Supplementary Figure 1: MYCER protein expressed from the transgene can enhance

Size: px
Start display at page:

Download "Supplementary Figure 1: MYCER protein expressed from the transgene can enhance"

Transcription

1 Relative luciferase activity Relative luciferase activity MYC is a critical target FBXW7 MYC Supplementary is a critical Figures target 1-7. FBXW7 Supplementary Material A E-box sequences HSV-TK Luc+ B Relative MYC reporter activity in uninfected MCF10A cells 4 Relative MYC reporter activity in MYCER-infected MCF10A cells NT + 4OHT 0 NT + 4OHT Supplementary Figure 1: MYCER protein expressed from the transgene can enhance transcriptional activity. (A) A reporter plasmid containing 6 E-box sequences (CACGTG) followed Supplementary by a luciferase Figure 1. reporter MYCER was protein transfected expressed into from uninfected the transgene parental can MCF10A enhance or transcriptional activity. (A) A reporter plasmid containing 6 E-box sequences (CACGTG) MCF10A-MYCER cells and luminescence was measured 48 hr after transfection. (B) followed by a luciferase reporter was transfected into uninfected parental MCF10A or Luciferase activity from the reporter was normalized to Renilla luciferase activity. Each MCF10A-MYCER cells and luminescence was measured 48 hr after transfection. (B) experiment was done in triplicate and graphs show the average 3 biological replicates. Luciferase activity from the reporter was normalized to Renilla luciferase activity. Each Error experiment bars represent was done the in SEM. triplicate and graphs show the average 3 biological replicates. Error bars represent the SEM. 1

2 Asynchronous cells After double thymidine block 24h post release from DT block Supplementary Supplementary Figure Figure 2: 2. MCF10A-MYCER cells cells arrest arrest at the at G1/S the transition G1/S transition following following double double thymidine block. MCF10A-MYCER cells cells were were subjected subjected to two rounds to two rounds 2.5mM 2.5mM thymidine treatment, treatment, then fixed then and fixed stained and stained propidium iodide propidium flow cytometric iodide flow analysis. Compared to untreated asynchronous cells, thymidine treated cells showed cytometric analysis. Compared to untreated asynchronous cells, thymidine treated cells accumulation cells in M1+M2 (<2N DNA content). 24h after release, the cell cycle showed distribution accumulation returns to normal. cells in M1+M2 (<2N DNA content). 24h after release, the cell cycle distribution returns to normal. 2

3 MCF10A-MYCER TAM MCF10A-MYCER TAM -shrna +EtOH (MYC OFF) 50% GFP or RFP +4OHT (MYC ON) FACS analysis FACS analysis FACS analysis Supplementary Figure 3: Schematic fluorescence-based competition assay. Uninfected MCF10A-MYCER cells which express no fluorescent proteins are plated on the same plate MCF10A-MYCER cells infected a single shrna clone choice coexpressing GFP or RFP. At day 1, cells from the plate are subjected to live cell flow cytometry to verify ~50% fluorescence. Subsequently, the cells are split into control or 4OHT treated groups, and passaged every hr. At each passage or desired timepoint, remaining fluorescence on the plate is measured by flow cytometry the duration the experiment. Supplementary Figure 3. Schematic fluorescence-based competition assay. Uninfected MCF10A-MYCER cells which express no fluorescent proteins are plated on the same plate MCF10A-MYCER cells infected a single shrna clone choice co-expressing GFP or RFP. At day 1, cells from the plate are subjected to live cell flow cytometry to verify ~50% fluorescence. Subsequently, the cells are split into control or 4OHT treated groups, and passaged every hr. At each passage or desired timepoint, remaining fluorescence on the plate is measured by flow cytometry the duration the experiment. 3

4 WHOLE CELL EXTRACTS 4OHT MYCER c-jun Notch1 Cyclin E mtor βactin Supplementary Supplementary Figure 4. FBXW7 Figure 4: knockdown FBXW7 knockdown specifically leads specifically to stabilization leads to stabilization MYCER. MCF10A-MYCER MYCER. cells MCF10A-MYCER expressing either cells control expressing or FBXW7 either shrna control were or cultured FBXW7 in the shrna were presence cultured or absence in the 4OHT presence 4 or weeks. absence Whole 4OHT cell lysates 4 weeks. (80µg total Whole protein/lane) cell lysates were (80μg total run on SDS-PAGE protein/lane) and were subjected run on to SDS-PAGE Western blot and analysis subjected to major Western FBXW7 blot targets. analysis major Figure shows FBXW7 a representative targets. Figure image shows replicated a representative experiments. image replicated experiments. 4

5 Supplementary Figure 5. FBXW7 knockdown leads to preferential stabilization MYCER. MCF10A-MYCER cells stably expressing Dox-inducible shrna clones FBXW7 were treated or out 4OHT (MYC OFF or ON) 4 weeks, then cell lysates were analyzed by SDS-PAGE/Western blot. Bands were quantified using ImageQuant v5.2 (Molecular Dynamics) and normalized to loading controls. Figure shows averages from 3 independent biological replicates. Supplementary Figure 5: FBXW7 knockdown leads to preferential stabilization MYCER. MCF10A-MYCER cells stably expressing Dox-inducible shrna clones FBXW7 were treated or out 4OHT (MYC OFF or ON) 4 weeks, then cell lysates were analyzed by SDS-PAGE/Western blot. Bands were quantified using ImageQuant v5.2 (Molecular Dynamics) and normalized to loading controls. Figure shows averages from 3 independent biological replicates. 5

