated from the mononuclear cell fraction of bone marrow aspirates as previously described (2). Both, watmscs and bmmscs were cultured on uncoated plates using MSC-medium: MSCGM (Lonza) supplemented with 10% MSC-qualified FBS (Hyclone), 1x glutamine-penicillin-streptomycin (GPS; Invitrogen). All experiments were carried out with MSCs between passages 4-6. Human ECFCs were isolated from umbilical cord blood samples in accordance with an Institutional Review Board-approved protocol as previously described (3). ECFCs were cultured on 1% gelatin-coated plates using ECFC-medium: EGM-2 (except for hydrocortisone; Lonza) supplemented with 20% FBS, 1x GPS. All experiments were carried out with ECFCs between passages 5-8. In vivo cell engraftment Animal experiments were conducted under a protocol approved by the Institutional Animal Care and Use Committee at Children s Hospital Boston in an AAALAC-approved facility. Human MSCs (1.2x10 6 cells), resuspended in 200 µl of ice-cold Phenol Red-free Matrigel (BD Bioscience) and in the presence or absence of ECFCs (8x10 5 cells), were subcutaneously injected on the back of 6-week-old male athymic nu/nu mice (Massachusetts General Hospital, Boston, MA) or GFP transgenic severe combined immunodeficiency (SCID) mice. GFP transgenic SCID mice were generated by crossing GFP-expressing UBI-GFP/BL6 mice with C57BL/6J-SCID mice (Jackson Laboratories). Alternatively, on indicated experiments, bovine collagen type 1 (Trevigen) based gels were used instead of Matrigel, as previously described (4). On indicated experiments, supplements were added to the cell-matrigel mixture prior to implantation: BMP-2 (R&D Systems; 2 µg/implant); PDGF-BB (R&D Systems; 100 ng/implant); PDGFR inhibitor Tyrphostin AG1296 (Sigma; 1.33 µg/implant); or concentrated ECFCconditioned medium (100 µl/implants). Conditioned media were generated for 24 h by 8x10 5 ECFCs in EBM-2, 5% FBS, and then concentrated 10-fold. Mice were euthanized and grafts were explanted after either 2, 7, or 28 days. On indicated experiments, rhodamine-conjugated Ulex europaeus agglutinin I lectin (UEA-1; Vector Laboratories) (100 µl; 1 mg/ml in saline) was intravenously injected into the tail vein of implant-bearing mice 10 min before harvesting the implants. Cell retrieval and sorting Grafts were removed from euthanized mice and cells were retrieved by enzymatic (1 mg/ml collagenase and 2.5 U/mL dispase) digestion for 1 h at 37 C. Retrieved cells were then prepared into single-cell suspensions and sorted into hcd90 + and hcd90 - cells by magneticactivated cell sorting (MACS) using magnetic beads (Miltenyi Biotec) coated with anti-human CD90 antibodies. Alternatively, retrieved cells were sorted into hcd90 + /PDGFR-β + and hcd90 + / 1

