Supplementary Materials for
|
|
- Brittney Gibbs
- 6 years ago
- Views:
Transcription
1 Supplementary Materials for Genome-Wide RNAi Screen Reveals Disease-Associated Genes That Are Common to Hedgehog and Wnt Signaling Leni S. Jacob, Xiaofeng Wu, Michael E. Dodge, Chih-Wei Fan, Ozlem Kulak, Baozhi Chen, Wei Tang, Baolin Wang, James F. Amatruda, Lawrence Lum* *To whom correspondence should be addressed. Published 25 January 2011, Sci. Signal. 4, ra4 (2011) DOI: /scisignal This PDF file includes: Fig. S1. Additional material relating to the RNAi screen. Fig. S2. Confirmatory sirna assays for gene function in Hh pathway response. Fig. S3. Additional characterization of STK11 / cells. Fig. S4. Hh-induced Smo or Gli protein accumulation in the primary cilium is not affected in STK11 / cells. Fig. S5. Dvl phosphorylation is sensitive to IWP but not SAHA. Fig. S6. undergoes a change in distribution in response to Wnt protein stimulation in MEFs. Fig. S7. The defect in posterior morphogenesis and somite development is apparent in STK11 morphants stained for MyoD expression, which labels somitic tissue. Fig. S8. Loss of STK11 in cancerous cells induces Dvl protein phosphorylation and compromises primary cilia formation. Fig. S9. Cell line dependent responses to Wnt ligand in cervical carcinoma cells lacking Stk11. Fig. S10. Axin1 forms punctate structures in HeLa cells. Other Supplementary Material for this manuscript includes the following: (available at Table S1 (Microsoft Excel format). Dharmacon library primary screen results. Table S2 (Microsoft Excel format). Qiagen library primary screening results. Table S3 (Microsoft Excel format). Genes identified by two sirna pools from the primary screen. Table S4 (Microsoft Excel format). Counterscreen results. Table S5 (Microsoft Excel format). sirna sequences targeting disease genes.
2 Figure S1 A E G Assay Acetylated-tub Primary Screen Exogenous Hh Test DAPI NIH3T3-ShhFL; 72 hrs Light II cells; 72 hrs Wnt Assay NIH-3T3 cells; 72hrs Cross-Library Test Number of hits Plate column: Conditions Light II cells; 72 hrs H 8 9 Low High 10 Cell density Cutoffs Z (FL) < -2.0; SD < 0.10; Z (RL) < 2.5 FL < 75% control; SD < %< FL/RL <110% FL < 75% control; SD < H G B Genes that passed exogenous Hh test (x<0.75) F E A B C D Plate row 3T3-ShhFL cells ShhN FL FL ShhN FL RL RL ShhN DHARMACON Gli1 Gli2 191 Kif11 Mef2c Med14 F Qiagen screen Z score: Dharmacon screen Z score: Relative frequency Relative frequency QIAGEN 160 C D Ptch1 Gapdh Normalized Hh pathway response cyclop. (1μM): - + NIH-3T3 cells NIH-3T3 cells +ShhN CM 3T3-ShhFL cells 3T3-ShhFL cells Total sirna pools tested 351 Genes that do not effect Wnt response (0.9< x>1.10) Cross-Library Test Light II cells; 72 hrs (x<0.75) A15/JMJD2D CAR4 STK22B/TSSK2 GPRK2L/GRK4 RHOD MGI: /GIPC3 AAAS GATA6 GPR73 CSNK1G3
3 Figure S1. Additional material relating to the RNAi screen. A. NIH-3T3 cells form cilia under high-density conditions. B. A cell-autonomous signaling assay for Hh pathway response. NIH-3T3 cells were stably integrated with an Hh-responsive firefly luciferase (FL) reporter (GliBS reporter), a control reporter (Renilla luciferase; RL), and an expression construct encoding Shh to generate the 3T3-ShhFL cell line. C. 3T3-ShhFL cells exhibit faithful Hh transcriptional response. RT-PCR analysis of the Hh target gene Ptch1 in 3T3-ShhFL cells was compared with wild-type NIH-3T3 cells treated with or without ShhN conditioned medium. D. 3T3-ShhFL cells are responsive to cyclopamine. E. Criteria and conditions used to select genes of interest in the primary screen and various secondary screens. F. Frequency of Z score assignment to genes reveals a Gaussian-type distribution of results. G. Summary of hits identified from various well positions in 96 well plates from the primary screen without well-based normalization procedure. An edge effect is apparent from the skewed well distribution of hit frequenices. H. Genes identified from screening either the Dharmacon or Qiagen libraries that do not effect Wnt pathway response (62 total) were re-tested manually in 96 well plates avoiding wells on the edge of the plate using sirnas targeting the same gene from the other library. A total of 18 genes could not be re-tested given a corresponding sirna set was not arrayed in the library. Ten genes including several identified from the OMIM-based analysis were shown to induce similar effects on Hh pathway response. The improved ability to recover shared genes from both sirna libraries but not necessary known pathway components (Smo for example) under these testing conditions demonstrate the influence of sirna design and inherent noise in high-throughput screening platforms in genomescale RNAi studies. White boxes- genes that were tested; gray boxes - genes not tested because there is no corresponding gene in the other library; blue boxes- genes that have already been identified by 2 pools, thus not tested in the cross-library test.