6 A B DNA DAMAGE APOPTOSIS 4OHT P-Chk2-72 4OHT Cleaved Caspase3-28 β actin Cleaved PARP1-95 P-H2AX -28 PUMA -28 HistoneH3 β actin Supplementary Figure 6: Long term FBXW7 knockdown and MYCER activation do not result in significant levels DNA damage or apoptosis. (A) Control or FBXW7 knockdown Supplementary cells Figure were 6. treated Long term FBXW7 or out knockdown 4OHT and MYCER 4 weeks activation and probed do not result the in significant levels DNA damage or apoptosis. (a) Control or FBXW7 knockdown cells presence were treated phosphorylated or out 4OHT Chk2 (in 4 weeks whole and cell probed lysate) or the H2AX presence (in chromatin-bound samples phosphorylated after fractionation) Chk2 (in whole as cell markers lysate) or H2AX checkpoint (in chromatin-bound activation/dna samples damage. after shfbxw7 fractionation) cells as did markers not show checkpoint a significant activation/dna accumulation damage. shfbxw7 either species cells did after not show long term treatment a significant accumulation 4OHT. (B) Similarly either species treated after cells long term were treatment probed 4OHT. the presence (b) Similarly treated cells were probed the presence apoptosis markers in whole cell lysates. apoptosis However, markers we failed in to whole detect any cell significant lysates. However, levels cleaved we failed caspase-3, to detect PARP1, any or significant PUMA in levels the surviving cleaved cells caspase-3, after 4 weeks PARP1, treatment. or PUMA Shown in above the surviving are representative cells after images 4 weeks 3 treatment. independent Shown replicates. above are representative images 3 independent replicates. 6

7 shcontrol shfbxw7-7 MYC OFF MYC ON Supplementary Figure 7: FBXW7 knockdown MYCER activation causes synergistic accumulation Supplementary Figure cells 7. in FBXW7 S and knockdown G2/M phase. MYCER MCF10A-MYCER activation causes cells synergistic stably expressing accumulation cells in S and G2/M phase. MCF10A-MYCER cells stably expressing control or FBXW7 shrna were cultured 4 weeks in the presence or absence control or FBXW7 shrna were cultured 4 weeks in the presence or absence 4OHT 4OHT (MYC OFF (MYC or ON). OFF Cells or ON). were fixed Cells and were stained fixed and propidium stained iodide propidium flow cytometric iodide flow cytometric analysis. Cells analysis. accumulate Cells in accumulate the M3+M4 region in the (<1N M3+M4 DNA content) region only (<1N in the DNA FBXW7 content) only in the knockdown FBXW7 and knockdown MYC ON condition. and MYC Shown ON is condition. a representative Shown image is a representative 3 independent image 3 independent replicates. replicates. 7

8 Supplementary Table 1: List top 78 synthetic lethal targets from MCF10A-MYCER screen. Results were filtered according to fold change (Log2 FC<-1) signal abundance between MYC ON and MYC OFF, and individually associated p-values (p<0.05). Only annotated target genes are shown. Candidates are ranked in order most depleted in the MYC ON population compared to MYC OFF (Log2 FC value). Rank Name p- value Log2 FC Acc. Number shrnai ID 1 ARL5B NM_ v2hs_ C2orf NM_ v2hs_ TTBK AB v2hs_ PSG NM_ v2hs_ NAT NM_ v2hs_ TRPM NM_ v2hs_ MFN NM_ v2hs_ C18orf NM_ v2hs_ DONSON NM_ v2hs_ ZNF NM_ v2hs_ H2AFV NM_ v2hs_ NUPL NM_ v2hs_ ZNF NM_ v2hs_ PSMD NM_ v2hs_ CDC14B NM_ v2hs_ UGT1A NM_ v2hs_ SOX NM_ v2hs_ NUPL NM_ v2hs_ ANKRD NM_ v2hs_ EPHA NM_ v2hs_ ST8SIA NM_ v2hs_ SLC44A NM_ v2hs_ SH3BP NM_ v2hs_ KIAA AB v2hs_ DMKN NM_ v2hs_ STK17A NM_ v2hs_ PHF21A NM_ v2hs_ EYA NM_ v2hs_ C6orf XM_ v2hs_ ZFYVE NM_ v2hs_ LRCH NM_ v2hs_ NR2E NM_ v2hs_ TOP3B NM_ v2hs_ WDSOF NM_ v2hs_ CLDN NM_ v2hs_ CMTM NM_ v2hs_ IRAK NM_ v2hs_

9 38 APOBEC3A NM_ v2hs_ ERGIC NM_ v2hs_ PARP NM_ v2hs_ RAE NM_ v2hs_ LEPREL NM_ v2hs_ ZNF NM_ v2hs_ SLC7A NM_ v2hs_ LAMA NM_ v2hs_ LOC XM_ v2hs_ ATP1B1P NG_ v2hs_ C1orf NM_ v2hs_ KRIT NM_ v2hs_ ASAH NM_ v2hs_ OLFR AJ v2hs_ CCDC NM_ v2hs_ TOP3A NM_ v2hs_ MATK NM_ v2hs_ ST NM_ v2hs_ KIAA AB v2hs_ PERP NM_ v2hs_ FBXW AY v2hs_ APOA NM_ v2hs_ C NM_ v2hs_ SLC36A NM_ v2hs_ PPP3CC NM_ v2hs_ TRIM NM_ v2hs_ ELL NM_ v2hs_ PRMT NM_ v2hs_ PRSS NM_ v2hs_ UBE2I NM_ v2hs_ QRSL XM_ v2hs_ C11orf NM_ v2hs_ EPYC NM_ v2hs_ TNFAIP NM_ v2hs_ PAQR NM_ v2hs_ PREB NM_ v2hs_ CEND NM_ v2hs_ BBOX NM_ v2hs_ CDKL NM_ v2hs_ CMTM NM_ v2hs_ GCN1L XM_ v2hs_

Supplementary Fig. 1. Schematic structure of TRAIP and RAP80. The prey line below TRAIP indicates bait and the two lines above RAP80 highlight the

Supplementary Fig. 1. Schematic structure of TRAIP and RAP80. The prey line below TRAIP indicates bait and the two lines above RAP80 highlight the Supplementary Fig. 1. Schematic structure of TRAIP and RAP80. The prey line below TRAIP indicates bait and the two lines above RAP80 highlight the prey clones identified in the yeast two hybrid screen.

More information

Primers used for PCR of conductin, SGK1 and GAPDH have been described in (Dehner et al,

Primers used for PCR of conductin, SGK1 and GAPDH have been described in (Dehner et al, Supplementary METHODS Flow Cytometry (FACS) For FACS analysis, trypsinized cells were fixed in ethanol, rehydrated in PBS and treated with 40μg/ml propidium iodide and 10μ/ml RNase for 30 min at room temperature.