2 PDGFR-β - cells by fluorescence-activated cell sorting (FACS) using a FACSAria II 5-LASER sorter system (BD Bioscience). Sorted cells were analyzed either immediately or after an indicated period of culture. Analyses included (1) expression of cell markers, (2) CFU-F activity, (3) in vitro differentiation potential, and (4) in vivo engraftment potential in secondary mice. Histological analyses Explanted grafts were fixed overnight in 10% buffered formalin, embedded in paraffin and sectioned (7 µm-thick). Hematoxylin and eosin (H&E)-stained sections were examined for the presence of adipocytes, adipocyte density (adipocytes/mm 2 ), and adipocyte size (µm 2 ) using ImageJ 1.47v software (National Institutes of Health). Von kossa-stained sections were used to measure tissue mineralization (% of section area mineralized) using ImageJ. For immunostaining, sections were deparaffinized and antigen retrieval was carried out with tris EDTA buffer (10 mm Tris-Base, 2 mm EDTA, 0.05 % Tween-20, ph 9.0), as previously described (2). Sections were then blocked for 30 min in 5 10 % blocking serum and incubated with primary antibodies for 1 h at room temperature. Primary antibodies used are detailed in Supplemental Experimental Procedures. Horseradish peroxidase-conjugated mouse secondary antibody (1:200; Vector Laboratories) and 3,3 -diaminobenzidine (DAB) were used for detection of hcd31, followed by hematoxylin counterstaining and Permount mounting. Fluorescent staining was performed using either Texas Red- or FITC-conjugated secondary antibodies (1:200) followed by DAPI counterstaining (Vector Laboratories). On indicated experiments, additional fluorescent staining was performed using rhodamine-conjugated UEA-1 (1:200). Sections taken from indicated murine tissues and from normal discarded human dermis and adipose tissues served as control. Ex vivo multilineage differentiation Adipogenesis: confluent MSCs were cultured for 10 days in low-glucose DMEM with 10% FBS, 1x GPS, and adipogenic supplements (5 µg/ml insulin, 1 µm dexamethasone, 0.5 mm isobutylmethylxanthine, 60 µm indomethacin, 1 µm rosiglitazone). Differentiation into adipocytes was assessed by Oil Red O staining. Cells cultured in medium lacking adipogenic supplements served as a negative control. Osteogenesis: confluent MSCs were cultured for 21 days in low-glucose DMEM with 10% FBS, 1x GPS, and osteogenic supplements (1 µm dexamethasone, 10 mm β- glycerophosphate, 60 µm ascorbic acid-2-phosphate). Osteogenic differentiation was assessed by alkaline phosphatase and von Kossa staining. Cells cultured in medium lacking osteogenic supplements served as a negative control. Chondrogenesis: suspensions of MSCs were gently centrifuged in 15 ml polypropylene centrifuge tubes (500,000 cells/tube). Pellets were cultured in high-glucose DMEM medium with 1x GPS, and chondrogenic supplements (1X insulin-transferrin-selenium, 1 µm dexamethasone, 100 µm ascorbic acid-2-phosphate, and 10 ng/ml TGF-β3). After 21 days, pellets were fixed in 10% buffered formalin, cryoprotected in 30% (w/v) sucrose solution, embedded in O.C.T. medium, and sectioned (8 µm-thick) using a cryostat microtome. Chondrogenic differentiation was assessed by the presence of glycosaminoglycans with Alcian Blue staining. MSCs cultured in the absence of TGF-β3 served as negative controls and failed to form compact spheroids. Smooth muscle myogenesis: MSCs were co-cultured for 7 days with ECFCs (1:1 ratio) on fibronectin-coated, 2-well Permanox chamber slides at a density of 1x10 5 cell/well using ECFC- 2

3 medium. Expression of smooth muscle myosin heavy chain (MYH11) was evaluated by immunofluorescence using a rabbit monoclonal antibody followed by anti-rabbit FITCconjugated secondary antibody. ECFCs were stained with rhodamine-conjugated UEA-1 (1:200). Monocultures of MSCs served as negative control. Protein array Samples of conditioned media were collected from monocultures of MSCs and ECFCs and from co-cultures of MSCs+ECFCs (1:1 ratio). Cells were cultured in EBM-2, 5% FBS for 24 h and collected media were filtered (0.2 µm) and then concentrated 10-fold (Amicon Ultra centrifugal filters; 3 kda cut off; Millipore). The presence of angiogenic cytokines and growth factors was evaluated with a human angiogenesis protein array (R&D Systems Inc.), according to the manufacturer s instructions. Antigen-antibody complexes were visualized using LumiGLO substrate (Kirkegaard & Perry Laboratories, Inc.) and chemiluminescent sensitive film (Kodak). Densitometry was performed by image analysis (ImageJ) to estimate the amount of protein present in each sample. sirna silencing Three sirna constructs targeting human PDGF-B, as well as the negative control sirna construct, were obtained from Origene (Trilencer-27 sirna; SR303420). Each sirna construct (100 pmole) was transfected into 2x10 6 ECFCs by electroporation using Amaxa HUVEC Nuclefector kit (Lonza). After 48 h, mrna were isolated from transfected cells and qrt-pcr was carried out to validate the efficiency of sirna silencing. For in vivo cell implantation, ECFCs 24 h after sirna transfection were used. Colony-forming unit-fibroblast (CFU-F) activity MSCs were plated at clonal density (500 cell/100 cm 2 ) onto 1% gelatin-coated plates using MSC-medium. Medium was refreshed every 4 days. At day 10, colonies containing 200 cells were scored under a fluorescence microscope following nuclei staining with DAPI. On indicated experiments, colonies were also examined for expression of green fluorescence and binding of rhodamine-conjugated UEA-1 identify the presence of murine GFP + colonies and human ECFCs, respectively. Quantitative RT-PCR Quantitative RT-PCR (qrt-pcr) was carried out in RNA lysates prepared from either cells in culture or explanted grafts. Total RNA was isolated with a RNeasy kit (QIAGEN), and cdna was prepared using reverse transcriptase III (Invitrogen), according to the manufacturer s instructions. Multigene transcriptional profiling, a form of qrt-pcr, was used to determine the number of mrna copies per cell normalized to ribosomal 18S rrna abundance, as previously described (4). On indicated analyses, gene expression was normalized to human β-actin (ACTB) expression. Real-time PCR primer sequences are displayed in Table S1. Heat maps were generated using the Gene-E software package ( software/gene-e/). Lysates from human adult peripheral blood mononuclear cells (PBMNCs), aortic smooth muscle cells (SMCs; Lonza), and dermal fibroblasts (NHDFs; Lonza) served as control. Flow cytometry 3