4 Figure S2 Normalized Shh Pathway Response x sirnas 3x sirnas 1x-2x sirnas 100% response 75% response sirna: Prkar1a 1 Prkara1 2 Prkar1a 3 Prkar1a 4 Smo 1 Smo 2 Smo 3 Smo 4 Rlbp1 1 Rlbp1 2 Rlbp1 3 Rlbp1 4 Stk11 1 Stk11 2 Stk11 3 Stk11 4 Gpc1 1 Gpc1 2 Gpc1 3 Gpc1 4 Dgkq 1 Dgkq 2 Dgkq 3 Dgkq 4 IFT57 1 IFT57 2 IFT57 3 IFT57 4 Msx1 1 Msx1 2 Msx1 3 Msx1 4 Robo2 1 Robo2 2 Robo2 3 Robo2 4 Nphp3 1 Nphp3 2 Nphp3 3 Nphp3 4 Gli1 Pool Figure S2. Confirmatory sirna assays for gene function in Hh pathway response. Diseaseassociated genes identified in Fig. 1 were re-evaluated using non-redundant sirnas from each sirna pool. Gene function in Hh pathway response confirmed by only one or two sirnas was no longer considered. Data are represented as mean +/ SEM.
5 O Figure S3 A C Fold change in Gli3 mrna expression as compared with WT MEFs STK11-/- MEFs 1/50 dilution of cdna 1/500 dilution of cdna WT B SANT1 (hrs): SAG : Acetylated tubulin DAPI E N O WT O OH N H D Cell Titer Glo (RLU) Stk11-/- cells (doubling time=14hrs) Wt cells (doubling time=23hrs) Time (hrs): SAHA * Gli3R STK11-/- STK11-/- Gli3FL * Gli3R * Background band O O N N N MS-275 Tubacin Figure S3. Additional characterization of STK11 -/- cells. A. Wt and STK11 -/- MEFs express compa- rable levels of Gli3. A. PCR was performed from different concentrations of total cdna generated from RNA samples, analyzed, and compared to test reproducibility. Gli3 transcript abundance cells is normalized to GapDH. Values are given as the fold change between Stk11-/- cells and WT cells. Graph shows average and SD from 3 samples. B. Raw data for analysis of kinetics Gli3R formation following addition of SAG quantified in Fig. 2F. In this study wild-type and STK11-/- MEFs were treated overnight with SAG (Smo agonist) to inhibit Gli3R formation. SAG was then removed and SANT1 was added to allow Gli3R forma- tion. Lysate generated at various time points after SAG removal were analyzed by Western blot analysis for Gli3R protein then quantified as before. C. Additional images of primary cilia from WT and STK11-/- MEFs. White bars indicate length of the primary cilium. D. STK11-/- MEFs exhibit increased rate of doubling time as compared to WT MEFs. Cell number was measured using Cell Titer Glo assay that determines levels of ATP produced by cells. This experiment was performed in triplicate. E. Chemical structures of several classes of HDAC inhibitors. Tubacin and MS-275 exhibit selectivity for HDAC6 and HDAC1, respectively.
6 Figure S4 A Ac-tubulin Smo DAPI Merged Control CM WT ShhN CM Control CM STK11-/- ShhN CM B WT -Hh WT +Hh STK11-/- -Hh STK11-/- +Hh C 3.5 % Gli2 ciliary localization Hh CM: MEFs: WT STK11-/- cilia length (μm) measured using anti-smo antibody MEFs: WT STK11-/- Ac-tubulin Gli2 DAPI Figure S4. Hh-induced Smo or Gli protein accumulation in the primary cilium is not affected in STK11 -/- cells. A. Endogenous Smo protein and acetylated tubulin were detected by immunofluorescence. B. Gli2 protein localizes to the tip of the primary cilium in STK11-/- MEFs treated with Hh conditioned medium. C. Quantification of cilia length in MEFs using an anti-smo antibody.
7 Figure S5 A Wnt3A: CIP: Stk11 Actin Stk11 Actin B Tubacin SAHA MS-275 WT STK11-/- WT STK11-/- Ac-tub Actin STK11-/- WT C MEFs: Cmpd: WT STK11-/- - - D IWP IWP-control IWR Axin1 Axin1 IWP: Wnt3A CM: H460 cells + + Stk11 E F STK11-/- TOFA: - - MEFs: WT STK11-/- STK11 Actin Cmpd: PKA inhibitor (H89) Axin1 Figure S5. Dvl phosphorylation is sensitive to IWP but not SAHA. A. is phosphorylated in STK11-/- cells. Phosphatase treatment of cell lysates derived from STK11-/- cells confirms the slower migrating band recognized by the antibody as phosphorylated Dvl protein. CIP= calf intestinal phosphatase. B. Inhibition of HDAC6 does not alter Dvl protein phosphorylation. Tubacin and SAHA but not MS-275, an inhibitor HDAC1-3, induces accumulation of acetylated tubulin in agreement with their relative activity against HDAC6. C. The increased Dvl phosphorylation in STK11-/- cells is inhibited by IWP, but not IWR, an Axin protein stabilizer. In addition, an inactive form of IWP (IWP control) has no effect on Dvl phosphorylation. Abundance of Axin protein is used to monitor activity of IWR compound. Taken together, this data indicates that Dvl phosphorylation is dependent on production of Wnt. Data are representative of 3 experiments. D. The effects of IWP compound on phoshporylation can be blocked by addition of Wnt3A-containing conditioned medium (CM), consistent with the ability of IWP to inhibit Wnt protein production. E. The acetyl-coa (ACC) enzyme inhibitor TOFA mimics the effects of IWP on phosphorylation in wild-type and STK11-/- MEFs. Given the role of ACC in the production of palmitoyl-coa, a co-factor essential to Wnt protein production, this observation further supports previous conclusions that the IWP compounds to inhibit Wnt protein production. F. Inhibition of PKA does not block phosphorylation in STK11-/- cells. STK11-/- MEFs were treated with increasing concentration of the PKA inhibitor H89 up to 10μM. Axin1 serves as a loading control.