More information

Supplementary Fig. 1 Proteomic analysis of ATR-interacting proteins. ATR, ARID1A and

Supplementary Fig. 1 Proteomic analysis of ATR-interacting proteins. ATR, ARID1A and Supplementary Figure Legend: Supplementary Fig. 1 Proteomic analysis of ATR-interacting proteins. ATR, ARID1A and ATRIP protein peptides identified from our mass spectrum analysis were shown. Supplementary

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Supplementary Figure 1: Vector maps of TRMPV and TRMPVIR variants. Many derivatives of TRMPV have been generated and tested. Unless otherwise noted, experiments in this paper use

More information

Supplementary Material

Supplementary Material Supplementary Material Supplementary Methods Cell synchronization. For synchronized cell growth, thymidine was added to 30% confluent U2OS cells to a final concentration of 2.5mM. Cells were incubated

More information

File name: Supplementary Information Description: Supplementary figures and supplementary tables. File name: Peer review file Description:

File name: Supplementary Information Description: Supplementary figures and supplementary tables. File name: Peer review file Description: File name: Supplementary Information Description: Supplementary figures and supplementary tables. File name: Peer review file Description: Supplementary Figure 1. dcas9-mq1 fusion protein induces de novo

More information

Supplementary Figure 1. Nature Structural & Molecular Biology: doi: /nsmb.3494

Supplementary Figure 1. Nature Structural & Molecular Biology: doi: /nsmb.3494 Supplementary Figure 1 Pol structure-function analysis (a) Inactivating polymerase and helicase mutations do not alter the stability of Pol. Flag epitopes were introduced using CRISPR/Cas9 gene targeting

More information

Supplementary Figure 1. Additional RNAi screen data

Supplementary Figure 1. Additional RNAi screen data Supplementary Figure 1. Additional RNAi screen data A. Cisplatin induced ATR autophosphorylation. Western blot illustrating ATR and phospho-atr (T1989) in cells exposed to 1 µm cisplatin for 24 hours prior

More information

Supplementary Figure 1. Intracellular distribution of the EPE peptide. HeLa cells were serum-starved (16 h, 0.1%), and treated with EPE peptide,

Supplementary Figure 1. Intracellular distribution of the EPE peptide. HeLa cells were serum-starved (16 h, 0.1%), and treated with EPE peptide, Supplementary Figure 1. Intracellular distribution of the EPE peptide. HeLa cells were serum-starved (16 h, 0.1%), and treated with EPE peptide, conjugated with either TAT or Myristic acid and biotin for

More information

Supplementary Figure 1 (related to Figure 1) a. SVEC cells stably expressing egfp tbid 2A BCL xl were analysed by Western blot for expression of egfp

Supplementary Figure 1 (related to Figure 1) a. SVEC cells stably expressing egfp tbid 2A BCL xl were analysed by Western blot for expression of egfp Supplementary Figure 1 (related to Figure 1) a. SVEC cells stably expressing egfp tbid 2A BCL xl were analysed by Western blot for expression of egfp tbid and BCL xl. TOM20 was used as a loading control.

More information

Supplementary Figure 1: Overexpression of EBV-encoded proteins Western blot analysis of the expression levels of EBV-encoded latency III proteins in

Supplementary Figure 1: Overexpression of EBV-encoded proteins Western blot analysis of the expression levels of EBV-encoded latency III proteins in Supplementary Figure 1: Overexpression of EBV-encoded proteins Western blot analysis of the expression levels of EBV-encoded latency III proteins in BL2 cells. The Ponceau S staining of the membranes or

More information

Emanuela Tumini, Sonia Barroso, Carmen Pérez Calero and Andrés Aguilera

Emanuela Tumini, Sonia Barroso, Carmen Pérez Calero and Andrés Aguilera SUPPLEMENTARY INFORMATION Roles of human POLD1 and POLD3 in genome stability Emanuela Tumini, Sonia Barroso, Carmen Pérez Calero and Andrés Aguilera SUPPLEMENTARY METHODS Cell proliferation After sirna

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2579 Figure S1 Incorporation of heavy isotope-labeled amino acids and enrichment of di-glycine modified peptides. The incorporation of isotopelabeled amino acids in peptides was calculated

More information

Coleman et al., Supplementary Figure 1

Coleman et al., Supplementary Figure 1 Coleman et al., Supplementary Figure 1 BrdU Merge G1 Early S Mid S Supplementary Figure 1. Sequential destruction of CRL4 Cdt2 targets during the G1/S transition. HCT116 cells were synchronized by sequential

More information

3 P p25. p43 p41 28 FADD. cflips. PE-Cy5 [Fluorescence intensity]

3 P p25. p43 p41 28 FADD. cflips. PE-Cy5 [Fluorescence intensity] L S p4 3 D3 76 N S L Ve ct or p4 3 D3 76 N S L Ve ct or A aspase 8 FADD TRAF2 D95-R - + Vector D95L TL I S L D376N T RAIL-R1 T RAIL-R2 D95-R E-y5 [Fluorescence intensity] Supplemental Fig. 1 Different

More information

Supplementary Figure 1. Expressions of stem cell markers decreased in TRCs on 2D plastic. TRCs were cultured on plastic for 1, 3, 5, or 7 days,

Supplementary Figure 1. Expressions of stem cell markers decreased in TRCs on 2D plastic. TRCs were cultured on plastic for 1, 3, 5, or 7 days, Supplementary Figure 1. Expressions of stem cell markers decreased in TRCs on 2D plastic. TRCs were cultured on plastic for 1, 3, 5, or 7 days, respectively, and their mrnas were quantified by real time

More information

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Analyses of ECTRs by C-circle and T-circle assays.