4 Flow cytometric analyses were performed using a Guava easy Cyte HT FACS flow cytometer (Millipore). Antibody labeling was carried out for 20 min on ice followed by 3 washes with PBS supplemented with 1% BSA and 0.2 mm EDTA. Cell staining was followed by fixation with 1% paraformaldehyde. All fluorophore-conjugated antibodies used are displayed in Table S2. Cell apoptosis was evaluated following APC-conjugated Annexin V and propidium iodide (PI) staining (Annexin V Apoptosis Detection Kit; ebioscience), according to the manufacturer s instructions. Immunofluorescence Immunofluorescence was carried out using primary antibodies described in Table S2, followed by fluorescently-conjugated secondary antibodies (1:200; Vector Laboratories) and Vectashield mounting medium with DAPI (Vector Laboratories). Murine dermal ECs (m-decs) and adipose tissue-derived MSCs (m-watmscs) served as control. Microscopy Images were taken using an Axio Observer Z1 inverted microscope (Carl Zeiss) and AxioVision Rel. 4.8 software. Phase microscopy images were taken with an AxioCam MRm camera and 5x/ 0.16 or 10x/0.3 objective lens. Fluorescent images were taken with an ApoTome.2 Optical sectioning system (Carl Zeiss) and 20x/0.8 or 40x/1.4 oil objective lens. Non-fluorescent images were taken with an AxioCam MRc5 camera using a 40x/1.4 objective oil lens. Statistical analyses Data were expressed as mean ± standard error of the mean (SEM). Means were compared using unpaired Student s t tests. Comparisons between multiple groups were performed by ANOVA followed by bonferroni post-test analysis. All statistical analyses were performed using GraphPad Prism v.5 software (GraphPad Software Inc). P<0.05 was considered statistically significant. SI References 1. Lin RZ, et al. (2013) Human white adipose tissue vasculature contains endothelial colonyforming cells with robust in vivo vasculogenic potential. Angiogenesis 16(4): Melero-Martin JM, et al. (2008) Engineering robust and functional vascular networks in vivo with human adult and cord blood-derived progenitor cells. Circ Res 103(2): Melero-Martin JM, et al. (2007) In vivo vasculogenic potential of human blood-derived endothelial progenitor cells. Blood 109(11): Lin RZ, et al. (2011) Induction of erythropoiesis using human vascular networks genetically engineered for controlled erythropoietin release. Blood 118(20):