8 Figure S6 Control DNA Wnt3A DNA DAPI DVL2-GFP Embryonic fibroblasts Figure S6. undergoes a change in distribution in response to Wnt protein stimulation in M E Fs. White arrows: punctae.
9 Figure S7 Control MO STK11 MO MyoD Figure S7. The defect in posterior morphogenesis and somite development is apparent in STK11 morphants stained for MyoD expression, which labels somitic tissue. >25 embryos at 24 hrs post fertilization were analyzed in each group.
10 Figure S8 A Cell line: CRC cell Lung-derived cell lines line HBEC H23 H460 A549 H1819 DLD1 Compound: IWR1 IWP2 IWR1 IWP2 IWR1 IWP2 IWR1 IWP2 IWR1 IWP2 IWR1 IWP2 Stk11 Actin B Ac-tubulin; DAPI 14% HBEC 0% 0% A549 0% C Stk11 DNA Control DNA Ac-tubulin; DAPI 1% ± 0.5% 11% ± 2.5% Stk11: - + * 50 Stk11 A549 cells H1819 H460 A549 cells Figure S8. Loss of STK11 in cancerous cells induces Dvl protein phosphorylation and compro- mises primary cilia formation. A. NSCLC cell lines lacking Stk11 exhibit increased abundance of phosphorylated Dvl protein that can be lowered with IWP compound. Human bronchial epithelial cells (HBEC) and colorectal cancer cells (DLD-1) are controls. B. NSCLC cell lines with loss of STK11 do not elaborate primary cilia as compared to HBECs. C. Introduction of Stk11 DNA into A549 cells increased the percentage of cells with primary cilium. Cells were selected for 7 days prior to immunostaining with an anti-acetylated tubulin antibody.
11 Figure S9 IWR: IWP: Endo HeLa SiHa Lrp6-P Lrp6 Axin1 Axin2 Tnks1 Tnks2 Stk11 Actin Cervix-derived cell lines Figure S9. Cell line-dependent responses to Wnt ligand in cervical carcinoma cells lacking Stk11. Lysates from Endo, HeLa, or SiHa cells were Western blotted for various Wnt pathway components. As before, HeLa but not SiHa cells exhibit Wnt/β-catenin pathway response (measured by expression of Axin2) that is sensitive to the IWR and IWP compounds. In addition, HeLa cells exhibit phosphorylation of Lrp6, a receptor for mostly canonincal Wnt proteins. Dvl phosphorylation and Tankyrase (Tnks) protein levels are used to measure activity of IWP and IWR compounds, respectively. IWR compounds stabilize Axin proteins through the inhibition and stabilization of Tnks proteins, which facilitate Axin degradation.
12 Figure S10 Axin1-GFP HeLa cells Figure S10. Axin1 forms punctate structures in HeLa cells. In contrast to the diffuse localization of in HeLa cells, its binding partner Axin1 is found in puncate structures.
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Legends for Supplementary Tables. Supplementary Table 1. An excel file containing primary screen data. Worksheet 1, Normalized quantification data from a duplicated screen: valid
More informationThe microtubule-associated tau protein has intrinsic acetyltransferase activity. Todd J. Cohen, Dave Friedmann, Andrew W. Hwang, Ronen Marmorstein and
SUPPLEMENTARY INFORMATION: The microtubule-associated tau protein has intrinsic acetyltransferase activity Todd J. Cohen, Dave Friedmann, Andrew W. Hwang, Ronen Marmorstein and Virginia M.Y. Lee Cohen
More informationSureSilencing sirna Array Technology Overview
SureSilencing sirna Array Technology Overview Pathway-Focused sirna-based RNA Interference Topics to be Covered Who is SuperArray? Brief Introduction to RNA Interference Challenges Facing RNA Interference
More informationSupplementary Figure 1. Isolation of GFPHigh cells.
Supplementary Figure 1. Isolation of GFP High cells. (A) Schematic diagram of cell isolation based on Wnt signaling activity. Colorectal cancer (CRC) cell lines were stably transduced with lentivirus encoding
More informationβ-arrestin mediated localization of Smoothened to the primary cilium
Published as: Science. 2008 June 27; 320(5884): 1777 1781. β-arrestin mediated localization of Smoothened to the primary cilium Jeffrey J. Kovacs 1,2, Erin J. Whalen 1, Renshui Liu 1, Kunhong Xiao 3, Jihee
More informationCorrection: The Leukemia-Associated Mllt10/ Af10-Dot1l Are Tcf4/β-Catenin Coactivators Essential for Intestinal Homeostasis
CORRECTION Correction: The Leukemia-Associated Mllt10/ Af10-Dot1l Are Tcf4/β-Catenin Coactivators Essential for Intestinal Homeostasis Tokameh Mahmoudi, Sylvia F. Boj, Pantelis Hatzis, Vivian S. W. Li,
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Dynamic Phosphorylation of HP1 Regulates Mitotic Progression in Human Cells Supplementary Figures Supplementary Figure 1. NDR1 interacts with HP1. (a) Immunoprecipitation using
More informationsupplementary information
DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /
More informationSupplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1: Vector maps of TRMPV and TRMPVIR variants. Many derivatives of TRMPV have been generated and tested. Unless otherwise noted, experiments in this paper use
More informationSupplementary Table 1. The Q-PCR primer sequence is summarized in the following table.
Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of
More informationSupplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling
Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Glendining KA 1, Markie D 2, Gardner RJM 4, Franz EA 3, Robertson SP 4, Jasoni CL 1 Supplementary
More informationShort hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna
Supplemental Materials and Methods Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna (Mission shrna, Sigma) against mouse MMP14 were transfected into HEK293 cells using FuGene6
More informationSupplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate
Supplementary Figure Legends Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate BC041951 in gastric cancer. (A) The flow chart for selected candidate lncrnas in 660 up-regulated
More informationCenter Drive, University of Michigan Health System, Ann Arbor, MI
Leukotriene B 4 -induced reduction of SOCS1 is required for murine macrophage MyD88 expression and NFκB activation Carlos H. Serezani 1,3, Casey Lewis 1, Sonia Jancar 2 and Marc Peters-Golden 1,3 1 Division
More informationSupplementary Figure and Table Legends
1 Supplementary Figure and Table Legends Figure S1: Whole-animal metabolic analysis. 12 week old WT and Dvl1 / were singly housed in CLAMS cages (Comprehensive Laboratory Animals Monitoring System) for
More informationThe Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit
Cell Reports, Volume 5 Supplemental Information The Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit Andrey Poleshko, Katelyn M. Mansfield, Caroline
More informationDescription: Nuclear morphology and dynamics in nontargeting sirna transfected cells. HeLa Kyoto
Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Tables Title of file for HTML: Supplementary Movie 1 Description: Nuclear morphology and dynamics
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/1137999/dc1 Supporting Online Material for Disrupting the Pairing Between let-7 and Enhances Oncogenic Transformation Christine Mayr, Michael T. Hemann, David P. Bartel*
More informationTumor Growth Suppression Through the Activation of p21, a Cyclin-Dependent Kinase Inhibitor
Tumor Growth Suppression Through the Activation of p21, a Cyclin-Dependent Kinase Inhibitor Nicholas Love 11/28/01 A. What is p21? Introduction - p21 is a gene found on chromosome 6 at 6p21.2 - this gene
More informationab Hypoxic Response Human Flow Cytometry Kit
ab126585 Hypoxic Response Human Flow Cytometry Kit Instructions for Use For measuring protein levels by flow cytometry: hypoxia-inducible factor 1-alpha (HIF1A) and BCL2/adenovirus E1B 19 kda proteininteracting
More informationFigure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab.
/ 36B4 mrna ratio Figure S1 * 2. 1.6 1.2.8 *.4 control TNFα BRL49653 Figure S2 Su bw AT p iw Anti- (COOH-terminal peptide) Ab Blot : Anti-GST-(45-127) Ab β-actin Figure S3 HB2 HW AT BA T Figure S4 A TAG
More informationFigure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion
Stem Cell Reports, Volume 1 Supplemental Information Robust Self-Renewal of Rat Embryonic Stem Cells Requires Fine-Tuning of Glycogen Synthase Kinase-3 Inhibition Yaoyao Chen, Kathryn Blair, and Austin
More informationImmunofluorescence images of different core histones and different histone exchange assay.
Molecular Cell, Volume 51 Supplemental Information Enhanced Chromatin Dynamics by FACT Promotes Transcriptional Restart after UV-Induced DNA Damage Christoffel Dinant, Giannis Ampatziadis-Michailidis,
More informationINOS. Colorimetric Cell-Based ELISA Kit. Catalog #: OKAG00807
INOS Colorimetric Cell-Based ELISA Kit Catalog #: OKAG00807 Please read the provided manual entirely prior to use as suggested experimental protocols may have changed. Research Purposes Only. Not Intended
More informationNon-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit
Application Note 13 RNA Sample Preparation Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit B. Lam, PhD 1, P. Roberts, MSc 1 Y. Haj-Ahmad, M.Sc., Ph.D 1,2 1 Norgen
More informationThermo Scientific DharmaFECT Transfection Reagents sirna Transfection Protocol
Protocol Thermo Scientific Transfection Reagents sirna Transfection Protocol The following is a general protocol for use of Thermo Scientific transfection reagents to deliver sirna into cultured mammalian
More information7.06 Problem Set #3, Spring 2005
7.06 Problem Set #3, Spring 2005 1. The Drosophila compound eye is composed of about 800 units called ommatidia. Each ommatidium contains eight photoreceptor neurons (R1 through R8), which develop in a
More information2D gel Western blotting using antibodies against ubiquitin, SUMO and acetyl PTM
2D gel Western blotting using antibodies against ubiquitin, SUMO and acetyl PTM Nancy Kendrick, Jon Johansen & Matt Hoelter, Kendrick Labs Inc www.kendricklabs.com Talk Outline Significance Method description
More informationTransIT-TKO Transfection Reagent
Quick Reference Protocol, MSDS and Certificate of Analysis available at mirusbio.com/2150 INTRODUCTION TransIT-TKO is a broad spectrum sirna transfection reagent that enables high efficiency sirna delivery
More information7.06 Cell Biology EXAM #2 March 20, 2003
7.06 Cell Biology EXAM #2 March 20, 2003 This is an open book exam, and you are allowed access to books, a calculator, and notes but not computers or any other types of electronic devices. Please write
More informationComparison of Commercial Transfection Reagents: Cell line optimized transfection kits for in vitro cancer research.