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Analyses of ECTRs by C-circle and T-circle assays. Supplementary Figure 1 Analyses of ECTRs by C-circle and T-circle assays. (a) C-circle and (b) T-circle amplification reactions using genomic DNA from different cell lines in the presence (+) or absence

More information

Fig. S1 TGF RI inhibitor SB effectively blocks phosphorylation of Smad2 induced by TGF. FET cells were treated with TGF in the presence of

Fig. S1 TGF RI inhibitor SB effectively blocks phosphorylation of Smad2 induced by TGF. FET cells were treated with TGF in the presence of Fig. S1 TGF RI inhibitor SB525334 effectively blocks phosphorylation of Smad2 induced by TGF. FET cells were treated with TGF in the presence of different concentrations of SB525334. Cells were lysed and

More information

Supplemental Material

Supplemental Material Supplemental Material Figure S1.(A) Immuno-staining of freshly isolated Myf5-Cre:ROSA-YFP fiber (B) Satellite cell enumeration in WT and cko mice from resting hind limb muscles. Bulk hind limb muscles

More information

Supplementary Figure 1. TRIM9 does not affect AP-1, NF-AT or ISRE activity. (a,b) At 24h post-transfection with TRIM9 or vector and indicated

Supplementary Figure 1. TRIM9 does not affect AP-1, NF-AT or ISRE activity. (a,b) At 24h post-transfection with TRIM9 or vector and indicated Supplementary Figure 1. TRIM9 does not affect AP-1, NF-AT or ISRE activity. (a,b) At 24h post-transfection with TRIM9 or vector and indicated reporter luciferase constructs, HEK293T cells were stimulated

More information

TRIM31 is recruited to mitochondria after infection with SeV.

TRIM31 is recruited to mitochondria after infection with SeV. Supplementary Figure 1 TRIM31 is recruited to mitochondria after infection with SeV. (a) Confocal microscopy of TRIM31-GFP transfected into HEK293T cells for 24 h followed with SeV infection for 6 h. MitoTracker

More information

Pre-made Reporter Lentivirus for p53 Signal Pathway

Pre-made Reporter Lentivirus for p53 Signal Pathway Pre-made Reporter for p53 Signal Pathway Cat# Product Name Amounts LVP977-P or: LVP977-P-PBS P53-GFP (Puro) LVP978-P or: LVP978-P-PBS P53-RFP (Puro) LVP979-P or: LVP979-P-PBS P53-Luc (Puro) LVP980-P or:

More information

Supplementary Information

Supplementary Information Supplementary Information Sam68 modulates the promoter specificity of NF-κB and mediates expression of CD25 in activated T cells Kai Fu 1, 6, Xin Sun 1, 6, Wenxin Zheng 1, 6, Eric M. Wier 1, Andrea Hodgson

More information

SUPPLEMENTARY FIGURES

SUPPLEMENTARY FIGURES SUPPLEMENTARY FIGURES Supplementary Figure 1. EndoC-βH1 cells were either mock-tranfected (control) or transfected with PolyI:C and analyzed 24 hours later. (A, B) Heatmap from global transcriptomic analysis

More information

DOI: 10.1038/ncb3259 A Ismail et al. Supplementary Figure 1 B 60000 45000 SSC 30000 15000 Live cells 0 0 15000 30000 45000 60000 FSC- PARR 60000 45000 PARR Width 30000 FSC- 15000 Single cells 0 0 15000

More information

Supplementary Information. ATM and MET kinases are synthetic lethal with. non-genotoxic activation of p53

Supplementary Information. ATM and MET kinases are synthetic lethal with. non-genotoxic activation of p53 Supplementary Information ATM and MET kinases are synthetic lethal with non-genotoxic activation of p53 Kelly D. Sullivan 1, Nuria Padilla-Just 1, Ryan E. Henry 1, Christopher C. Porter 2, Jihye Kim 3,

More information

Fig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.

Fig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG. Fig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.SCUBE2, E-cadherin.Myc, or HA.p120-catenin was transfected in a combination

More information

ASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG

ASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG Supplemental Materials and Methods Plasmids: the following plasmids were used in the supplementary data: pwzl-myc- Lats2 (Aylon et al, 2006), pretrosuper-vector and pretrosuper-shp53 (generous gift of

More information

Supplementary Materials

Supplementary Materials Supplementary Materials Construction of Synthetic Nucleoli in Human Cells Reveals How a Major Functional Nuclear Domain is Formed and Propagated Through Cell Divisision Authors: Alice Grob, Christine Colleran

More information

Chromatin immunoprecipitation (ChIP) ES and FACS-sorted GFP+/Flk1+ cells were fixed in 1% formaldehyde and sonicated until fragments of an average

Chromatin immunoprecipitation (ChIP) ES and FACS-sorted GFP+/Flk1+ cells were fixed in 1% formaldehyde and sonicated until fragments of an average Chromatin immunoprecipitation (ChIP) ES and FACS-sorted cells were fixed in % formaldehyde and sonicated until fragments of an average size of 5 bp were obtained. Soluble, sheared chromatin was diluted

More information

Supplementary Figure 1. GST pull-down analysis of the interaction of GST-cIAP1 (A, B), GSTcIAP1

Supplementary Figure 1. GST pull-down analysis of the interaction of GST-cIAP1 (A, B), GSTcIAP1 Legends Supplementary Figure 1. GST pull-down analysis of the interaction of GST- (A, B), GST mutants (B) or GST- (C) with indicated proteins. A, B, Cell lysate from untransfected HeLa cells were loaded

More information

Sarker et al. Supplementary Material. Subcellular Fractionation

Sarker et al. Supplementary Material. Subcellular Fractionation Supplementary Material Subcellular Fractionation Transfected 293T cells were harvested with phosphate buffered saline (PBS) and centrifuged at 2000 rpm (500g) for 3 min. The pellet was washed, re-centrifuged

More information

Supplementary Figure 1 Phosphorylated tau accumulates in Nrf2 (-/-) mice. Hippocampal tissues obtained from Nrf2 (-/-) (10 months old, 4 male; 2

Supplementary Figure 1 Phosphorylated tau accumulates in Nrf2 (-/-) mice. Hippocampal tissues obtained from Nrf2 (-/-) (10 months old, 4 male; 2 Supplementary Figure 1 Phosphorylated tau accumulates in Nrf2 (-/-) mice. Hippocampal tissues obtained from Nrf2 (-/-) (10 months old, 4 male; 2 female) or wild-type (5 months old, 1 male; 11 months old,