5 Table S1 - Primer sequences used in the study * Gene Forward Reverse β-actin (ACTB) CTGGAACGGTGAAGGTGACA AGTCCTCGGCCACATTGTG 18S rrna TGTCTCAAAGATTAAGCCATGCA GCGACCAAAGGAACCATAACTG CD90 GCCTAACGGCCTGCCTAGT GGGTGAACTGCTGGTATTCTCAT CD73 TATCCGGTCGCCCATTGAT GGCAATACAGCAGCCAGGTT PDGF-A CACAGCATCCGGGACCTC AGGCTGGTGTCCAAAGAATCC PDGF-B CTCGATCCGCTCCTTTGATG GGGTCATGTTCAGGTCCAACTC PDGFR-β GGTGGGCACACTACAATTTGC GGTGGGTAGGCCTCGAACA CD31 CACCTGGCCCAGGAGTTTC AGTACACAGCCTTGTTGCCATGT vwf GTCGAGCTGCACAGTGACATG GCACCATAAACGTTGACTTCCA VE-cadherin GAACCCAAGATGTGGCCTTTAG GATGTGACAACAGCGAGGTGTAA VEGFR-2 GGCAAATGTGTCAGCTTTGTACA GGTCACGTGGAAGGAGATCAC enos AGATCTCCGCCTCGCTCAT GTCTCGGAGCCATACAGGATTG CD45 GTGGAGAAAGGACGCATGCT TGCCAAGAGTTTAAGCCACAAA CD11b TCGAGTACGTGCCACACCAA TTCCGAAGCTCAGCCAGAA CD14 GAACTGACGCTCGAGGACCTA GCAAGTCCTGTGGCTTCCA PPARγ GCCAAGCTGCTCCAGAAAAT GAGCGGGTGAAGACTCATGTC FABP4 TGGTGGTGGAATGCGTCAT CAACGTCCCTTGGCTTATGC C/EBPα GCCTTCAGCATTGCCTAGGA GGGCACAGAGGCCAGATACA Leptin GTATGCCTTCCAGAAACGTGATC GGCCAGCACGTGAAGAAGA Adiponectin CCACTATGATGGCTCCACTGGTA AGGCTGACCTTCACATCCTTCA Adiposin TGGTTGGTCTTTATTGAGCACCTA GAGATGGAGTCGCGCTACGT LPL TGTGGTGGACTGGCTGTCA TCCTGTCCCACCAGTTTGGT RUNX2 CCTCACTGAGAGCCGCTTCT AGGGACATGCCTGAGGTGACT SOX9 CCCCAACAGATCGCCTACAG TCTGGTGGTCGGTGTAGTCGTA Osterix TGAGCTGGAGCGTCATGTG GGTGGTCGCTTCGGGTAAA Osteopontin CGAGGAGTTGAATGGTGCATAC CATCCAGCTGACTCGTTTCATAA Osteocalcin AAGAGACCCAGGCGCTACCT AACTCGTCACAGTCCGGATTG SM22 CTGCAGGAGGGAAAGCATGT AGGTCGTCCGTAGCCTGTCA α-sma GGAAGGACCTGTATGCCAACA AGCGCGGTGATCTCTTTCTG MYH11 CAGCCCAGGATGATGAGATGT TCCTCGCTGAAACCCATGA PDGFR-α CCTGGCTAAGAATCTCCTTGGA CAGCAGCCACCGTGAGTTC Desmin TCCAGTCCTACACCTGCGAGAT GGCAAATCGGTCCTCCAAT Ang1 CGCTGCCATTCTGACTCACATA CCGGTTATATCTTCTCCCACTGTTT * Primers were designed to specifically recognize human, but not murine, genes. Primers for 18S rrna were valid for both human and mouse. 5