Comparison of Commercial Transfection Reagents: Cell line optimized transfection kits for in vitro cancer research. by Altogen Labs, 11200 Manchaca Road, Suite 203 Austin TX 78748 USA Tel. (512) 433-6177
More informationSupplemental Table 1 Gene Symbol FDR corrected p-value PLOD1 CSRP2 PFKP ADFP ADM C10orf10 GPI LOX PLEKHA2 WIPF1
Supplemental Table 1 Gene Symbol FDR corrected p-value PLOD1 4.52E-18 PDK1 6.77E-18 CSRP2 4.42E-17 PFKP 1.23E-14 MSH2 3.79E-13 NARF_A 5.56E-13 ADFP 5.56E-13 FAM13A1 1.56E-12 FAM29A_A 1.22E-11 CA9 1.54E-11
More informationHCT116 SW48 Nutlin: p53
Figure S HCT6 SW8 Nutlin: - + - + p GAPDH Figure S. Nutlin- treatment induces p protein. HCT6 and SW8 cells were left untreated or treated for 8 hr with Nutlin- ( µm) to up-regulate p. Whole cell lysates
More informationSupplementary Information Design of small molecule-responsive micrornas based on structural requirements for Drosha processing
Supplementary Information Design of small molecule-responsive micrornas based on structural requirements for Drosha processing Chase L. Beisel, Yvonne Y. Chen, Stephanie J. Culler, Kevin G. Hoff, & Christina
More informationsirna Transfection Into Primary Neurons Using Fuse-It-siRNA
sirna Transfection Into Primary Neurons Using Fuse-It-siRNA This Application Note describes a protocol for sirna transfection into sensitive, primary cortical neurons using Fuse-It-siRNA. This innovative
More informationReal-Time PCR Workshop Gene Expression. Applications Absolute and Relative Quantitation
Real-Time PCR Workshop Gene Expression Applications Absolute and Relative Quantitation Absolute Quantitation Easy to understand the data, difficult to develop/qualify the standards Relative Quantitation
More informationCell culture and drug treatment. Lineage - Sca-1+ CD31+ EPCs were cultured on
Supplemental Material Detailed Methods Cell culture and drug treatment. Lineage - Sca-1+ CD31+ EPCs were cultured on 5µg/mL human fibronectin coated plates in DMEM supplemented with 10% FBS and penicillin/streptomycin
More informationConvoy TM Transfection Reagent
Convoy TM Transfection Reagent Catalog No.11103 0.25ml (40-80 transfections in 35mm dishes) Catalog No.11105 0.5 ml (80-165 transfections in 35mm dishes) Catalog No.11110 1.0 ml (165-330 transfections
More informationInt. J. Mol. Sci. 2016, 17, 1259; doi: /ijms
S1 of S5 Supplementary Materials: Fibroblast-Derived Extracellular Matrix Induces Chondrogenic Differentiation in Human Adipose-Derived Mesenchymal Stromal/Stem Cells in Vitro Kevin Dzobo, Taegyn Turnley,
More informationMSD Immuno-Dot-Blot Assays. A division of Meso Scale Diagnostics, LLC.
MSD Immuno-Dot-Blot Assays Example: High Throughput Western Blots Replacements Traditional Western Blots High content Molecular weight and immunoreactivity Labor and protein intensive Inherently low throughput
More informationTechnical Review. Real time PCR
Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously
More informationEGFR (Phospho-Ser695)
Assay Biotechnology Company www.assaybiotech.com Tel: 1-877-883-7988 Fax: 1-877-610-9758 EGFR (Phospho-Ser695) Colorimetric Cell-Based ELISA Kit Catalog #: OKAG02090 Please read the provided manual entirely
More informationPlasmid DNA transfection of SW480 human colorectal cancer cells with the Biontex K2 Transfection System
Plasmid DNA transfection of human colorectal cancer cells with the Biontex K2 Transfection System Stephanie Hehlgans and Franz Rödel, Department of Radiotherapy and Oncology, Goethe- University Frankfurt,
More informationChicken EpithelialGut CellLines 1
Chicken EpithelialGut CellLines 1 Content 01 Introduction p 3 02 Characterization p 5 03 Infection and inhibition p 6 04 Protein expression system p 8 05 NutriProof p 10 06 Contact p 12 01...which came
More informationLearning Objectives. Define RNA interference. Define basic terminology. Describe molecular mechanism. Define VSP and relevance
Learning Objectives Define RNA interference Define basic terminology Describe molecular mechanism Define VSP and relevance Describe role of RNAi in antigenic variation A Nobel Way to Regulate Gene Expression
More informationSupplementary Figure 1: MYCER protein expressed from the transgene can enhance
Relative luciferase activity Relative luciferase activity MYC is a critical target FBXW7 MYC Supplementary is a critical Figures target 1-7. FBXW7 Supplementary Material A E-box sequences 1 2 3 4 5 6 HSV-TK
More informationContents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution...