More information

SUPPLEMENTAL EXPERIMENTAL PROCEDURES

SUPPLEMENTAL EXPERIMENTAL PROCEDURES SUPPLEMENTAL EXPERIMENTAL PROCEDURES Luciferase Assays Cells were seeded on 24well plates and grown to 7% confluency. Cells were then transfected with ng of reporter constructs and 1 ng of the renilla

More information

Breast cell lines with Combination Index (CI) and p53 mutation status

Breast cell lines with Combination Index (CI) and p53 mutation status Supplementary Table 1 Breast cell lines with Combination Index (CI) and p53 mutation status Cell Line CI p53 status a BT20 0.44 K132Q BT549 0.53 R249S CAL120 0.61 c.672+2t>g CAL51 0.73 wild-type CAMA1

More information

Supplementary Information

Supplementary Information Supplementary Information Supplementary Figure 1: Over-expression of CD300f in NIH3T3 cells enhances their capacity to phagocytize AC. (a) NIH3T3 cells were stably transduced by EV, CD300f WT or CD300f

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/8/362/ra12/dc1 Supplementary Materials for FOXP1 potentiates Wnt/β-catenin signaling in diffuse large B cell lymphoma Matthew P. Walker, Charles M. Stopford, Maria

More information

Regulation of transcription by the MLL2 complex and MLL complex-associated AKAP95

Regulation of transcription by the MLL2 complex and MLL complex-associated AKAP95 Supplementary Information Regulation of transcription by the complex and MLL complex-associated Hao Jiang, Xiangdong Lu, Miho Shimada, Yali Dou, Zhanyun Tang, and Robert G. Roeder Input HeLa NE IP lot:

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb3209 Supplementary Figure 1 IR induces the association of FH with chromatin. a, U2OS cells synchronized by thymidine double block (2 mm) underwent no release (G1 phase) or release for 2

More information

Supplementary Figure 1, Wiel et al

Supplementary Figure 1, Wiel et al Supplementary Figure 1, Wiel et al Supplementary Figure 1 ITPR2 increases in benign tumors and decreases in aggressive ones (a-b) According to the Oncomine database, expression of ITPR2 increases in renal

More information

Total RNA was isolated using Trizol reagent (Invitrogen) and reverse transcribed using

Total RNA was isolated using Trizol reagent (Invitrogen) and reverse transcribed using Supplementary Methods RNA Isolation and Quantitative RT-PCR Total RNA was isolated using Trizol reagent (Invitrogen) and reverse transcribed using random hexamers and superscript II reverse transcriptase

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature09732 Supplementary Figure 1: Depletion of Fbw7 results in elevated Mcl-1 abundance. a, Total thymocytes from 8-wk-old Lck-Cre/Fbw7 +/fl (Control) or Lck-Cre/Fbw7 fl/fl (Fbw7 KO) mice

More information

Supplementary Table 1. Sequences for BTG2 and BRCA1 sirnas.

Supplementary Table 1. Sequences for BTG2 and BRCA1 sirnas. Supplementary Table 1. Sequences for BTG2 and BRCA1 sirnas. Target Gene Non-target / Control BTG2 BRCA1 NFE2L2 Target Sequence ON-TARGET plus Non-targeting sirna # 1 (Cat# D-001810-01-05) sirna1: GAACCGACAUGCUCCCGGA

More information

Supplementary Methods

Supplementary Methods Supplementary Methods Microarray Data Analysis Gene expression data were obtained by hybridising a total of 24 samples from 6 experimental groups (n=4 per group) to Illumina HumanHT-12 Expression BeadChips.

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Han et al., http://www.jcb.org/cgi/content/full/jcb.201311007/dc1 Figure S1. SIVA1 interacts with PCNA. (A) HEK293T cells were transiently

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:.38/nature899 Supplementary Figure Suzuki et al. a c p7 -/- / WT ratio (+)/(-) p7 -/- / WT ratio Log X 3. Fold change by treatment ( (+)/(-)) Log X.5 3-3. -. b Fold change by treatment ( (+)/(-)) 8

More information

Supplementary information

Supplementary information Supplementary information Supplementary Figure 1 (a) EM image of the pyramidal layer of wt mice. CA3 pyramidal neurons were selected according to their typical alignment, size and shape for subsequent

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION (Supplementary Methods and Materials) GST pull-down assay GST-fusion proteins Fe65 365-533, and Fe65 538-700 were expressed in BL21 bacterial cells and purified with glutathione-agarose beads (Sigma).

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Supplementary Figure 1. Activation capacity of tettale-ad compared to tet trans-activator (ttas) using different teto variants. (A) HeLa cells were co-transfected with activation

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 1.1/ncb2918 Supplementary Figure 1 (a) Biotin-dUTP labelling does not affect S phase progression. Cells synchronized in mid-s phase were labelled with biotindutp during a 5 min hypotonic shift (red)

More information

Nature Biotechnology: doi: /nbt Supplementary Figure 1

Nature Biotechnology: doi: /nbt Supplementary Figure 1 Supplementary Figure 1 Generation of the AARE-Gene system construct. (a) Position and sequence alignment of AAREs extracted from human Trb3, Chop or Atf3 promoters. AARE core sequences are boxed in grey.