6 Table S2 - Antibodies used in the study Antibody Vendor Clone Dilution * PE-conjugated mouse anti-human CD90 BD Pharmingen 5E10 5 µl/10 6 cells (MACS) 1:100 (FC) APC-conjugated mouse anti-human CD90 ebioscience 5E10 1:100 (FC) PE-conjugated mouse anti-human CD44 BD Pharmingen 515 1:100 (FC) FITC-conjugated mouse anti-human CD105 R&D Systems :100 (FC) PE-conjugated mouse anti-human CD29 BD Pharmingen MAR4 1:100 (FC) PE-conjugated mouse anti-human CD73 BD Pharmingen AD2 1:100 (FC) APC-conjugated mouse anti-human PDGFR-β BioLegend 18A2 1:10 (FC) FITC-conjugated mouse anti-human CD31 BD Pharmingen WM59 1:10 (FC) PE-conjugated mouse anti-human CD31 Ancell 158-2B3 1:100 (FC) FITC-conjugated mouse anti-human CD45 BD Pharmingen 2D1 1:100 (FC) FITC-conjugated rat anti-mouse CD45 BD Pharmingen 30-F11 1 µl/10 6 cells (MACS) 1:100 (FC) PE-Cy5-conjugated rat anti-mouse CD45 BD Pharmingen 30-F11 1:100 (FC) PE -conjugated rat anti-mouse CD29 ebioscience HMb1-1 1:100 (FC) APC-conjugated rat anti-mouse CD31 ebioscience 390 1:50 (FC) Mouse anti-human Vimentin Abcam V9 1:200 (IF) 1:200 (IHF) Rabbit anti-myh11 Biomedical BT-562 1:200 (IF) Technology, Inc. Mouse anti-human CD31 DakoCytomation JC70A 1:50 (IHC) Goat anti-perilipin-a Abcam ab :200 (IF) Rabbit anti-osterix Abcam ab :200 (IF) Rabbit anti-pdgfr-β Cell Signaling 28E1 1:200 (IF) Rabbit anti-αsma Abcam ab5694 1:200 (IHF) Rabbit anti-gfp Abcam ab290 1:200 (IHF) TexasRed -conjugated horse anti-mouse IgG Vector Laboratories TI :200 (IF) 1:200 (IHF) FITC-conjugated horse anti-mouse IgG Vector Laboratories FI :200 (IHF) Peroxidase-conjugated horse anti-mouse IgG Vector Laboratories PI :200 (IHC) Texas Red-conjugated goat anti-rabbit IgG Vector Laboratories TI :200 (IF) Texas Red -conjugated goat anti-rabbit IgG Vector Laboratories TI :200 (IHF) FITC-conjugated goat anti-rabbit IgG Vector Laboratories FI :200 (IHF) * MACS: Magnetic-activated cell sorting; FC: flow cytometry; IF: immunofluorescence cell staining; IHC: immunohistochemistry staining; IHF: immuno-histofluorescence staining. 6

7 Fig. S1. Isolation and phenotypical characterization of human MSCs. (A) Characteristic spindleshape morphology of MSC colonies derived from normal white adipose tissue (watmscs) and bone marrow aspirates (bmmscs) (n = 3 separate subjects per tissue). (B) Cytometric analysis of cultured MSCs revealed uniform expression of mesenchymal cell markers (CD90, CD44, CD105, CD29, CD73 and PDGFR-β) and lack of CD31 and CD45 expression. Red and bluelined histograms represent cells stained with fluorescent antibodies. Isotype-matched controls are overlaid in solid grey histograms. (C) Heat map generated from qrt-pcr analysis of cultured MSCs revealed high expression of mesenchymal markers (top) and low expression of endothelial (middle) and hematopoietic (bottom) markers. mrna data are normalized to ribosomal 18S rrna abundance. Human blood-derived ECFCs and PBMNCs served as controls. 7

8 Fig. S2. Ex vivo multilineage differentiation of MSCs. (A) Induction of adipogenic differentiation (10 days) assessed by intracellular accumulation of oil droplets (oil red O staining). Inset depicts watmscs under non-inducing conditions. (B) Upregulation of PPAR-γ following adipogenic induction. Analyses were performed by qrt-pcr and data normalized to ribosomal 18S rrna abundance. (C) Ex vivo induction of osteogenic differentiation (21 days) assessed by calcium deposition (von Kossa staining). Inset depicts watmscs under non-inducing conditions. (D) Upregulation of RUNX2 following osteogenic induction. Data normalized to 18S rrna abundance. (E) Induction of chondrogenic differentiation (21 days) assessed in pellet culture by glycosaminoglycan deposition (Alcian blue staining). (F) Induction of smooth-muscle-myogenic differentiation (7 days) assessed by expression of smooth muscle myosin heavy chain (MYH11) upon direct contact with ECFCs. ECFCs were identified by binding of rhodamine-conjugated UEA-1 (red). Cell nuclei were counterstained with DAPI (blue). Scale bars: 100 µm (A, C, and F) and 200 µm (E). Bars represent mean ± SEM (n = 3). * P < ** P <