vii Contents Contents... vii List of Figures... xii List of Tables... xiv Abbreviatons... xv Summary... xvii 1. Introduction...1 1.1 In vitro evolution... 1 1.2 Phage Display Technology... 3 1.3 Cell surface
More informationConfocal immunofluorescence microscopy
Confocal immunofluorescence microscopy HL-6 and cells were cultured and cytospun onto glass slides. The cells were double immunofluorescence stained for Mt NPM1 and fibrillarin (nucleolar marker). Briefly,
More informationSupplementary Figures Montero et al._supplementary Figure 1
Montero et al_suppl. Info 1 Supplementary Figures Montero et al._supplementary Figure 1 Montero et al_suppl. Info 2 Supplementary Figure 1. Transcripts arising from the structurally conserved subtelomeres
More informationP HENIX. PHENIX PCR Enzyme Guide Tools For Life Science Discovery RESEARCH PRODUCTS
PHENIX PCR Enzyme Guide PHENIX offers a broad line of premium quality PCR Enzymes. This PCR Enzyme Guide will help simplify your polymerase selection process. Each DNA Polymerase has different characteristics
More informationIsolation, culture, and transfection of primary mammary epithelial organoids
Supplementary Experimental Procedures Isolation, culture, and transfection of primary mammary epithelial organoids Primary mammary epithelial organoids were prepared from 8-week-old CD1 mice (Charles River)
More informationBIOLOGY. Chapter 16 GenesExpression
BIOLOGY Chapter 16 GenesExpression CAMPBELL BIOLOGY TENTH EDITION Reece Urry Cain Wasserman Minorsky Jackson 18 Gene Expression 2014 Pearson Education, Inc. Figure 16.1 Differential Gene Expression results
More informationAutomated Imaging and Dual-Mask Analysis of γh2ax Foci to Determine DNA Damage on an Individual Cell Basis
A p p l i c a t i o n N o t e Automated Imaging and Dual-Mask Analysis of γh2ax Foci to Determine DNA Damage on an Individual Cell Basis Brad Larson, BioTek Instruments, Inc., Winooski, VT USA Asha Sinha
More informationGeneration of ips-derived model cells for analyses of hair shaft differentiation
Supplementary Material Generation of ips-derived model cells for analyses of hair shaft differentiation Takumi Kido, Tomoatsu Horigome, Minori Uda, Naoki Adachi, Yohei Hirai Department of Biomedical Chemistry,
More informationTechnical note: Molecular Index counting adjustment methods
Technical note: Molecular Index counting adjustment methods By Jue Fan, Jennifer Tsai, Eleen Shum Introduction. Overview of BD Precise assays BD Precise assays are fast, high-throughput, next-generation
More informationViral RNAi suppressor reversibly binds sirna to. outcompete Dicer and RISC via multiple-turnover
Supplementary Data Viral RNAi suppressor reversibly binds sirna to outcompete Dicer and RISC via multiple-turnover Renata A. Rawlings 1,2, Vishalakshi Krishnan 2 and Nils G. Walter 2 * 1 Biophysics and
More informationRegulation of Synaptic Structure and Function by FMRP- Associated MicroRNAs mir-125b and mir-132
Neuron, Volume 65 Regulation of Synaptic Structure and Function by FMRP- Associated MicroRNAs mir-125b and mir-132 Dieter Edbauer, Joel R. Neilson, Kelly A. Foster, Chi-Fong Wang, Daniel P. Seeburg, Matthew
More informationTransfection. How do you study and control gene expression? How do you detect mycoplasma contamination?
PROTEIN FUNCTION & ANALYSIS Transfection How do you study and control gene expression? How do you detect mycoplasma contamination? How do you ensure the success of your RNA or protein transfection? TRANSFECTION
More informationIn-Cell Western Kits I and II
Odyssey and Aerius Infrared Imaging Systems In-Cell Western Assay Kits I and II Published November, 2006. The most recent version of this protocol is posted at http://biosupport.licor.com/protocols.jsp
More informationChapter 18: Regulation of Gene Expression. 1. Gene Regulation in Bacteria 2. Gene Regulation in Eukaryotes 3. Gene Regulation & Cancer
Chapter 18: Regulation of Gene Expression 1. Gene Regulation in Bacteria 2. Gene Regulation in Eukaryotes 3. Gene Regulation & Cancer Gene Regulation Gene regulation refers to all aspects of controlling
More informationRayBio Human NF-κB p65 Transcription Factor Activity Assay Kit
RayBio Human NF-κB p65 Transcription Factor Activity Assay Kit Catalog #: TFEH-p65 User Manual Mar 13, 2017 3607 Parkway Lane, Suite 200 Norcross, GA 30092 Tel: 1-888-494-8555 (Toll Free) or 770-729-2992,
More informationSupplemental Materials. Matrix Proteases Contribute to Progression of Pelvic Organ Prolapse in Mice and Humans
Supplemental Materials Matrix Proteases Contribute to Progression of Pelvic Organ Prolapse in Mice and Humans Madhusudhan Budatha, Shayzreen Roshanravan, Qian Zheng, Cecilia Weislander, Shelby L. Chapman,
More informationMolecular Cell Biology - Problem Drill 11: Recombinant DNA
Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna
More informationReliable and sensitive RT-qPCR analysis of whole-blood RNA samples
APPLICATION NOTE SuperScript IV Reliable and sensitive RT-qPCR analysis of whole-blood RNA samples Introduction Most commercially available reverse transcription products do not perform well with difficult
More informationReverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami
Reverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami hanialhadrami@kau.edu.sa www.hanialhadrami.kau.edu.sa Overview Several techniques are available to detect and analyse RNA. Examples of these techniques
More informationAssessment of HDAC1 Inhibition Using an Automated, Bioluminescent Histone Deacetylase I/II Assay
A p p l i c a t i o n N o t e Assessment of HDAC1 Inhibition Using an Automated, Bioluminescent Histone Deacetylase I/II Assay Brad Larson, BioTek Instruments, Inc., Winooski, VT Tracy Worzella, Promega
More information3.1.4 DNA Microarray Technology
3.1.4 DNA Microarray Technology Scientists have discovered that one of the differences between healthy and cancer is which genes are turned on in each. Scientists can compare the gene expression patterns
More informationSOD1 as a Molecular Switch for Initiating the Homeostatic ER Stress Response under Zinc Deficiency
Molecular Cell, Volume 52 Supplemental Information SOD1 as a Molecular Switch for Initiating the Homeostatic ER Stress Response under Zinc Deficiency Kengo Homma, Takao Fujisawa, Naomi Tsuburaya, Namiko
More informationBronchial epithelium and its associated tissues act as a
The Journal of Immunology A JNK-Independent Signaling Pathway Regulates TNF -Stimulated, c-jun-driven FRA-1 Protooncogene Transcription in Pulmonary Epithelial Cells 1 Pavan Adiseshaiah,* Dhananjaya V.