More information

Supplementary Information (Aoki, K. et al., "Chromosomal instability by β-catenin/tcf transcription in APC or β-catenin mutant cells")

Supplementary Information (Aoki, K. et al., Chromosomal instability by β-catenin/tcf transcription in APC or β-catenin mutant cells) Supplementary Information (Aoki, K. et al., "Chromosomal instability by β-catenin/tcf transcription in APC or β-catenin mutant cells") Supplementary materials and methods ES cells and Mice The floxed β-catenin

More information

Supplementary Figure S1

Supplementary Figure S1 Supplementary Figure S1 Luciferase ctivity (%) 5 4 3 2 1 HeLa E2 OHT Figure S1. SENP2 represses estradiol-dependent transcriptional activity in HeLa cells. HeLa cells were transiently transfected with

More information

Supplementary Figure 1. Localization of MST1 in RPE cells. Proliferating or ciliated HA- MST1 expressing RPE cells (see Fig. 5b for establishment of

Supplementary Figure 1. Localization of MST1 in RPE cells. Proliferating or ciliated HA- MST1 expressing RPE cells (see Fig. 5b for establishment of Supplementary Figure 1. Localization of MST1 in RPE cells. Proliferating or ciliated HA- MST1 expressing RPE cells (see Fig. 5b for establishment of the cell line) were immunostained for HA, acetylated

More information

A RRM1 H2AX DAPI. RRM1 H2AX DAPI Merge. Cont. sirna RRM1

A RRM1 H2AX DAPI. RRM1 H2AX DAPI Merge. Cont. sirna RRM1 A H2AX DAPI H2AX DAPI Merge Cont sirna Figure S1: Accumulation of RRM1 at DNA damage sites (A) HeLa cells were subjected to in situ detergent extraction without IR irradiation, and immunostained with the

More information

Genetic screening for synthetic lethal partners of polynucleotide kinase/phosphatase: potential for targeting SHP-1 depleted cancers

Genetic screening for synthetic lethal partners of polynucleotide kinase/phosphatase: potential for targeting SHP-1 depleted cancers Genetic screening for synthetic lethal partners of polynucleotide kinase/phosphatase: potential for targeting SHP-1 depleted cancers T.R. Mereniuk et al. Supplemental tlmt Material: il Supplemental l Figures

More information

Arrest-In Transfection Reagent Catalog numbers: ATR1740, ATR1741, ATR1742, ATR1743

Arrest-In Transfection Reagent Catalog numbers: ATR1740, ATR1741, ATR1742, ATR1743 Arrest-In Transfection Reagent Catalog numbers: ATR1740, ATR1741, ATR1742, ATR1743 Technical support: 1-888-412-2225 Page 1 Arrest-In Transfection Reagent Catalog numbers: ATR1740, ATR1741, ATR1742, ATR1743

More information

Mammosphere formation assay. Mammosphere culture was performed as previously described (13,

Mammosphere formation assay. Mammosphere culture was performed as previously described (13, Supplemental Text Materials and Methods Mammosphere formation assay. Mammosphere culture was performed as previously described (13, 17). For co-culture with fibroblasts and treatment with CM or CCL2, fibroblasts

More information

IKK is a therapeutic target in KRAS-induced lung cancer with disrupted p53 activity

IKK is a therapeutic target in KRAS-induced lung cancer with disrupted p53 activity IKK is a therapeutic target in KRAS-induced lung cancer with disrupted p5 activity H6 5 5 H58 A59 H6 H58 A59 anti-ikkα anti-ikkβ anti-panras anti-gapdh anti-ikkα anti-ikkβ anti-panras anti-gapdh anti-ikkα

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Legends for Supplementary Tables. Supplementary Table 1. An excel file containing primary screen data. Worksheet 1, Normalized quantification data from a duplicated screen: valid

More information

Supplemental Table 1 Gene Symbol FDR corrected p-value PLOD1 CSRP2 PFKP ADFP ADM C10orf10 GPI LOX PLEKHA2 WIPF1

Supplemental Table 1 Gene Symbol FDR corrected p-value PLOD1 CSRP2 PFKP ADFP ADM C10orf10 GPI LOX PLEKHA2 WIPF1 Supplemental Table 1 Gene Symbol FDR corrected p-value PLOD1 4.52E-18 PDK1 6.77E-18 CSRP2 4.42E-17 PFKP 1.23E-14 MSH2 3.79E-13 NARF_A 5.56E-13 ADFP 5.56E-13 FAM13A1 1.56E-12 FAM29A_A 1.22E-11 CA9 1.54E-11

More information

Transcriptional regulation of BRCA1 expression by a metabolic switch: Di, Fernandez, De Siervi, Longo, and Gardner. H3K4Me3

Transcriptional regulation of BRCA1 expression by a metabolic switch: Di, Fernandez, De Siervi, Longo, and Gardner. H3K4Me3 ChIP H3K4Me3 enrichment.25.2.15.1.5 H3K4Me3 H3K4Me3 ctrl H3K4Me3 + E2 NS + E2 1. kb kb +82 kb Figure S1. Estrogen promotes entry of MCF-7 into the cell cycle but does not significantly change activation-associated

More information

Supplementary Information: Materials and Methods. GST and GST-p53 were purified according to standard protocol after

Supplementary Information: Materials and Methods. GST and GST-p53 were purified according to standard protocol after Supplementary Information: Materials and Methods Recombinant protein expression and in vitro kinase assay. GST and GST-p53 were purified according to standard protocol after induction with.5mm IPTG for

More information

Nature Biotechnology: doi: /nbt Supplementary Figure 1

Nature Biotechnology: doi: /nbt Supplementary Figure 1 Supplementary Figure 1 Schematic and results of screening the combinatorial antibody library for Sox2 replacement activity. A single batch of MEFs were plated and transduced with doxycycline inducible

More information

Supplementary Materials

Supplementary Materials Supplementary Materials Supplementary Figure 1. PKM2 interacts with MLC2 in cytokinesis. a, U87, U87/EGFRvIII, and HeLa cells in cytokinesis were immunostained with DAPI and an anti-pkm2 antibody. Thirty

More information

Executing T-REX in mammalian cells

Executing T-REX in mammalian cells Supplementary Figure 1 Executing T-REX in mammalian cells HEK-293 cells cultured (a) in 2x 55 cm 2 adherent cell culture plates, and (b and c) in a 48-well multi-well adherent cell culture plate. No cover

More information

Multiplex Fluorescence Assays for Adherence Cells without Trypsinization

Multiplex Fluorescence Assays for Adherence Cells without Trypsinization Multiplex Fluorescence Assays for Adherence Cells without Trypsinization The combination of a bright field and three fluorescent channels allows the Celigo to perform many multiplexed assays. A gating

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/3/146/ra80/dc1 Supplementary Materials for DNMT1 Stability Is Regulated by Proteins Coordinating Deubiquitination and Acetylation-Driven Ubiquitination Zhanwen

More information

Supplementary Figure 1. The Hsp70 acetylation level is related to the co-chaperone binding of Hsp70 under various stress conditions.