9 Fig. S3. In vivo pro-vasculogenic properties of MSCs. watmscs and bmmscs with and without ECFCs were combined in Matrigel and the mixture subcutaneously injected into nude mice for 7 days. Microvessel density was determined as the number of total and human (ECFC-lined) blood vessels per unit of area in explants. Bars represent mean ± SEM (n = 4). 9

10 10

11 Fig. S4. Identification of transplanted human MSCs and ECFCs by flow cytometry. (A) Human MSCs were subcutaneously transplanted with ECFCs into nude mice. Grafts were explanted at day 7 and the retrieved cells analyzed by flow cytometry. Cells were identified as follows: nonhematopoietic cells (mcd45 - cells; R1 gate); human MSCs (mcd45 - /hcd90 + /hcd31 - cells; R2 gate); human ECFCs (mcd45 - /hcd90 - /hcd31 + cells; R3 gate); murine non-hematopoietic cells (mcd45 - /hcd90 - /hcd31 - cells; R4 gate); murine ECs (mcd45 - /mcd29 + /mcd31 + cells; R5 gate); and other murine stromal cells (mcd45 - /mcd29 + /mcd31 - cells; R6 gate). (B) Flow cytometry analysis of cells retrieved from grafts that were seeded with MSCs but without ECFCs. (C) Flow cytometry analysis of cells retrieved from grafts that were seeded with murine cells (m-watmscs + m-decs). (D) Flow cytometry analysis of cells retrieved from native murine subcutaneous white adipose tissue. (E-H) Cytometric quantification of cells retrieved from grafts at day 7: (E) human ECFCs; (F) human MSCs; (G) murine ECs; and (H) other murine stromal cells. Bars represent mean ± SEM (n = 4 mice per group). * P < 0.05, ** P < 0.01, and *** P <

12 Fig. S5. Magnetic-activated sorting of MSCs retrieved from subcutaneous grafts. (A) Human MSCs were subcutaneously transplanted with ECFCs into GFP-SCID mice. Grafts were explanted at day 7 and the retrieved cells sorted into hcd90 + and hcd90 - cells by magneticactivated cell sorting (MACS) using magnetic beads coated with anti-human CD90 antibodies. (B-D) Flow cytometry analysis of retrieved cells. Cells were identified as either murine (R1 gate) or human (R2) by virtue of GFP expression. Cytometric analyses were performed on: (B) nonsorted retrieved cells, (C) sorted hcd90 + cells, and (D) sorted hcd90 - cells. 12

13 Fig. S6. Identification of colonies formed by human MSCs retrieved from subcutaneous grafts. MSCs were subcutaneously transplanted with ECFCs into GFP-SCID mice. Engrafted MSCs were retrieved from explants (day 7) and selected as hcd90 + cells by MACS (see Fig. S4.). CFU-F activity of retrieved MSCs was tested at clonal density (500 cell/100 cm 2 ). Phase contrast microscopy (top) and immunofluorescence (bottom) was used to reveal the identity of the colonies formed. (A) Colonies formed by murine cells were identified as GFP + /UEA-1 - cells. (B) Colonies formed by human ECFCs were identified as GFP - /UEA-1 + cells. (C) Colonies formed by human MSCs were identified as GFP - /UEA-1 - cells and categorized into small, intermediate and large colonies. Scale bars: 50 µm. 13

14 Fig. S7. Engraftment and adipogenic differentiation of human MSCs in collagen-fibrin gels. (A) Human watmscs (1.2x10 6 cells) were subcutaneously transplanted into nude mice with or without ECFCs (8x10 5 cells) using collagen-fibrin gels. H&E staining revealed differential adipocyte abundance (28 days). Insets depict representative macroscopic views of the explants. (B) Histological quantification of adipocyte density in explants (28 days). Sections from native murine subcutaneous white adipose tissue (WAT) served as control. Scale bars: 200 µm (top panels), 50 µm (bottom panels), and 5 mm (insets). Bars represent mean ± SEM (n = 4 mice per group). ** P < 0.01 compared to grafts with MSCs alone. 14