More informationSupplementary Figure 1. Characterization of EVs (a) Phase-contrast electron microscopy was used to visualize resuspended EV pellets.
Supplementary Figure 1. Characterization of EVs (a) Phase-contrast electron microscopy was used to visualize resuspended EV pellets. Scale bar represent 100 nm. The sizes of EVs from MDA-MB-231-D3H1 (D3H1),
More informationbfgf Supports Human ES Cell Self- Renewal
APPLICATION NOTE Page 1 bfgf Supports Human ES Cell Self- Renewal Authors: Dongmei Wu, Wen Xiong, Yan Gao, Kristine Guerrero, Yi Chen, Liming Yang, Yang Liu, and Shuyuan Yao 1 Stemgent, Inc., 10575 Roselle
More informationSupplementary Information
Supplementary Information Supplementary Figure 1. ZBTB20 expression in the developing DRG. ZBTB20 expression in the developing DRG was detected by immunohistochemistry using anti-zbtb20 antibody 9A10 on
More informationHistone Analysis. Histone Analysis
Histone Analysis Histone Analysis innovative tools designed to help unravel the histone code Histone Antibodies Histone Purification Recombinant Histones Histone Modifying Enzymes Histone Modification
More informationHUMAN EMBRYONIC STEM CELL (hesc) ASSESSMENT BY REAL-TIME POLYMERASE CHAIN REACTION (PCR)
HUMAN EMBRYONIC STEM CELL (hesc) ASSESSMENT BY REAL-TIME POLYMERASE CHAIN REACTION (PCR) OBJECTIVE: is performed to analyze gene expression of human Embryonic Stem Cells (hescs) in culture. Real-Time PCR
More informationREAL TIME PCR USING SYBR GREEN
REAL TIME PCR USING SYBR GREEN 1 THE PROBLEM NEED TO QUANTITATE DIFFERENCES IN mrna EXPRESSION SMALL AMOUNTS OF mrna LASER CAPTURE SMALL AMOUNTS OF TISSUE PRIMARY CELLS PRECIOUS REAGENTS 2 THE PROBLEM
More informationToll Receptor-Mediated Hippo Signaling Controls Innate Immunity in Drosophila
Cell Supplemental Information Toll Receptor-Mediated Hippo Signaling Controls Innate Immunity in Drosophila Bo Liu, Yonggang Zheng, Feng Yin, Jianzhong Yu, Neal Silverman, and Duojia Pan Supplemental Experimental
More informationTitle: Production and characterisation of monoclonal antibodies against RAI3 and its expression in human breast cancer
Author's response to reviews Title: Production and characterisation of monoclonal antibodies against RAI3 and its expression in human breast cancer Authors: Hannah Jörißen (hannah.joerissen@molbiotech.rwth-aachen.de)
More informationRoche Molecular Biochemicals Technical Note No. LC 10/2000
Roche Molecular Biochemicals Technical Note No. LC 10/2000 LightCycler Overview of LightCycler Quantification Methods 1. General Introduction Introduction Content Definitions This Technical Note will introduce
More informationSupplemental Online Material. The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/-
#1074683s 1 Supplemental Online Material Materials and Methods Cell lines and tissue culture The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/- knock-out animals
More informationSupplemental Information. Lithocholic Acid Hydroxyamide Destabilizes. Cyclin D1 and Induces G 0 /G 1 Arrest by Inhibiting. Deubiquitinase USP2a
Cell Chemical Biology, Volume 24 Supplemental Information Lithocholic Acid Hydroxyamide Destabilizes Cyclin D1 and Induces G 0 /G 1 Arrest by Inhibiting Deubiquitinase USP2a Katarzyna Magiera, Marcin Tomala,
More informationRNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,
Materials and methods Oligonucleotides and DNA constructs RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by Dharmacon Inc. (Lafayette, CO). The sequences were: 122-2 OMe, 5
More informationmir-24-mediated down-regulation of H2AX suppresses DNA repair
Supplemental Online Material mir-24-mediated down-regulation of H2AX suppresses DNA repair in terminally differentiated blood cells Ashish Lal 1,4, Yunfeng Pan 2,4, Francisco Navarro 1,4, Derek M. Dykxhoorn
More informationIPA Advanced Training Course
IPA Advanced Training Course Academia Sinica 2015 Oct Gene( 陳冠文 ) Supervisor and IPA certified analyst 1 Review for Introductory Training course Searching Building a Pathway Editing a Pathway for Publication
More informationUniversity of Pennsylvania Perelman School of Medicine High Throughput Screening Core
University of Pennsylvania Perelman School of Medicine High Throughput Screening Core Sara Cherry, Ph. D. David C. Schultz, Ph. D. dschultz@mail.med.upenn.edu (215) 573 9641 67 John Morgan Building Mission
More informationSupplementary Figure 1 Activated B cells are subdivided into three groups
Supplementary Figure 1 Activated B cells are subdivided into three groups according to mitochondrial status (a) Flow cytometric analysis of mitochondrial status monitored by MitoTracker staining or differentiation
More informationSystem. Using the xcelligence System for Functional Genomics: Assessing Gene Function in Real Time. Application Note No.