Supplementary Figure 1. The Hsp70 acetylation level is related to the co-chaperone binding of Hsp70 under various stress conditions. Supplementary Figure 1. The Hsp70 acetylation level is related to the co-chaperone binding of Hsp70 under various stress conditions. 1 (a) Etoposide treatment gradually changes acetylation level and co-chaperone

More information

Product: Arrest-In TM Transfection Reagent for RNAi

Product: Arrest-In TM Transfection Reagent for RNAi Product: Arrest-In TM Transfection Reagent for RNAi Catalog #: ATR1740, ATR1741, ATR1742, ATR1743 Product Description Arrest-In transfection reagent is a proprietary polymeric formulation, developed and

More information

Supplementary Fig. 1. (A) Working model. The pluripotency transcription factor OCT4

Supplementary Fig. 1. (A) Working model. The pluripotency transcription factor OCT4 SUPPLEMENTARY FIGURE LEGENDS Supplementary Fig. 1. (A) Working model. The pluripotency transcription factor OCT4 directly up-regulates the expression of NIPP1 and CCNF that together inhibit protein phosphatase

More information

Thanasoula et al. - Fig. S1

Thanasoula et al. - Fig. S1 S HK1si G1 Thanasoula et al. - Fig. S1 G2/M HK2si 1 3 5 7 9 11 13 hours after double thymidine block release Figure S1. U2OS synchronous cell cycle progression. U2OS cells transfected with, POT1, HK1,

More information

Mock. Control. sirna1

Mock. Control. sirna1 siha CaSki Mock Control sirna1 Supplementary Data Figure 1: Photomicrographs of siha and CaSki cells taken 48 hours after mock transfection, transfection of control sirna or sirna1. (100X magnification).

More information

Supplemental Materials and Methods

Supplemental Materials and Methods Supplemental Materials and Methods Co-immunoprecipitation (Co-IP) assay Cells were lysed with NETN buffer (20 mm Tris-HCl, ph 8.0, 0 mm NaCl, 1 mm EDT, 0.5% Nonidet P-40) containing 50 mm β-glycerophosphate,

More information

As a control to demonstrate that we could isolate PCR products that result from ligating

As a control to demonstrate that we could isolate PCR products that result from ligating SUPPLEMENTAL INFORMATION (Mullen and Marzluff) RESULTS Oligo(dA) Clones and Oligo(dT) RT-PCR controls. As a control to demonstrate that we could isolate PCR products that result from ligating the authentic

More information

Nature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1. Validation of CDK9-inhibitor treatment.

Nature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1. Validation of CDK9-inhibitor treatment. Supplementary Figure 1 Validation of CDK9-inhibitor treatment. (a) Schematic of GAPDH with the middle of the amplicons indicated in base pairs. The transcription start site (TSS) and the terminal polyadenylation

More information

Online Supplementary Information

Online Supplementary Information Online Supplementary Information NLRP4 negatively regulates type I interferon signaling by targeting TBK1 for degradation via E3 ubiquitin ligase DTX4 Jun Cui 1,4,6,7, Yinyin Li 1,5,6,7, Liang Zhu 1, Dan

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/10/496/eaam6291/dc1 Supplementary Materials for Regulation of autophagy, NF-κB signaling, and cell viability by mir-124 in KRAS mutant mesenchymal-like NSCLC cells

More information

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1 Supplementary Figure 1 Endogenous gene tagging to study subcellular localization and chromatin binding. a, b, Schematic of experimental set-up to endogenously tag RNAi factors using the CRISPR Cas9 technology,

More information

Supplementary Information for: CRISPR/Cas9-based target validation. for p53-reactivating model compounds

Supplementary Information for: CRISPR/Cas9-based target validation. for p53-reactivating model compounds for: CRISPR/Cas9-based target validation for p53-reactivating model compounds Michael Wanzel 1,5, Jonas B. Vischedyk 1, Miriam P. Gittler 1, Niklas Gremke 1, Julia R. Seiz 1, Mirjam Hefter 1, Magdalena

More information

cells (MLEC) that produce luciferase under the control of the PAI-1 promoter in response to

cells (MLEC) that produce luciferase under the control of the PAI-1 promoter in response to Supplemental Materials and Methods TGF bioassay. To quantify the levels of active and total TGF, we used mink lung epithelial cells (MLEC) that produce luciferase under the control of the PAI-1 promoter

More information

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1 Supplementary Figure 1 Detection of MCM-subunit SUMOylation under normal growth conditions. a. Sumoylated forms of MCM subunits show differential shifts when SUMO is attached to differently sized tags.

More information

Supplementary Data. Flvcr1a TCTAAGGCCCAGTAGGACCC GGCCTCAACTGCCTGGGAGC AGAGGGCAACCTCGGTGTCC

Supplementary Data. Flvcr1a TCTAAGGCCCAGTAGGACCC GGCCTCAACTGCCTGGGAGC AGAGGGCAACCTCGGTGTCC Supplementary Data Supplementary Materials and Methods Measurement of reactive oxygen species accumulation in fresh intestinal rings Accumulation of reactive oxygen species in fresh intestinal rings was

More information

Supplemental Information. DNp63 Inhibits Oxidative Stress-Induced Cell. Death, Including Ferroptosis, and Cooperates with

Supplemental Information. DNp63 Inhibits Oxidative Stress-Induced Cell. Death, Including Ferroptosis, and Cooperates with Cell Reports, Volume 21 Supplemental Information DNp63 Inhibits Oxidative Stress-Induced Cell Death, Including Ferroptosis, and Cooperates with the BCL-2 Family to Promote Clonogenic Survival Gary X. Wang,