15 Fig. S8. Expression of vimentin by human MSCs. (A) Immunofluorescent staining of human bmmscs and watmscs using an antibody against human vimentin (h-vimentin; red) and FITCphalloidin for F-actin (green). Murine dermal ECs (m-decs) and adipose tissue-derived MSCs (m-watmscs) served as negative control and did not express h-vimentin. (B) Fluorescent staining of sections taken from indicated murine tissues using an antibody against human vimentin (h-vimentin; green) and rhodamine-phalloidin for F-actin (red). (C) Fluorescent staining of tissue sections from human dermis using antibodies against human vimentin (h-vimentin; green) and UEA-1 (red). (D) Fluorescent staining of tissue sections from human subcutaneous adipose tissue using antibodies against human vimentin (h-vimentin; green) and perilipin-a (red). Cell nuclei were counterstained with DAPI (blue; A-D). Scale bars: 20 µm (A), 100 µm (B, C right panel, and D), and 200 µm (C left panel). 15

16 Fig. S9. Adipogenic differentiation of human MSCs in GFP-SCID mice. (A) Human MSCs (both bmmscs and watmscs) were subcutaneously transplanted into GFP-SCID mice with ECFCs. Grafts were explanted at day 28. (B) Immunohistochemical analysis of adipocytes in explanted grafts. Adipocytes were identified by expression of perilipin-a (red). Murine cells were identified by expression of GFP (green). Cell nuclei were counterstained with DAPI (blue). Dashed white lines mark the boundary between implants (right) and host tissue (left). White asterisks indicate human adipocytes. Yellow asterisks indicate host murine adipocytes. Scale bars: 200 µm (top panels) and 50 µm (bottom panels). 16

17 Fig. S10. PDGF-B mrna expression in ECFCs. ECFCs were transplanted into nude mice with watmscs, retrieved at day 7, and immediately sorted into hcd31 + and hcd31 - cells. (A) mrna expression of CD31 in both hcd31 + and hcd31 - cell fractions. (B) mrna expression of PDGF- B in both hcd31 + and hcd31 - cell fractions. mrna data are normalized to ribosomal 18S rrna abundance. (C) Comparison of PDGF-B expression level between ECFCs prior to implantation (in vitro) and ECFCs retrieved from the graft at day 7 (in vivo). mrna data are normalized to human β-actin (ACTB) expression. Bars represent mean ± SEM (n = 3). * P <

18 Fig. S11. In vivo inhibition of PDGFR signaling compromises MSC clonogenic and differentiation potential. MSC were implanted into GFP-SCID mice with ECFCs and with or without PDGFR inhibitor (AG1296) and then retrieved and selected as hcd90 + cells at day 7. (A) CFU-F activity of retrieved hcd90 + MSCs. (B) Quantitative CFU-F activity of retrieved MSCs from replicate grafts. (C) Ex vivo adipogenic and osteogenic differentiation potential of retrieved MSCs at clonal density (n = 16 clones per group). (D) Percentage of MSC clones with double differentiation potential. Bars represent mean ± SEM (n=3 mice per group). 18

19 Fig. S12. Effect of PDGFR inhibitor AG1296 on vascular network formation. (A) watmscs and (B) bmmscs were subcutaneously transplanted into nude mice with ECFCs and PDGFR inhibitor AG1296. BMP-2 was added to grafts seeded with bmmscs. Grafts were explanted at day 7 and analyzed histologically. H&E staining (left panels) revealed the presence of numerous blood vessels containing murine erythrocytes. Immunohistochemistry using antibodies against human CD31 (hcd31) revealed that most lumens were lined by human cells (right panels). Scale bars: 100 µm. 19

20 Fig. S13. Effect of AG1296 on MSC function. (A) Dose-dependent effect of AG1296 on watmsc proliferation assessed as fold increase in cell number after 48 h. (B) Proliferation of watmscs in basal medium upon stimulation with PDGF-BB (50 ng/ml) in the presence or absence of AG1296 (10 µm). (C) Non-treated and H2O2-treated (500 µm) watmscs were assessed for apoptosis by flow cytometry (annexin-v+) in the presence or absence of PDGF-BB (50 ng/ml), AG1296 (10 µm), and ECFC-CM. (D) Dose-dependent effect of AG1296 on adipogenic differentiation (10 days) assessed by intracellular accumulation of oil droplets (oil red O staining; top panels). Induction of osteogenic differentiation (21 days) assessed by calcium deposition (von Kossa staining; bottom panels). Insets depict watmscs under non-inducing conditions. Scale bars: 100 µm. Bars represent mean ± SEM (n = 3). * P < 0.05; ** P < 0.01; *** P <