System Application Note No. 11/January 2013 Using the xcelligence System for Functional Genomics: Assessing Gene Function in Real Time For life science research only. Not for use in diagnostic procedures.
More informationAP Biology Gene Expression/Biotechnology REVIEW
AP Biology Gene Expression/Biotechnology REVIEW Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Gene expression can be a. regulated before transcription.
More informationGM130 Is Required for Compartmental Organization of Dendritic Golgi Outposts
Current Biology, Volume 24 Supplemental Information GM130 Is Required for Compartmental Organization of Dendritic Golgi Outposts Wei Zhou, Jin Chang, Xin Wang, Masha G. Savelieff, Yinyin Zhao, Shanshan
More informationMethods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology -
Methods of Biomaterials Testing Lesson 3-5 Biochemical Methods - Molecular Biology - Chromosomes in the Cell Nucleus DNA in the Chromosome Deoxyribonucleic Acid (DNA) DNA has double-helix structure The
More informationThe MAP Kinase Family
The MAP Kinase Family Extracellular stimuli Classical MAP kinases Atypical MAP kinases MAPKKK MLK1/2/3/7; LZK RAF-1/A/B TAK1; TPL2 c-mos MEKK1-4; DLK ASK1/2; MLTK TAO1/2 ASK1 TAK1 MEKK1-4 MEKK2/3 TPL2???
More informationAscl2 Acts as an R-spondin/Wnt-Responsive Switch to Control Stemness in Intestinal Crypts
Cell Stem Cell Supplemental Information Ascl2 Acts as an R-spondin/Wnt-Responsive Switch to Control Stemness in Intestinal Crypts Jurian Schuijers, Jan Philipp Junker, Michal Mokry, Pantelis Hatzis, Bon-Kyoung
More informationA subclass of HSP70s regulate development and abiotic stress responses in Arabidopsis thaliana
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 Journal of Plant Research A subclass of HSP70s regulate development and abiotic stress responses in Arabidopsis thaliana Linna Leng 1 Qianqian Liang
More informationSupplementary Information. Title BRD3 and BRD4 BET Bromodomain Proteins Differentially Regulate Skeletal Myogenesis
Supplementary Information Title BRD3 and BRD4 BET Bromodomain Proteins Differentially Regulate Skeletal Myogenesis Authors Thomas C. Roberts 1,2, Usue Etxaniz 1, Alessandra Dall Agnese 1, Shwu-Yuan Wu
More informationMultiplex Fluorescence Assays for Adherence Cells without Trypsinization
Multiplex Fluorescence Assays for Adherence Cells without Trypsinization The combination of a bright field and three fluorescent channels allows the Celigo to perform many multiplexed assays. A gating
More informationSupplemental Information. Loss of MicroRNA-7 Regulation Leads. to a-synuclein Accumulation and. Dopaminergic Neuronal Loss In Vivo
YMTHE, Volume 25 Supplemental Information Loss of MicroRNA-7 Regulation Leads to a-synuclein Accumulation and Dopaminergic Neuronal Loss In Vivo Kirsty J. McMillan, Tracey K. Murray, Nora Bengoa-Vergniory,
More informationGalea GL et al, J Biol Chem Supplementary Figure 1
Galea GL et al, J Biol Chem Supplementary Figure 1 Supplementary Figure 1: Characterisation of long bone osteoblastic cells derived from mouse long bone diaphyses. A) clbobs treated with or without differentiation
More informationTropix Chemiluminescent Kits and Reagents For Cell Biology Applications
PRODUCT FAMILY BULLETIN Tropix Chemiluminescent Kits and Reagents Tropix Chemiluminescent Kits and Reagents For Cell Biology Applications Introduction to Chemiluminescence Chemiluminescence is the conversion
More informationThermo Scientific Dharmacon SMARTvector 2.0 Lentiviral shrna Particles
Thermo Scientific Dharmacon SMARTvector 2.0 Lentiviral shrna Particles Long-term gene silencing shrna-specific design algorithm High titer, purified particles Thermo Scientific Dharmacon SMARTvector shrna
More informationA 5 P degradation hot spot influences molecular farming of anticancerogenic nuclease TBN1 in tobacco cells
Plant Cell, Tissue and Organ Culture (PCTOC) A 5 P degradation hot spot influences molecular farming of anticancerogenic nuclease TBN1 in tobacco cells Anna Týcová a,b, Rajen J. J. Piernikarczyk c, Michael
More information