More information

a. Increased active HPSE (50 kda) protein expression upon infection with multiple herpes viruses: bovine

a. Increased active HPSE (50 kda) protein expression upon infection with multiple herpes viruses: bovine Fold change vs uninfeced MOI 0.1 MOI 1 MOI 0.1 MOI 1 MOI 0.001 MOI 0.01 Fold change vs uninfected a 6 4 2 50 kda HPSE * ** * * BHV PRV HSV-2 333 ** * 0 - + + - + + - + + b 50 kda HPSE 3 2 ** *** mock inf

More information

Supplementary Figure 1. APP cleavage assay. HEK293 cells were transfected with various

Supplementary Figure 1. APP cleavage assay. HEK293 cells were transfected with various Supplementary Figure 1. APP cleavage assay. HEK293 cells were transfected with various GST-tagged N-terminal truncated APP fragments including GST-APP full-length (FL), APP (123-695), APP (189-695), or

More information

Supplementary Figure 1, related to Figure 1. GAS5 is highly expressed in the cytoplasm of hescs, and positively correlates with pluripotency.

Supplementary Figure 1, related to Figure 1. GAS5 is highly expressed in the cytoplasm of hescs, and positively correlates with pluripotency. Supplementary Figure 1, related to Figure 1. GAS5 is highly expressed in the cytoplasm of hescs, and positively correlates with pluripotency. (a) Transfection of different concentration of GAS5-overexpressing

More information

Supplementary Figure 1. IFN-γ induces TRC dormancy. a, IFN-γ induced dormancy

Supplementary Figure 1. IFN-γ induces TRC dormancy. a, IFN-γ induced dormancy Supplementary Figure 1. IFN-γ induces TRC dormancy. a, IFN-γ induced dormancy of various tumor type TRCs, including H22 (murine hepatocarcinoma) and CT26 (murine colon cancer). Bar, 50 µm. b, B16 cells

More information

supplementary information

supplementary information DOI: 10.1038/ncb2172 Figure S1 p53 regulates cellular NADPH and lipid levels via inhibition of G6PD. (a) U2OS cells stably expressing p53 shrna or a control shrna were transfected with control sirna or

More information

Supplementary Figure 1. Confirmation of sirna in PC3 and H1299 cells PC3 (a) and H1299 (b) cells were transfected with sirna oligonucleotides

Supplementary Figure 1. Confirmation of sirna in PC3 and H1299 cells PC3 (a) and H1299 (b) cells were transfected with sirna oligonucleotides Supplementary Figure 1. Confirmation of sirna in PC3 and H1299 cells PC3 (a) and H1299 (b) cells were transfected with sirna oligonucleotides targeting RCP (SMARTPool (RCP) or two individual oligos (RCP#1

More information

Supplementary Figure 1. RAD51 and RAD51 paralogs are enriched spontaneously onto

Supplementary Figure 1. RAD51 and RAD51 paralogs are enriched spontaneously onto Supplementary Figure legends Supplementary Figure 1. and paralogs are enriched spontaneously onto the S-phase chromatin during DN replication. () Chromatin fractionation was carried out as described in

More information

kda

kda Relative VENUS/RFP fluorescence Relative fluorescence a min 2 min 4 min 6 min 8 min min Jas9-VENUS d kda 8 3 75 63 48 Jas9-VENUS Col- - + - + COR µm Jas9-VENUS 35 28 H2B-RFP 7 b c Overlay,2,8,6,4,2,6,4,2,8,6,4,2

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Supplementary Fig. 1 shrna mediated knockdown of ZRSR2 in K562 and 293T cells. (a) ZRSR2 transcript levels in stably transduced K562 cells were determined using qrt-pcr. GAPDH was

More information

Table 1. Primers, annealing temperatures, and product sizes for PCR amplification.

Table 1. Primers, annealing temperatures, and product sizes for PCR amplification. Table 1. Primers, annealing temperatures, and product sizes for PCR amplification. Gene Direction Primer sequence (5 3 ) Annealing Temperature Size (bp) BRCA1 Forward TTGCGGGAGGAAAATGGGTAGTTA 50 o C 292

More information

HPV E6 oncoprotein targets histone methyltransferases for modulating specific. Chih-Hung Hsu, Kai-Lin Peng, Hua-Ci Jhang, Chia-Hui Lin, Shwu-Yuan Wu,

HPV E6 oncoprotein targets histone methyltransferases for modulating specific. Chih-Hung Hsu, Kai-Lin Peng, Hua-Ci Jhang, Chia-Hui Lin, Shwu-Yuan Wu, 1 HPV E oncoprotein targets histone methyltransferases for modulating specific gene transcription 3 5 Chih-Hung Hsu, Kai-Lin Peng, Hua-Ci Jhang, Chia-Hui Lin, Shwu-Yuan Wu, Cheng-Ming Chiang, Sheng-Chung

More information

Supporting Information

Supporting Information Supporting Information Su et al. 10.1073/pnas.1211604110 SI Materials and Methods Cell Culture and Plasmids. Tera-1 and Tera-2 cells (ATCC: HTB- 105/106) were maintained in McCoy s 5A medium with 15% FBS

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Figure S1 The effect of T198A mutation on p27 stability. a, Hoechst 33342 staining for nuclei (see Fig 1d). Scale bar, 100 μm. b, Densitometric analysis of wild type and mutant p27 protein levels represented

More information

Supplementary information; Mungamuri et al., 2006

Supplementary information; Mungamuri et al., 2006 Supplementary information; Mungamuri et al., 6 Antibodies used for western blotting: The following antibodies were used for western blotting: antiser473 Akt (#4), antiakt (#97), antiser9 Gsk 3b (#9336),

More information

(a) Immunoblotting to show the migration position of Flag-tagged MAVS

(a) Immunoblotting to show the migration position of Flag-tagged MAVS Supplementary Figure 1 Characterization of six MAVS isoforms. (a) Immunoblotting to show the migration position of Flag-tagged MAVS isoforms. HEK293T Mavs -/- cells were transfected with constructs expressing

More information

Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate

Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate Supplementary Figure Legends Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate BC041951 in gastric cancer. (A) The flow chart for selected candidate lncrnas in 660 up-regulated

More information