21 Fig. S14. Effect of silencing PDGF-B expression in ECFCs. (A) Downregulation of PDGF-B mrna expression in ECFCs treated with three separate sirna constructs targeting PDGF-B. (B) Unaltered PDGF-A mrna expression in ECFCs treated with PDGF-B sirna. mrna values were measured by qrt-pcr and values were normalized to a control sirna. (C) watmscs were transplanted into nude mice with either ECFCs, ECFCs transfected with control sirna, or ECFCs transfected with PDGF-B sirna (construct #2; red bar). All sirna transfections were carried out on ECFCs 24 h prior to implantation. The number of viable MSCs was quantified at day 2 by flow cytometry in explanted grafts. Bars represent mean ± SEM (n = 2). 21

22 Fig. S15. Effect of PDGF-BB on long term differentiation of MSC. (A) watmscs were subcutaneously transplanted into nude mice with either ECFCs or 100 ng PDGF-BB. H&E staining revealed the presence of adipocyte at day 28. Immunohistochemical analysis of adipocytes in explanted grafts by expression of perilipin-a (red). Human MSC-derived cells were identified by expression of h-vimentin (green). Cell nuclei were counterstained with DAPI (blue). Yellow asterisks indicate human adipocytes. (B) bmmscs were subcutaneously transplanted into nude mice with either ECFCs or 100 ng PDGF-BB for 28 days. All grafts were stimulated with BMP-2 at day 7. Von kossa staining revealed calcium deposition at day 28. Immunohistochemical analysis of osteoblasts in explanted grafts by expression of osterix (red). Human MSC-derived cells were identified by expression of h-vimentin (green). Yellow arrowheads indicate human osteoblasts. White arrowheads indicate murine osteoblasts. Scale bars: 200 µm (top) and 50 µm (bottom). 22

23 Fig. S16. Dual perivascular and interstitial localization of engrafted MSCs. (A) watmscs were subcutaneously transplanted into nude mice in the presence or absence of ECFCs. Grafts were explanted at day 7 and analyzed histologically. Immunofluorescent staining of explanted grafts revealed dual perivascular and interstitial localization of donor MSCs. Human MSCs were identified by expression of h-vimentin (green). Perivascular cells were identified by expression of α-sma (red). Cell nuclei were counterstained with DAPI (blue). Yellow arrowheads indicate perivascular MSCs. White arrowheads indicate interstitial MSCs. Scale bars: 50 µm. (B) Quantification of perivascular/interstitial MSCs (ratio) in grafts explanted at day 7. Bars represent mean ± SEM (n = 3 mice per group). 23

24 Fig. S17. Ex vivo and in vivo expression of PDGFR-β by human MSCs. (A) Cytometric analysis revealed uniform ex vivo expression of PDGFR-β on cultured MSCs derived from both adipose tissue (watmscs) and bone marrow (bmmscs). Red and blue-lined histograms represent MSCs stained with fluorescent antibody against PDGFR-β. Isotype-matched controls are overlaid in solid grey histograms. (B) MSCs were subcutaneously transplanted with ECFCs into GFP-SCID mice. Grafts were explanted at day 7 and the retrieved cells analyzed by flow cytometry. watmscs were identified as GFP-/hCD31-/hCD90+ cells (left panel) and displayed a dichotomized expression of PDGFR-β (right panel). (C) MSCs were subcutaneously transplanted with ECFCs into GFP-SCID mice. Grafts were explanted at day 7 and the retrieved MSCs sorted into GFP-/hCD31-/hCD90+/PDGFR-β+ and GFP-/hCD31-/hCD90+/PDGFR-β- cells by FACS. (D) Phase microscopy (left panels) and immunofluorescent staining (right panels) of FACS-sorted MSCs revealed that PDGFR-β- MSCs acquired expression of PDGFR-β (green) in culture. Ex vivo culture time corresponded to either 3 h or 5 days post sorting. Cell nuclei were counterstained with DAPI (blue). Scale bars: 100 µm (phase) and 20 µm (immunofluorescence). 24